- galaxy-commits - lists.galaxyproject.org

commit/galaxy-central: jgoecks: Trackster: do not use child tracks for now because they do not work with new request_redraw structure.
by Bitbucket 19 Sep '11

19 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/5344a6864d47/ changeset: 5344a6864d47 user: jgoecks date: 2011-09-19 06:07:24 summary: Trackster: do not use child tracks for now because they do not work with new request_redraw structure. affected #: 1 file (-1 bytes) --- a/static/scripts/trackster.js Thu Sep 15 17:10:39 2011 -0400 +++ b/static/scripts/trackster.js Mon Sep 19 00:07:24 2011 -0400 @@ -1228,7 +1228,7 @@ new_track = new ToolDataFeatureTrack(track_name, view, current_track.hda_ldda, undefined, {}, {}, current_track); new_track.change_mode(current_track.mode); } - this.track.add_track(new_track); + this.track.view.add_track(new_track); new_track.content_div.text("Starting job."); // Run tool. Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Comment the Trinity assembler out of the sample tool conf so that it must be explicitly enabled.
by Bitbucket 15 Sep '11

15 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/32b3ed6d5255/ changeset: 32b3ed6d5255 user: jgoecks date: 2011-09-15 23:10:39 summary: Comment the Trinity assembler out of the sample tool conf so that it must be explicitly enabled. affected #: 1 file (-1 bytes) --- a/tool_conf.xml.sample Wed Sep 14 14:41:19 2011 -0400 +++ b/tool_conf.xml.sample Thu Sep 15 17:10:39 2011 -0400 @@ -338,8 +338,11 @@ <tool file="ngs_rna/cufflinks_wrapper.xml" /><tool file="ngs_rna/cuffcompare_wrapper.xml" /><tool file="ngs_rna/cuffdiff_wrapper.xml" /> + <label text="Filtering" id="filtering" /><tool file="ngs_rna/filter_transcripts_via_tracking.xml" /></section> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: New API scripts to do POST/PUT/DELETE without any guidance. Use like:
by Bitbucket 14 Sep '11

14 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/0540dedaaca0/ changeset: 0540dedaaca0 user: natefoo date: 2011-09-14 20:40:38 summary: New API scripts to do POST/PUT/DELETE without any guidance. Use like: ./update.py key url param1=val param2=val affected #: 3 files (0 bytes) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: New API features:
by Bitbucket 14 Sep '11

14 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/ca6db8f67477/ changeset: ca6db8f67477 user: natefoo date: 2011-09-14 20:36:38 summary: New API features: * The @web.require_admin decorator can now be used on API methods * When using model.model_class.get_api_value(), api_*_visible_keys can now be mapper attributes to other model classes (get_api_value() recursion) * Monkeypatch the route mapper to contain a resource_with_deleted() method. This works just like the existing mapper.resource() method but adds extra routes. The following is a supplement to the Routes RESTful services documentation at: https://routes.groovie.org/restful.html Using: mapper.resources_with_deleted( "message", "items" ) Would result in the same routes as in the use of resource(), with the addition of: map.connect("deleted_messages", "/messages/deleted", controller=messages, action="index", deleted=True, conditions=dict(method=["GET"]) map.connect("deleted_message", "/messages/deleted/{id}", controller=messages, action="show", deleted=True, conditions=dict(method=["GET"]) map.connect("undelete_deleted_message", "/messages/deleted/{id}/undelete", controller=messages, action="index", conditions=dict(method=["POST"]) Which adds to the convention: GET /messages/deleted => messages.index(deleted=True) => url("deleted_messages") GET /messages/deleted/1 => messages.show(id, deleted=True) => url("deleted_message", id=1) POST /messages/deleted/1/undelete => messages.undelete(id) => url("undelete_deleted_message", id=1) affected #: 3 files (1.7 KB) --- a/lib/galaxy/model/item_attrs.py Tue Sep 13 16:55:17 2011 -0400 +++ b/lib/galaxy/model/item_attrs.py Wed Sep 14 14:36:38 2011 -0400 @@ -1,4 +1,5 @@ from sqlalchemy.sql.expression import func +from sqlalchemy.orm.collections import InstrumentedList # Cannot import galaxy.model b/c it creates a circular import graph. import galaxy import logging @@ -156,6 +157,13 @@ #api_collection_visible_keys = ( 'id' ) #api_element_visible_keys = ( 'id' ) def get_api_value( self, view='collection', value_mapper = None ): + def get_value( key, item ): + try: + return item.get_api_value( view=view, value_mapper=value_mapper ) + except: + if key in value_mapper: + return value_mapper.get( key )( item ) + return item if value_mapper is None: value_mapper = {} rval = {} @@ -165,9 +173,13 @@ raise Exception( 'Unknown API view: %s' % view ) for key in visible_keys: try: - rval[key] = self.__getattribute__( key ) - if key in value_mapper: - rval[key] = value_mapper.get( key )( rval[key] ) + item = self.__getattribute__( key ) + if type( item ) == InstrumentedList: + rval[key] = [] + for i in item: + rval[key].append( get_value( key, i ) ) + else: + rval[key] = get_value( key, item ) except AttributeError: rval[key] = None return rval --- a/lib/galaxy/web/framework/__init__.py Tue Sep 13 16:55:17 2011 -0400 +++ b/lib/galaxy/web/framework/__init__.py Wed Sep 14 14:36:38 2011 -0400 @@ -117,7 +117,7 @@ return error trans.response.set_content_type( "application/json" ) trans.set_user( provided_key.user ) -# Perform api_run_as processing, possibly changing identity + # Perform api_run_as processing, possibly changing identity if 'run_as' in kwargs: if not trans.user_can_do_run_as(): error_message = 'User does not have permissions to run jobs as another user' @@ -147,13 +147,18 @@ def require_admin( func ): def decorator( self, trans, *args, **kwargs ): if not trans.user_is_admin(): + msg = "You must be an administrator to access this feature." admin_users = trans.app.config.get( "admin_users", "" ).split( "," ) + user = trans.get_user() if not admin_users: - return trans.show_error_message( "You must be logged in as an administrator to access this feature, but no administrators are set in the Galaxy configuration." ) - user = trans.get_user() - if not user: - return trans.show_error_message( "You must be logged in as an administrator to access this feature." ) - return trans.show_error_message( "You must be an administrator to access this feature." ) + msg = "You must be logged in as an administrator to access this feature, but no administrators are set in the Galaxy configuration." + elif not user: + msg = "You must be logged in as an administrator to access this feature." + trans.response.status = 403 + if trans.response.get_content_type() == 'application/json': + return msg + else: + return trans.show_error_message( msg ) return func( self, trans, *args, **kwargs ) return decorator --- a/lib/galaxy/web/framework/base.py Tue Sep 13 16:55:17 2011 -0400 +++ b/lib/galaxy/web/framework/base.py Wed Sep 14 14:36:38 2011 -0400 @@ -29,6 +29,21 @@ log = logging.getLogger( __name__ ) +def __resource_with_deleted( self, member_name, collection_name, **kwargs ): + """ + Method to monkeypatch on to routes.mapper.Mapper which does the same thing + as resource() with the addition of standardized routes for handling + elements in Galaxy's "deleted but not really deleted" fashion. + """ + collection_path = kwargs.get( 'path_prefix', '' ) + '/' + collection_name + '/deleted' + member_path = collection_path + '/:id' + self.connect( 'deleted_' + collection_name, collection_path, controller=collection_name, action='index', deleted=True ) + self.connect( 'deleted_' + member_name, member_path, controller=collection_name, action='show', deleted=True ) + self.connect( 'undelete_deleted_' + member_name, member_path + '/undelete', controller=collection_name, action='undelete', + conditions=dict( method=['POST'] ) ) + self.resource( member_name, collection_name, **kwargs ) +routes.Mapper.resource_with_deleted = __resource_with_deleted + class WebApplication( object ): """ A simple web application which maps requests to objects using routes, @@ -320,6 +335,8 @@ Sets the Content-Type header """ self.headers[ "content-type" ] = type + def get_content_type( self ): + return self.headers[ "content-type" ] def send_redirect( self, url ): """ Send an HTTP redirect response to (target `url`) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Trackster: improve method for fetching additional data and simply data fetching.
by Bitbucket 13 Sep '11

13 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/c6452f6558ee/ changeset: c6452f6558ee user: jgoecks date: 2011-09-13 22:55:17 summary: Trackster: improve method for fetching additional data and simply data fetching. affected #: 3 files (1.4 KB) --- a/lib/galaxy/visualization/tracks/data_providers.py Mon Sep 12 14:51:26 2011 -0400 +++ b/lib/galaxy/visualization/tracks/data_providers.py Tue Sep 13 16:55:17 2011 -0400 @@ -3,7 +3,7 @@ """ import sys -from math import floor, ceil, log, pow +from math import ceil, log import pkg_resources pkg_resources.require( "bx-python" ) if sys.version_info[:2] == (2, 4): @@ -13,14 +13,12 @@ from galaxy.datatypes.util.gff_util import * from galaxy.util.json import from_json_string from bx.interval_index_file import Indexes -from bx.arrays.array_tree import FileArrayTreeDict from bx.bbi.bigwig_file import BigWigFile from galaxy.util.lrucache import LRUCache from galaxy.visualization.tracks.summary import * import galaxy_utils.sequence.vcf from galaxy.datatypes.tabular import Vcf from galaxy.datatypes.interval import Bed, Gff, Gtf -from galaxy.datatypes.util.gff_util import parse_gff_attributes from pysam import csamtools, ctabix @@ -32,7 +30,20 @@ return None else: return float(n) - + +def get_bounds( reads, start_pos_index, end_pos_index ): + """ + Returns the minimum and maximum position for a set of reads. + """ + max_low = sys.maxint + max_high = -sys.maxint + for read in reads: + if read[ start_pos_index ] < max_low: + max_low = read[ start_pos_index ] + if read[ end_pos_index ] > max_high: + max_high = read[ end_pos_index ] + return max_low, max_high + class TracksDataProvider( object ): """ Base class for tracks data providers. """ @@ -75,8 +86,11 @@ def get_data( self, chrom, start, end, start_val=0, max_vals=None, **kwargs ): """ Returns data in region defined by chrom, start, and end. start_val and - max_vals are used to denote the data to return: start_val is the first value to + max_vals are used to denote the data to return: start_val is the first element to return and max_vals indicates the number of values to return. + + Return value must be a dictionary with the following attributes: + dataset_type, data """ # Override. pass @@ -218,18 +232,23 @@ def get_data( self, chrom, start, end, start_val=0, max_vals=sys.maxint, **kwargs ): """ - Fetch reads in the region. + Fetch reads in the region and additional metadata. - Each read is a list with the format - [<guid>, <start>, <end>, <name>, <read_1>, <read_2>] - where <read_1> has the format - [<start>, <end>, <cigar>, ?<read_seq>?] - and <read_2> has the format - [<start>, <end>, <cigar>, ?<read_seq>?] - For single-end reads, read has format: - [<guid>, <start>, <end>, <name>, cigar, seq] - NOTE: read end and sequence data are not valid for reads outside of - requested region and should not be used. + Returns a dict with the following attributes: + data - a list of reads with the format + [<guid>, <start>, <end>, <name>, <read_1>, <read_2>] + where <read_1> has the format + [<start>, <end>, <cigar>, ?<read_seq>?] + and <read_2> has the format + [<start>, <end>, <cigar>, ?<read_seq>?] + For single-end reads, read has format: + [<guid>, <start>, <end>, <name>, cigar, seq] + NOTE: read end and sequence data are not valid for reads outside of + requested region and should not be used. + + max_low - lowest coordinate for the returned reads + max_high - highest coordinate for the returned reads + message - error/informative message """ start, end = int(start), int(end) orig_data_filename = self.original_dataset.file_name @@ -304,9 +323,13 @@ r2 = [ read['mate_start'], read['mate_start'] ] results.append( [ "%i_%s" % ( read_start, qname ), read_start, read_end, qname, r1, r2 ] ) - + + # Clean up. bamfile.close() - return { 'data': results, 'message': message } + + max_low, max_high = get_bounds( results, 1, 2 ) + + return { 'data': results, 'message': message, 'max_low': max_low, 'max_high': max_high } class BBIDataProvider( TracksDataProvider ): """ @@ -334,9 +357,10 @@ return None all_dat = all_dat[0] # only 1 summary - return { 'max': float( all_dat['max'] ), \ - 'min': float( all_dat['min'] ), \ - 'total_frequency': float( all_dat['coverage'] ) } + return { 'data' : { 'max': float( all_dat['max'] ), \ + 'min': float( all_dat['min'] ), \ + 'total_frequency': float( all_dat['coverage'] ) } \ + } start = int(start) end = int(end) @@ -361,7 +385,7 @@ result.append( (pos, float_nan(dat_dict['mean']) ) ) pos += step_size - return result + return { 'data': result } class BigBedDataProvider( BBIDataProvider ): def _get_dataset( self ): @@ -654,7 +678,7 @@ float( feature[5] )] rval.append(payload) - return { 'data_type' : 'vcf', 'data': rval, 'message': message } + return { 'data': rval, 'message': message } class GFFDataProvider( TracksDataProvider ): """ --- a/lib/galaxy/web/controllers/tracks.py Mon Sep 12 14:51:26 2011 -0400 +++ b/lib/galaxy/web/controllers/tracks.py Tue Sep 13 16:55:17 2011 -0400 @@ -530,15 +530,9 @@ data_provider = data_provider_class( converted_dataset=converted_dataset, original_dataset=dataset, dependencies=deps ) # Get and return data from data_provider. - data = data_provider.get_data( chrom, low, high, int(start_val), int(max_vals), **kwargs ) - message = None - if isinstance(data, dict) and 'message' in data: - message = data['message'] - tracks_dataset_type = data.get( 'data_type', tracks_dataset_type ) - track_data = data['data'] - else: - track_data = data - return { 'dataset_type': tracks_dataset_type, 'extra_info': extra_info, 'data': track_data, 'message': message } + result = data_provider.get_data( chrom, low, high, int(start_val), int(max_vals), **kwargs ) + result.update( { 'dataset_type': tracks_dataset_type, 'extra_info': extra_info } ) + return result @web.json def save( self, trans, **kwargs ): --- a/static/scripts/trackster.js Mon Sep 12 14:51:26 2011 -0400 +++ b/static/scripts/trackster.js Tue Sep 13 16:55:17 2011 -0400 @@ -443,9 +443,9 @@ $.extend(extra_params, {start_val: cur_data.data.length + 1}); } else if (req_type === this.BROAD_DATA_REQ) { - // Set query low to be past the last feature returned so that an area of extreme feature depth - // is bypassed. - query_low = cur_data.data[cur_data.data.length - 1][2] + 1; + // To get past an area of extreme feature depth, set query low to be after either + // (a) the maximum high or HACK/FIXME (b) the end of the last feature returned. + query_low = (cur_data.max_high ? cur_data.max_high : cur_data.data[cur_data.data.length - 1][2]) + 1; } // @@ -463,6 +463,9 @@ // Update data and message. if (result.data) { result.data = cur_data.data.concat(result.data); + if (result.max_low) { + result.max_low = cur_data.max_low; + } if (result.message) { // HACK: replace number in message with current data length. Works but is ugly. result.message = result.message.replace(/[0-9]+/, result.data.length); Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: jgoecks: Fix trackster bug in determining tile bounds and in documentation.
by Bitbucket 12 Sep '11

12 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/cafb70f10379/ changeset: cafb70f10379 user: jgoecks date: 2011-09-12 20:51:26 summary: Fix trackster bug in determining tile bounds and in documentation. affected #: 1 file (0 bytes) --- a/static/scripts/trackster.js Fri Sep 09 16:05:52 2011 -0400 +++ b/static/scripts/trackster.js Mon Sep 12 14:51:26 2011 -0400 @@ -2495,7 +2495,7 @@ var tile_low = tile_index * DENSITY * resolution, tile_length = DENSITY * resolution, // Tile high cannot be larger than view.max_high, which the chromosome length. - tile_high = (tile_low + tile_length <= this.view.max ? tile_low + tile_length : this.view.max_high); + tile_high = (tile_low + tile_length <= this.view.max_high ? tile_low + tile_length : this.view.max_high); return [tile_low, tile_high]; }, /** @@ -2998,7 +2998,7 @@ * @param mode mode to draw in * @param resolution view resolution * @param tile_index index of tile to be drawn - * @param w_scale base pairs per pixel + * @param w_scale pixels per base * @param ref_seq reference sequence data */ draw_tile: function(result, mode, resolution, tile_index, w_scale, ref_seq) { Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Two minor but important bug fixes in searching for and displaying tool shed repositories.
by Bitbucket 09 Sep '11

09 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/35063fa0b2cb/ changeset: 35063fa0b2cb user: greg date: 2011-09-09 22:05:52 summary: Two minor but important bug fixes in searching for and displaying tool shed repositories. affected #: 2 files (513 bytes) --- a/lib/galaxy/webapps/community/controllers/common.py Fri Sep 09 12:15:27 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/common.py Fri Sep 09 16:05:52 2011 -0400 @@ -380,7 +380,7 @@ return message, status def get_repository_by_name( trans, name ): """Get a repository from the database via name""" - return trans.sa_session.query( app.model.Repository ).filter_by( name=name ).one() + return trans.sa_session.query( trans.model.Repository ).filter_by( name=name ).one() def get_changectx_for_changeset( trans, repo, changeset_revision, **kwd ): """Retrieve a specified changectx from a repository""" for changeset in repo.changelog: --- a/lib/galaxy/webapps/community/controllers/repository.py Fri Sep 09 12:15:27 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/repository.py Fri Sep 09 16:05:52 2011 -0400 @@ -241,6 +241,14 @@ # What we've done is rendered the search box for the RepositoryListGrid on the grid.mako # template for the CategoryListGrid. See ~/templates/webapps/community/category/grid.mako. # Since we are searching repositories and not categories, redirect to browse_repositories(). + if 'id' in kwd and 'f-free-text-search' in kwd and kwd[ 'id' ] == kwd[ 'f-free-text-search' ]: + # The value of 'id' has been set to the search string, which is a repository name. + # We'll try to get the desired encoded repository id to pass on. + try: + repository = get_repository_by_name( trans, kwd[ 'id' ] ) + kwd[ 'id' ] = trans.security.encode_id( repository.id ) + except: + pass return self.browse_repositories( trans, **kwd ) if 'operation' in kwd: operation = kwd['operation'].lower() Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Fix tabs in secure_hash_message_digest.xml.
by Bitbucket 09 Sep '11

09 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/a0a77ce93344/ changeset: a0a77ce93344 user: dan date: 2011-09-09 18:15:27 summary: Fix tabs in secure_hash_message_digest.xml. affected #: 1 file (12 bytes) --- a/tools/filters/secure_hash_message_digest.xml Fri Sep 09 12:01:43 2011 -0400 +++ b/tools/filters/secure_hash_message_digest.xml Fri Sep 09 12:15:27 2011 -0400 @@ -2,10 +2,10 @@ <description>on a dataset</description><command interpreter="python">secure_hash_message_digest.py --input "${input1}" --output "${out_file1}" #if $algorithms.value: - #for $algorithm in str( $algorithms ).split( "," ): - --algorithm "${algorithm}" - #end for - #end if + #for $algorithm in str( $algorithms ).split( "," ): + --algorithm "${algorithm}" + #end for + #end if </command><inputs><param format="data" name="input1" type="data" label="Text file"/> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Add tool for calculating Secure Hashes / Message Digests of a dataset using the user selected algorithms.
by Bitbucket 09 Sep '11

09 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/ea163dae4490/ changeset: ea163dae4490 user: dan date: 2011-09-09 18:01:43 summary: Add tool for calculating Secure Hashes / Message Digests of a dataset using the user selected algorithms. affected #: 4 files (59 bytes) --- a/tool_conf.xml.sample Fri Sep 09 11:18:05 2011 -0400 +++ b/tool_conf.xml.sample Fri Sep 09 12:01:43 2011 -0400 @@ -56,6 +56,7 @@ <tool file="filters/tailWrapper.xml" /><tool file="filters/trimmer.xml" /><tool file="filters/wc_gnu.xml" /> + <tool file="filters/secure_hash_message_digest.xml" /><tool file="stats/dna_filtering.xml" /><tool file="new_operations/tables_arithmetic_operations.xml" /></section> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Add the ability for a tool shed repository owner to reset the repository metadata for any change set revision that has associated repository metadata (previously could only be reset for repository tip)
by Bitbucket 09 Sep '11

09 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/7547a3131862/ changeset: 7547a3131862 user: greg date: 2011-09-09 17:18:05 summary: Add the ability for a tool shed repository owner to reset the repository metadata for any change set revision that has associated repository metadata (previously could only be reset for repository tip) affected #: 5 files (3.1 KB) --- a/lib/galaxy/webapps/community/controllers/common.py Fri Sep 09 10:16:48 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/common.py Fri Sep 09 11:18:05 2011 -0400 @@ -110,7 +110,7 @@ """Get last metadata defined for a specified repository from the database""" return trans.sa_session.query( trans.model.RepositoryMetadata ) \ .filter( trans.model.RepositoryMetadata.table.c.repository_id == trans.security.decode_id( id ) ) \ - .order_by( trans.model.RepositoryMetadata.table.c.update_time.desc() ) \ + .order_by( trans.model.RepositoryMetadata.table.c.id.desc() ) \ .first() def generate_workflow_metadata( trans, id, changeset_revision, exported_workflow_dict, metadata_dict ): """ @@ -163,7 +163,7 @@ repository.name, tool.id, tool.version ) -def generate_tool_metadata( trans, id, changeset_revision, root, name, tool, metadata_dict ): +def generate_tool_metadata( trans, id, changeset_revision, tool_config, tool, metadata_dict ): """ Update the received metadata_dict with changes that have been applied to the received tool. @@ -189,7 +189,7 @@ version=tool.version, description=tool.description, version_string_cmd = tool.version_string_cmd, - tool_config=os.path.join( root, name ), + tool_config=tool_config, requirements=tool_requirements, tests=tool_tests ) if 'tools' in metadata_dict: @@ -249,49 +249,87 @@ ctx = get_changectx_for_changeset( trans, repo, changeset_revision ) if ctx is not None: metadata_dict = {} - for root, dirs, files in os.walk( repo_dir ): - if not root.find( '.hg' ) >= 0 and not root.find( 'hgrc' ) >= 0: - if '.hg' in dirs: - # Don't visit .hg directories - should be impossible since we don't - # allow uploaded archives that contain .hg dirs, but just in case... - dirs.remove( '.hg' ) - if 'hgrc' in files: - # Don't include hgrc files in commit. - files.remove( 'hgrc' ) - for name in files: - # Find all tool configs. - if name.endswith( '.xml' ): - try: - full_path = os.path.abspath( os.path.join( root, name ) ) - tool = load_tool( trans, full_path ) - if tool is not None: - # Update the list metadata dictionaries for tools in metadata_dict. - metadata_dict = generate_tool_metadata( trans, id, changeset_revision, root, name, tool, metadata_dict ) - except Exception, e: - invalid_files.append( ( name, str( e ) ) ) - # Find all exported workflows - elif name.endswith( '.ga' ): - try: - full_path = os.path.abspath( os.path.join( root, name ) ) - # Convert workflow data from json - fp = open( full_path, 'rb' ) - workflow_text = fp.read() - fp.close() - exported_workflow_dict = from_json_string( workflow_text ) - # Update the list of metadata dictionaries for workflows in metadata_dict. - metadata_dict = generate_workflow_metadata( trans, id, changeset_revision, exported_workflow_dict, metadata_dict ) - except Exception, e: - invalid_files.append( ( name, str( e ) ) ) + if changeset_revision == repository.tip: + for root, dirs, files in os.walk( repo_dir ): + if not root.find( '.hg' ) >= 0 and not root.find( 'hgrc' ) >= 0: + if '.hg' in dirs: + # Don't visit .hg directories - should be impossible since we don't + # allow uploaded archives that contain .hg dirs, but just in case... + dirs.remove( '.hg' ) + if 'hgrc' in files: + # Don't include hgrc files in commit. + files.remove( 'hgrc' ) + for name in files: + # Find all tool configs. + if name.endswith( '.xml' ): + try: + full_path = os.path.abspath( os.path.join( root, name ) ) + tool = load_tool( trans, full_path ) + if tool is not None: + # Update the list metadata dictionaries for tools in metadata_dict. + tool_config = os.path.join( root, name ) + metadata_dict = generate_tool_metadata( trans, id, changeset_revision, tool_config, tool, metadata_dict ) + except Exception, e: + invalid_files.append( ( name, str( e ) ) ) + # Find all exported workflows + elif name.endswith( '.ga' ): + try: + full_path = os.path.abspath( os.path.join( root, name ) ) + # Convert workflow data from json + fp = open( full_path, 'rb' ) + workflow_text = fp.read() + fp.close() + exported_workflow_dict = from_json_string( workflow_text ) + # Update the list of metadata dictionaries for workflows in metadata_dict. + metadata_dict = generate_workflow_metadata( trans, id, changeset_revision, exported_workflow_dict, metadata_dict ) + except Exception, e: + invalid_files.append( ( name, str( e ) ) ) + else: + # Get all tool config file names from the hgweb url, something like: + # /repos/test/convert_chars1/file/e58dcf0026c7/convert_characters.xml + for filename in ctx: + # Find all tool configs - should not have to update metadata for workflows. + if filename.endswith( '.xml' ): + fctx = ctx[ filename ] + # Write the contents of the old tool config to a temporary file. + fh = tempfile.NamedTemporaryFile( 'w' ) + tmp_filename = fh.name + fh.close() + fh = open( tmp_filename, 'w' ) + fh.write( fctx.data() ) + fh.close() + try: + tool = load_tool( trans, tmp_filename ) + if tool is not None: + # Update the list metadata dictionaries for tools in metadata_dict. Note that filename + # here is the relative path to the config file within the change set context, something + # like filtering.xml, but when the change set was the repository tip, the value was + # something like database/community_files/000/repo_1/filtering.xml. This shouldn't break + # anything, but may result in a bit of confusion when maintaining the code / data over time. + metadata_dict = generate_tool_metadata( trans, id, changeset_revision, filename, tool, metadata_dict ) + except Exception, e: + invalid_files.append( ( name, str( e ) ) ) + try: + os.unlink( tmp_filename ) + except: + pass if metadata_dict: - if new_tool_metadata_required( trans, id, metadata_dict ) or new_workflow_metadata_required( trans, id, metadata_dict ): - # Create a new repository_metadata table row. - repository_metadata = trans.model.RepositoryMetadata( repository.id, changeset_revision, metadata_dict ) - trans.sa_session.add( repository_metadata ) - trans.sa_session.flush() + if changeset_revision == repository.tip: + if new_tool_metadata_required( trans, id, metadata_dict ) or new_workflow_metadata_required( trans, id, metadata_dict ): + # Create a new repository_metadata table row. + repository_metadata = trans.model.RepositoryMetadata( repository.id, changeset_revision, metadata_dict ) + trans.sa_session.add( repository_metadata ) + trans.sa_session.flush() + else: + # Update the last saved repository_metadata table row. + repository_metadata = get_latest_repository_metadata( trans, id ) + repository_metadata.changeset_revision = changeset_revision + repository_metadata.metadata = metadata_dict + trans.sa_session.add( repository_metadata ) + trans.sa_session.flush() else: - # Update the last saved repository_metadata table row. - repository_metadata = get_latest_repository_metadata( trans, id ) - repository_metadata.changeset_revision = changeset_revision + # We're re-generating metadata for an old repository revision. + repository_metadata = get_repository_metadata_by_changeset_revision( trans, id, changeset_revision ) repository_metadata.metadata = metadata_dict trans.sa_session.add( repository_metadata ) trans.sa_session.flush() --- a/lib/galaxy/webapps/community/controllers/repository.py Fri Sep 09 10:16:48 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/repository.py Fri Sep 09 11:18:05 2011 -0400 @@ -1237,22 +1237,26 @@ # /repos/test/convert_chars1/file/e58dcf0026c7/convert_characters.xml old_tool_config_file_name = tool_config.split( '/' )[ -1 ] ctx = get_changectx_for_changeset( trans, repo, changeset_revision ) + fctx = None for filename in ctx: if filename == old_tool_config_file_name: fctx = ctx[ filename ] break - # Write the contents of the old tool config to a temporary file. - fh = tempfile.NamedTemporaryFile( 'w' ) - tmp_filename = fh.name - fh.close() - fh = open( tmp_filename, 'w' ) - fh.write( fctx.data() ) - fh.close() - tool = load_tool( trans, tmp_filename ) - try: - os.unlink( tmp_filename ) - except: - pass + if fctx: + # Write the contents of the old tool config to a temporary file. + fh = tempfile.NamedTemporaryFile( 'w' ) + tmp_filename = fh.name + fh.close() + fh = open( tmp_filename, 'w' ) + fh.write( fctx.data() ) + fh.close() + tool = load_tool( trans, tmp_filename ) + try: + os.unlink( tmp_filename ) + except: + pass + else: + tool = None tool_state = self.__new_state( trans ) is_malicious = change_set_is_malicious( trans, repository_id, repository.tip ) return trans.fill_template( "/webapps/community/repository/tool_form.mako", --- a/lib/galaxy/webapps/community/model/mapping.py Fri Sep 09 10:16:48 2011 -0400 +++ b/lib/galaxy/webapps/community/model/mapping.py Fri Sep 09 11:18:05 2011 -0400 @@ -194,7 +194,7 @@ categories=relation( RepositoryCategoryAssociation ), ratings=relation( RepositoryRatingAssociation, order_by=desc( RepositoryRatingAssociation.table.c.update_time ), backref="repositories" ), user=relation( User.mapper ), - downloadable_revisions=relation( RepositoryMetadata, order_by=desc( RepositoryMetadata.table.c.update_time ) ) ) ) + downloadable_revisions=relation( RepositoryMetadata, order_by=desc( RepositoryMetadata.table.c.id ) ) ) ) assign_mapper( context, RepositoryMetadata, RepositoryMetadata.table, properties=dict( repository=relation( Repository ) ) ) --- a/templates/webapps/community/repository/common.mako Fri Sep 09 10:16:48 2011 -0400 +++ b/templates/webapps/community/repository/common.mako Fri Sep 09 11:18:05 2011 -0400 @@ -176,20 +176,16 @@ %endif %endif %if can_set_metadata: - %if repository.tip == changeset_revision: - ## TODO: when we support previewing older versions of tools, we - ## should allow resetting metadata on the older versions as well. - <form name="set_metadata" action="${h.url_for( controller='repository', action='set_metadata', id=trans.security.encode_id( repository.id ), ctx_str=changeset_revision )}" method="post"> - <div class="form-row"> - <div style="float: left; width: 250px; margin-right: 10px;"> - <input type="submit" name="set_metadata_button" value="Reset metadata"/> - </div> - <div class="toolParamHelp" style="clear: both;"> - Inspect the repository and reset the above attributes for the repository tip. - </div> + <form name="set_metadata" action="${h.url_for( controller='repository', action='set_metadata', id=trans.security.encode_id( repository.id ), ctx_str=changeset_revision )}" method="post"> + <div class="form-row"> + <div style="float: left; width: 250px; margin-right: 10px;"> + <input type="submit" name="set_metadata_button" value="Reset metadata"/></div> - </form> - %endif + <div class="toolParamHelp" style="clear: both;"> + Inspect the repository and reset the above attributes for the repository tip. + </div> + </div> + </form> %endif </div></div> --- a/templates/webapps/community/repository/tool_form.mako Fri Sep 09 10:16:48 2011 -0400 +++ b/templates/webapps/community/repository/tool_form.mako Fri Sep 09 11:18:05 2011 -0400 @@ -152,26 +152,30 @@ ${render_msg( message, status )} %endif - <div class="toolForm" id="${tool.id}"> - <div class="toolFormTitle">${tool.name} (version ${tool.version})</div> - <div class="toolFormBody"> - <form id="tool_form" name="tool_form" action="" method="get"> - <input type="hidden" name="tool_state" value="${util.object_to_string( tool_state.encode( tool, app ) )}"> - ${do_inputs( tool.inputs_by_page[ tool_state.page ], tool_state.inputs, "" )} - </form> + %if tool: + <div class="toolForm" id="${tool.id}"> + <div class="toolFormTitle">${tool.name} (version ${tool.version})</div> + <div class="toolFormBody"> + <form id="tool_form" name="tool_form" action="" method="get"> + <input type="hidden" name="tool_state" value="${util.object_to_string( tool_state.encode( tool, app ) )}"> + ${do_inputs( tool.inputs_by_page[ tool_state.page ], tool_state.inputs, "" )} + </form> + </div></div> - </div> - %if tool.help: - <div class="toolHelp"> - <div class="toolHelpBody"> - <% - # Convert to unicode to display non-ascii characters. - if type( tool.help ) is not unicode: - tool.help = unicode( tool.help, 'utf-8') - %> - ${tool.help} - </div> - </div> + %if tool.help: + <div class="toolHelp"> + <div class="toolHelpBody"> + <% + # Convert to unicode to display non-ascii characters. + if type( tool.help ) is not unicode: + tool.help = unicode( tool.help, 'utf-8') + %> + ${tool.help} + </div> + </div> + %endif + %else: + Tool not properly loaded. %endif </body></html> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Add the ability for a user to log out of all user sessions. Function can be accessed under user preferences when logged in.
by Bitbucket 09 Sep '11

09 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/148dc33de394/ changeset: 148dc33de394 user: dan date: 2011-09-09 16:16:48 summary: Add the ability for a user to log out of all user sessions. Function can be accessed under user preferences when logged in. affected #: 3 files (1.2 KB) --- a/lib/galaxy/web/controllers/user.py Thu Sep 08 12:09:10 2011 -0400 +++ b/lib/galaxy/web/controllers/user.py Fri Sep 09 10:16:48 2011 -0400 @@ -363,7 +363,7 @@ else: refresh_frames = [ 'masthead', 'history' ] message, status, user, success = self.__validate_login( trans, webapp, **kwd ) - if success and referer and referer != trans.request.base + url_for( controller='user', action='logout' ): + if success and referer and not referer.startswith( trans.request.base + url_for( controller='user', action='logout' ) ): redirect_url = referer elif success: redirect_url = url_for( '/' ) @@ -414,7 +414,7 @@ success = True return ( message, status, user, success ) @web.expose - def logout( self, trans, webapp='galaxy' ): + def logout( self, trans, webapp='galaxy', logout_all=False ): if webapp == 'galaxy': if trans.app.config.require_login: refresh_frames = [ 'masthead', 'history', 'tools' ] @@ -424,7 +424,7 @@ refresh_frames = [ 'masthead' ] # Since logging an event requires a session, we'll log prior to ending the session trans.log_event( "User logged out" ) - trans.handle_user_logout() + trans.handle_user_logout( logout_all=logout_all ) message = 'You have been logged out.<br>You can log in again, <a target="_top" href="%s">go back to the page you were visiting</a> or <a target="_top" href="%s">go to the home page</a>.' % \ ( trans.request.referer, url_for( '/' ) ) return trans.fill_template( '/user/logout.mako', --- a/lib/galaxy/web/framework/__init__.py Thu Sep 08 12:09:10 2011 -0400 +++ b/lib/galaxy/web/framework/__init__.py Fri Sep 09 10:16:48 2011 -0400 @@ -543,7 +543,7 @@ self.sa_session.flush() # This method is not called from the Galaxy reports, so the cookie will always be galaxysession self.__update_session_cookie( name=cookie_name ) - def handle_user_logout( self ): + def handle_user_logout( self, logout_all=False ): """ Logout the current user: - invalidate the current session @@ -553,6 +553,14 @@ prev_galaxy_session.is_valid = False self.galaxy_session = self.__create_new_session( prev_galaxy_session ) self.sa_session.add_all( ( prev_galaxy_session, self.galaxy_session ) ) + galaxy_user_id = prev_galaxy_session.user_id + if logout_all and galaxy_user_id is not None: + for other_galaxy_session in self.sa_session.query( self.app.model.GalaxySession ) \ + .filter( and_( self.app.model.GalaxySession.table.c.user_id==galaxy_user_id, + self.app.model.GalaxySession.table.c.is_valid==True, + self.app.model.GalaxySession.table.c.id!=prev_galaxy_session.id ) ): + other_galaxy_session.is_valid = False + self.sa_session.add( other_galaxy_session ) self.sa_session.flush() # This method is not called from the Galaxy reports, so the cookie will always be galaxysession self.__update_session_cookie( name='galaxysession' ) --- a/templates/user/index.mako Thu Sep 08 12:09:10 2011 -0400 +++ b/templates/user/index.mako Fri Sep 09 10:16:48 2011 -0400 @@ -18,6 +18,13 @@ %if trans.app.config.enable_openid: <li><a href="${h.url_for( controller='user', action='openid_manage', cntrller=cntrller )}">${ ('Manage OpenIDs')}</a> linked to your account</li> %endif + %if trans.app.config.use_remote_user: + %if trans.app.config.remote_user_logout_href: + <li><a href="${trans.app.config.remote_user_logout_href}" target="_top">${_('Logout')}</a></li> + %endif + %else: + <li><a href="${h.url_for( controller='user', action='logout', logout_all=True )}" target="_top">${_('Logout')}</a> ${_('of all user sessions')}</li> + %endif %else: <li><a href="${h.url_for( controller='user', action='manage_user_info', cntrller=cntrller, webapp='community' )}">${_('Manage your information')}</a></li> %endif Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Make it easier to run helper.py from outside the galaxy-dist root directory.
by Bitbucket 08 Sep '11

08 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/8a8a587e2167/ changeset: 8a8a587e2167 user: natefoo date: 2011-09-08 18:09:10 summary: Make it easier to run helper.py from outside the galaxy-dist root directory. affected #: 1 file (102 bytes) --- a/scripts/helper.py Thu Sep 08 10:40:44 2011 -0400 +++ b/scripts/helper.py Thu Sep 08 12:09:10 2011 -0400 @@ -9,8 +9,10 @@ from ConfigParser import ConfigParser from optparse import OptionParser +default_config = os.path.abspath( os.path.join( os.path.dirname( __file__ ), '..', 'universe_wsgi.ini') ) + parser = OptionParser() -parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default='universe_wsgi.ini' ) +parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default=default_config ) parser.add_option( '-e', '--encode-id', dest='encode_id', help='Encode an ID' ) parser.add_option( '-d', '--decode-id', dest='decode_id', help='Decode an ID' ) parser.add_option( '--hda', dest='hda_id', help='Display HistoryDatasetAssociation info' ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Re-add the ability to display links to the same tool in more than one tool panel location, and add some recently introduced Galaxy config attributes to the tool shed app so exceptions won't be thrown.
by Bitbucket 08 Sep '11

08 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/2fcf14f59875/ changeset: 2fcf14f59875 user: greg date: 2011-09-08 16:40:44 summary: Re-add the ability to display links to the same tool in more than one tool panel location, and add some recently introduced Galaxy config attributes to the tool shed app so exceptions won't be thrown. affected #: 3 files (203 bytes) --- a/lib/galaxy/tools/__init__.py Thu Sep 08 10:34:56 2011 -0400 +++ b/lib/galaxy/tools/__init__.py Thu Sep 08 10:40:44 2011 -0400 @@ -125,9 +125,9 @@ tta = self.app.model.ToolTagAssociation( tool_id=tool.id, tag_id=tag.id ) self.sa_session.add( tta ) self.sa_session.flush() - if tool.id in self.tools_by_id: - raise Exception( "Tool with id %s already loaded." % tool.id ) - else: + if tool.id not in self.tools_by_id: + # Allow for the same tool to be loaded into multiple places in the + # tool panel. self.tools_by_id[ tool.id ] = tool key = 'tool_' + tool.id panel_dict[ key ] = tool --- a/lib/galaxy/webapps/community/app.py Thu Sep 08 10:34:56 2011 -0400 +++ b/lib/galaxy/webapps/community/app.py Thu Sep 08 10:40:44 2011 -0400 @@ -1,5 +1,6 @@ import sys, config import galaxy.tools.data +import galaxy.quota import galaxy.datatypes.registry import galaxy.webapps.community.model from galaxy.web import security @@ -36,5 +37,6 @@ self.tool_data_tables = galaxy.tools.data.ToolDataTableManager( self.config.tool_data_table_config_path ) # Load security policy self.security_agent = self.model.security_agent + self.quota_agent = galaxy.quota.NoQuotaAgent( self.model ) def shutdown( self ): pass --- a/lib/galaxy/webapps/community/config.py Thu Sep 08 10:34:56 2011 -0400 +++ b/lib/galaxy/webapps/community/config.py Thu Sep 08 10:40:44 2011 -0400 @@ -39,6 +39,8 @@ self.file_path = resolve_path( kwargs.get( "file_path", "database/files" ), self.root ) self.new_file_path = resolve_path( kwargs.get( "new_file_path", "database/tmp" ), self.root ) self.cookie_path = kwargs.get( "cookie_path", "/" ) + # web API + self.enable_api = string_as_bool( kwargs.get( 'enable_api', False ) ) self.datatypes_config = kwargs.get( 'datatypes_config_file', 'datatypes_conf.xml' ) self.test_conf = resolve_path( kwargs.get( "test_conf", "" ), self.root ) self.id_secret = kwargs.get( "id_secret", "USING THE DEFAULT IS NOT SECURE!" ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: dan: Minor tool help updates.
by Bitbucket 08 Sep '11

08 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/314d41df7881/ changeset: 314d41df7881 user: dan date: 2011-09-08 16:34:56 summary: Minor tool help updates. affected #: 8 files (1.6 KB) --- a/tools/fastx_toolkit/fasta_clipping_histogram.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_clipping_histogram.xml Thu Sep 08 10:34:56 2011 -0400 @@ -99,6 +99,12 @@ Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts. +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fasta_formatter.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_formatter.xml Thu Sep 08 10:34:56 2011 -0400 @@ -76,5 +76,12 @@ AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT >Scaffold9299 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fasta_nucleotide_changer.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fasta_nucleotide_changer.xml Thu Sep 08 10:34:56 2011 -0400 @@ -62,5 +62,12 @@ >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1 TGGAATGTAAAGAAGTATGTA + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_barcode_splitter.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_barcode_splitter.xml Thu Sep 08 10:34:56 2011 -0400 @@ -64,6 +64,13 @@ .. image:: ./static/fastx_icons/barcode_splitter_output_example.png + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_clipper.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_clipper.xml Thu Sep 08 10:34:56 2011 -0400 @@ -104,6 +104,12 @@ - + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/fastx_toolkit/fastx_collapser.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/fastx_toolkit/fastx_collapser.xml Thu Sep 08 10:34:56 2011 -0400 @@ -77,5 +77,12 @@ means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file. + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help></tool> --- a/tools/plotting/boxplot.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/plotting/boxplot.xml Thu Sep 08 10:34:56 2011 -0400 @@ -97,6 +97,12 @@ .. image:: ./static/images/solid_qual.png +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + </help></tool> --- a/tools/visualization/GMAJ.xml Wed Sep 07 17:19:15 2011 -0400 +++ b/tools/visualization/GMAJ.xml Thu Sep 08 10:34:56 2011 -0400 @@ -194,6 +194,16 @@ For detailed information on GMAJ, click here_. + +------ + +**Citation** + +If you use GMAJ, please cite `Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, Haussler D, Miller W. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. <http://www.ncbi.nlm.nih.gov/pubmed/15060014>`_ and http://globin.cse.psu.edu/dist/gmaj/. + +If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + .. _here: /static/gmaj/docs/gmaj_readme.html .. _TBA: http://www.bx.psu.edu/miller_lab/ </help> Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Do away with the encoding of 'file.<id>' and 'folder.<id>' in the API. All IDs in the API, with the exception of library folders, are now just the object's real encoded id. Library folders have an 'F' prepended to the id AFTER encoding. All real IDs (including the ldda ID of library datasets) can be seen in an item's element view. Workflows started from the API using the 'ld=' src should now use the new IDs as opposed to the old 'file.<id>' IDs.
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/435e3f628e7d/ changeset: 435e3f628e7d user: natefoo date: 2011-09-07 23:19:15 summary: Do away with the encoding of 'file.<id>' and 'folder.<id>' in the API. All IDs in the API, with the exception of library folders, are now just the object's real encoded id. Library folders have an 'F' prepended to the id AFTER encoding. All real IDs (including the ldda ID of library datasets) can be seen in an item's element view. Workflows started from the API using the 'ld=' src should now use the new IDs as opposed to the old 'file.<id>' IDs. affected #: 7 files (1.8 KB) --- a/lib/galaxy/model/__init__.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/model/__init__.py Wed Sep 07 17:19:15 2011 -0400 @@ -1136,7 +1136,9 @@ # display in other objects, we can't use the simpler method used by # other model classes. hda = self - rval = dict( name = hda.name, + rval = dict( id = hda.id, + model_class = self.__class__.__name__, + name = hda.name, deleted = hda.deleted, visible = hda.visible, state = hda.state, @@ -1230,7 +1232,7 @@ return name class LibraryFolder( object, APIItem ): - api_element_visible_keys = ( 'name', 'description', 'item_count', 'genome_build' ) + api_element_visible_keys = ( 'id', 'name', 'description', 'item_count', 'genome_build' ) def __init__( self, name=None, description=None, item_count=0, order_id=None ): self.name = name or "Unnamed folder" self.description = description @@ -1371,7 +1373,10 @@ tmp_dict[field['label']] = content[field['name']] template_data[template.name] = tmp_dict - rval = dict( name = ldda.name, + rval = dict( id = self.id, + ldda_id = ldda.id, + model_class = self.__class__.__name__, + name = ldda.name, file_name = ldda.file_name, uploaded_by = ldda.user.email, message = ldda.message, --- a/lib/galaxy/web/api/history_contents.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/history_contents.py Wed Sep 07 17:19:15 2011 -0400 @@ -32,7 +32,7 @@ try: for dataset in history.datasets: api_type = "file" - encoded_id = trans.security.encode_id( '%s.%s' % (api_type, dataset.id) ) + encoded_id = trans.security.encode_id( dataset.id ) rval.append( dict( id = encoded_id, type = api_type, name = dataset.name, @@ -46,9 +46,10 @@ @web.expose_api def show( self, trans, id, history_id, **kwd ): """ - GET /api/histories/{encoded_history_id}/contents/{encoded_content_type_and_id} + GET /api/histories/{encoded_history_id}/contents/{encoded_content_id} Displays information about a history content (dataset). """ + content_id = id try: content = get_history_content_for_access( trans, content_id ) except Exception, e: @@ -62,6 +63,7 @@ # http://routes.groovie.org/generating.html # url_for is being phased out, so new applications should use url item['download_url'] = url(controller='dataset', action='display', dataset_id=trans.security.encode_id(content.id), to_ext=content.ext) + item = encode_all_ids( trans, item ) except Exception, e: item = "Error in history API at listing dataset" log.error( item + ": %s" % str(e) ) --- a/lib/galaxy/web/api/libraries.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/libraries.py Wed Sep 07 17:19:15 2011 -0400 @@ -87,7 +87,7 @@ trans.sa_session.flush() encoded_id = trans.security.encode_id( library.id ) rval = {} - rval['url'] = url_for( 'libraries', id=encoded_id ) + rval['url'] = url_for( 'library', id=encoded_id ) rval['name'] = name rval['id'] = encoded_id return [ rval ] --- a/lib/galaxy/web/api/library_contents.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/library_contents.py Wed Sep 07 17:19:15 2011 -0400 @@ -52,14 +52,16 @@ if not library or not ( trans.user_is_admin() or trans.app.security_agent.can_access_library( current_user_roles, library ) ): trans.response.status = 400 return "Invalid library id ( %s ) specified." % str( library_id ) - encoded_id = trans.security.encode_id( 'folder.%s' % library.root_folder.id ) + encoded_id = 'F' + trans.security.encode_id( library.root_folder.id ) rval.append( dict( id = encoded_id, type = 'folder', name = '/', url = url_for( 'library_content', library_id=library_id, id=encoded_id ) ) ) library.root_folder.api_path = '' for content in traverse( library.root_folder ): - encoded_id = trans.security.encode_id( '%s.%s' % ( content.api_type, content.id ) ) + encoded_id = trans.security.encode_id( content.id ) + if content.api_type == 'folder': + encoded_id = 'F' + encoded_id rval.append( dict( id = encoded_id, type = content.api_type, name = content.api_path, @@ -69,7 +71,7 @@ @web.expose_api def show( self, trans, id, library_id, **kwd ): """ - GET /api/libraries/{encoded_library_id}/contents/{encoded_content_type_and_id} + GET /api/libraries/{encoded_library_id}/contents/{encoded_content_id} Displays information about a library content (file or folder). """ content_id = id @@ -77,7 +79,7 @@ content = get_library_content_for_access( trans, content_id ) except Exception, e: return str( e ) - return content.get_api_value( view='element' ) + return encode_all_ids( trans, content.get_api_value( view='element' ) ) @web.expose_api def create( self, trans, library_id, payload, **kwd ): @@ -88,51 +90,40 @@ create_type = None if 'create_type' not in payload: trans.response.status = 400 - return "Missing required 'create_type' parameter. Please consult the API documentation for help." + return "Missing required 'create_type' parameter." else: create_type = payload.pop( 'create_type' ) if create_type not in ( 'file', 'folder' ): trans.response.status = 400 - return "Invalid value for 'create_type' parameter ( %s ) specified. Please consult the API documentation for help." % create_type + return "Invalid value for 'create_type' parameter ( %s ) specified." % create_type + if 'folder_id' not in payload: + trans.response.status = 400 + return "Missing requred 'folder_id' parameter." + else: + folder_id = payload.pop( 'folder_id' ) try: - content_id = str( payload.pop( 'folder_id' ) ) - decoded_type_and_id = trans.security.decode_string_id( content_id ) - parent_type, decoded_parent_id = decoded_type_and_id.split( '.' ) - assert parent_type in ( 'folder', 'file' ) - except: - trans.response.status = 400 - return "Malformed parent id ( %s ) specified, unable to decode." % content_id - # "content" can be either a folder or a file, but the parent of new contents can only be folders. - if parent_type == 'file': - trans.response.status = 400 - try: - # With admins or people who can access the dataset provided as the parent, be descriptive. - dataset = trans.sa_session.query( trans.app.model.LibraryDataset ).get( decoded_parent_id ).library_dataset_dataset_association.dataset - assert trans.user_is_admin() or trans.app.security_agent.can_access_dataset( trans.get_current_user_roles(), dataset ) - return "The parent id ( %s ) points to a file, not a folder." % content_id - except: - # If you can't access the parent we don't want to reveal its existence. - return "Invalid parent folder id ( %s ) specified." % content_id + # _for_modification is not necessary, that security happens in the library_common controller. + parent = get_library_folder_for_access( trans, library_id, folder_id ) + except Exception, e: + return str( e ) # The rest of the security happens in the library_common controller. - folder_id = trans.security.encode_id( decoded_parent_id ) + real_folder_id = trans.security.encode_id( parent.id ) # Now create the desired content object, either file or folder. if create_type == 'file': - status, output = trans.webapp.controllers['library_common'].upload_library_dataset( trans, 'api', library_id, folder_id, **payload ) + status, output = trans.webapp.controllers['library_common'].upload_library_dataset( trans, 'api', library_id, real_folder_id, **payload ) elif create_type == 'folder': - status, output = trans.webapp.controllers['library_common'].create_folder( trans, 'api', folder_id, library_id, **payload ) + status, output = trans.webapp.controllers['library_common'].create_folder( trans, 'api', real_folder_id, library_id, **payload ) if status != 200: trans.response.status = status - # We don't want to reveal the encoded folder_id since it's invalid - # in the API context. Instead, return the content_id originally - # supplied by the client. - output = output.replace( folder_id, content_id ) return output else: rval = [] for k, v in output.items(): if type( v ) == trans.app.model.LibraryDatasetDatasetAssociation: v = v.library_dataset - encoded_id = trans.security.encode_id( create_type + '.' + str( v.id ) ) + encoded_id = trans.security.encode_id( v.id ) + if create_type == 'folder': + encoded_id = 'F' + encoded_id rval.append( dict( id = encoded_id, name = v.name, url = url_for( 'library_content', library_id=library_id, id=encoded_id ) ) ) --- a/lib/galaxy/web/api/util.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/util.py Wed Sep 07 17:19:15 2011 -0400 @@ -34,46 +34,61 @@ # Note that we could check the history provided in the URL heirarchy here, # but it's irrelevant, we care about the history associated with the hda. try: - content_type, decoded_content_id = trans.security.decode_string_id( content_id ).split( '.' ) - decoded_content_id = int( decoded_content_id ) + decoded_content_id = trans.security.decode_id( content_id ) + model_class = trans.app.model.HistoryDatasetAssociation except: trans.response.status = 400 raise BadRequestException( "Malformed history content id ( %s ) specified, unable to decode." % str( content_id ) ) try: - assert content_type == 'file' - model_class = trans.app.model.HistoryDatasetAssociation - except: - trans.response.status = 400 - raise BadRequestException( "Invalid type ( %s ) specified." % str( content_type ) ) - try: content = trans.sa_session.query( model_class ).get( decoded_content_id ) assert content if content.history.user != trans.user and not trans.user_is_admin(): assert trans.sa_session.query(trans.app.model.HistoryUserShareAssociation).filter_by(user=trans.user, history=content.history).count() != 0 except: trans.response.status = 400 - raise BadRequestException( "Invalid %s id ( %s ) specified." % ( content_type, str( content_id ) ) ) + raise BadRequestException( "Invalid history content id ( %s ) specified." % ( str( content_id ) ) ) return content +def get_library_folder_for_access( trans, library_id, folder_id ): + """ + When we know we're looking for a folder, take either the 'F' + encoded_id or bare encoded_id. + """ + if ( len( folder_id ) % 16 == 0 ): + folder_id = 'F' + folder_id + return get_library_content_for_access( trans, folder_id ) + def get_library_content_for_access( trans, content_id ): try: - content_type, decoded_content_id = trans.security.decode_string_id( content_id ).split( '.' ) - decoded_content_id = int( decoded_content_id ) + if ( len( content_id ) % 16 == 0 ): + model_class = trans.app.model.LibraryDataset + decoded_content_id = trans.security.decode_id( content_id ) + elif ( content_id.startswith( 'F' ) ): + model_class = trans.app.model.LibraryFolder + decoded_content_id = trans.security.decode_id( content_id[1:] ) + else: + raise Exception( 'Bad id' ) except: trans.response.status = 400 - raise BadRequestException( "Malformed library %s id ( %s ) specified, unable to decode." % ( content_type, str( content_id ) ) ) - if content_type == 'file': - model_class = trans.app.model.LibraryDataset - elif content_type == 'folder': - model_class = trans.app.model.LibraryFolder - else: - trans.response.status = 400 - raise BadRequestException( "Invalid type ( %s ) specified." % str( content_type ) ) + raise BadRequestException( "Malformed library content id ( %s ) specified, unable to decode." % str( content_id ) ) try: content = trans.sa_session.query( model_class ).get( decoded_content_id ) assert content assert trans.user_is_admin() or trans.app.security_agent.can_access_library_item( trans.get_current_user_roles(), content, trans.user ) except: trans.response.status = 400 - raise BadRequestException( "Invalid %s id ( %s ) specified." % ( content_type, str( content_id ) ) ) + raise BadRequestException( "Invalid library content id ( %s ) specified." % str( content_id ) ) return content + +def encode_all_ids( trans, rval ): + """ + encodes all integer values in the dict rval whose keys are 'id' or end with '_id' + """ + if type( rval ) != dict: + return rval + for k, v in rval.items(): + if k == 'id' or k.endswith( '_id' ): + try: + rval[k] = trans.security.encode_id( v ) + except: + pass # probably already encoded + return rval --- a/lib/galaxy/web/api/workflows.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/api/workflows.py Wed Sep 07 17:19:15 2011 -0400 @@ -106,9 +106,8 @@ assert trans.user_is_admin() or trans.app.security_agent.can_access_dataset( trans.get_current_user_roles(), ldda.dataset ) hda = ldda.to_history_dataset_association(history, add_to_history=add_to_history) elif ds_map[k]['src'] == 'ld': - ld_t, ld_id = trans.security.decode_string_id(ds_map[k]['id']).split('.') ldda = trans.sa_session.query(self.app.model.LibraryDataset).get( - ld_id).library_dataset_dataset_association + trans.security.decode_id(ds_map[k]['id'])).library_dataset_dataset_association assert trans.user_is_admin() or trans.app.security_agent.can_access_dataset( trans.get_current_user_roles(), ldda.dataset ) hda = ldda.to_history_dataset_association(history, add_to_history=add_to_history) elif ds_map[k]['src'] == 'hda': --- a/lib/galaxy/web/security/__init__.py Wed Sep 07 15:50:03 2011 -0400 +++ b/lib/galaxy/web/security/__init__.py Wed Sep 07 17:19:15 2011 -0400 @@ -43,8 +43,6 @@ return self.id_cipher.encrypt( s ).encode( 'hex' ) def decode_id( self, obj_id ): return int( self.id_cipher.decrypt( obj_id.decode( 'hex' ) ).lstrip( "!" ) ) - def decode_string_id( self, obj_id ): - return self.id_cipher.decrypt( obj_id.decode( 'hex' ) ).lstrip( "!" ) def encode_guid( self, session_key ): # Session keys are strings # Pad to a multiple of 8 with leading "!" Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: 2 new changesets
by Bitbucket 07 Sep '11

07 Sep '11

2 new changesets in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/71dd469f2b9e/ changeset: 71dd469f2b9e user: dan date: 2011-09-07 19:55:08 summary: Update GATK Unified Genotyper with num_threads of 4. affected #: 1 file (42 bytes) --- a/tools/gatk/unified_genotyper.xml Wed Sep 07 12:28:18 2011 -0400 +++ b/tools/gatk/unified_genotyper.xml Wed Sep 07 13:55:08 2011 -0400 @@ -10,6 +10,7 @@ -p 'java -jar "${GALAXY_DATA_INDEX_DIR}/shared/jars/gatk/GenomeAnalysisTK.jar" -T "UnifiedGenotyper" + --num_threads 4 ##hard coded, for now -o "${output_vcf}" -et "NO_ET" ##ET no phone home ##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout http://bitbucket.org/galaxy/galaxy-central/changeset/a7c95bedc201/ changeset: a7c95bedc201 user: dan date: 2011-09-07 21:50:03 summary: merge affected #: 1 file (42 bytes) --- a/tools/gatk/unified_genotyper.xml Wed Sep 07 15:07:05 2011 -0400 +++ b/tools/gatk/unified_genotyper.xml Wed Sep 07 15:50:03 2011 -0400 @@ -10,6 +10,7 @@ -p 'java -jar "${GALAXY_DATA_INDEX_DIR}/shared/jars/gatk/GenomeAnalysisTK.jar" -T "UnifiedGenotyper" + --num_threads 4 ##hard coded, for now -o "${output_vcf}" -et "NO_ET" ##ET no phone home ##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Clarify output messages of set_user_disk_usage.py
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/3bd28e1e3e60/ changeset: 3bd28e1e3e60 user: natefoo date: 2011-09-07 21:07:05 summary: Clarify output messages of set_user_disk_usage.py affected #: 1 file (2 bytes) --- a/scripts/set_user_disk_usage.py Wed Sep 07 12:28:18 2011 -0400 +++ b/scripts/set_user_disk_usage.py Wed Sep 07 15:07:05 2011 -0400 @@ -38,7 +38,7 @@ def quotacheck( sa_session, users ): sa_session.refresh( user ) current = user.get_disk_usage() - print user.username, '<' + user.email + '> current usage:', str( current ) + ',', + print user.username, '<' + user.email + '> old usage:', str( current ) + ',', new = user.calculate_disk_usage() sa_session.refresh( user ) # usage changed while calculating, do it again @@ -49,7 +49,7 @@ if new == current: print 'no change' else: - print 'new:', new + print 'new usage:', new if not options.dryrun: user.set_disk_usage( new ) sa_session.add( user ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Updates for dist-eggs definitions, Python 2.7 for Mac OS X 10.6+ (intel-only) from python.org is now supported.
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/c62544f290b4/ changeset: c62544f290b4 user: natefoo date: 2011-09-07 18:28:18 summary: Updates for dist-eggs definitions, Python 2.7 for Mac OS X 10.6+ (intel-only) from python.org is now supported. affected #: 1 file (100 bytes) --- a/dist-eggs.ini Wed Sep 07 10:20:14 2011 -0400 +++ b/dist-eggs.ini Wed Sep 07 12:28:18 2011 -0400 @@ -27,7 +27,8 @@ py2.5-macosx-10.3-fat-ucs2 = weyerbacher.bx.psu.edu /usr/local/bin/python2.5 py2.6-macosx-10.3-fat-ucs2 = weyerbacher.bx.psu.edu /usr/local/bin/python2.6 py2.7-macosx-10.3-fat-ucs2 = weyerbacher.bx.psu.edu /usr/local/bin/python2.7 -py2.6-macosx-10.6-universal-ucs2 = fanty.bx.psu.edu /usr/bin/python2.6 +py2.6-macosx-10.6-universal-ucs2 = lion.bx.psu.edu /usr/bin/python2.6 +py2.7-macosx-10.6-intel-ucs2 = lion.bx.psu.edu /usr/local/bin/python2.7 py2.4-solaris-2.10-i86pc_32-ucs2 = thumper.bx.psu.edu /afs/bx.psu.edu/project/pythons/solaris-2.10-i86pc_32-ucs2/bin/python2.4 py2.5-solaris-2.10-i86pc_32-ucs2 = thumper.bx.psu.edu /afs/bx.psu.edu/project/pythons/solaris-2.10-i86pc_32-ucs2/bin/python2.5 py2.6-solaris-2.10-i86pc_32-ucs2 = thumper.bx.psu.edu /afs/bx.psu.edu/project/pythons/solaris-2.10-i86pc_32-ucs2/bin/python2.6 @@ -70,7 +71,7 @@ py2.4-macosx = py2.4-macosx-10.3-fat-ucs2 py2.5-macosx = py2.5-macosx-10.3-fat-ucs2 py2.6-macosx = py2.6-macosx-10.3-fat-ucs2 py2.6-macosx-10.6-universal-ucs2 -py2.7-macosx = py2.7-macosx-10.3-fat-ucs2 +py2.7-macosx = py2.7-macosx-10.3-fat-ucs2 py2.7-macosx-10.6-intel-ucs2 macosx = py2.4-macosx py2.5-macosx py2.6-macosx py2.7-macosx py2.4-solaris-i86pc = py2.4-solaris-2.10-i86pc_32-ucs2 py2.4-solaris-2.10-i86pc_64-ucs2 py2.5-solaris-i86pc = py2.5-solaris-2.10-i86pc_32-ucs2 py2.5-solaris-2.10-i86pc_64-ucs2 Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fixes for browsing repository contents.
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/431eda93e017/ changeset: 431eda93e017 user: greg date: 2011-09-07 16:20:14 summary: Fixes for browsing repository contents. affected #: 1 file (774 bytes) --- a/lib/galaxy/webapps/community/controllers/repository.py Wed Sep 07 09:05:52 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/repository.py Wed Sep 07 10:20:14 2011 -0400 @@ -1,4 +1,4 @@ -import os, logging, urllib, ConfigParser, tempfile, shutil, pexpect +import os, logging, urllib, ConfigParser, tempfile, shutil from time import strftime from datetime import date, datetime from galaxy import util @@ -1357,7 +1357,12 @@ trans.response.headers['Expires'] = '0' repository = trans.sa_session.query( trans.model.Repository ).get( trans.security.decode_id( repository_id ) ) folder_path = key - files_list = self.__get_files( trans, repository, folder_path ) + try: + files_list = self.__get_files( trans, folder_path ) + except OSError, e: + if str( e ).find( 'No such file or directory' ) >= 0: + # We have a repository with no contents. + return [] folder_contents = [] for filename in files_list: is_folder = False @@ -1372,31 +1377,20 @@ "key": full_path } folder_contents.append( node ) return folder_contents - def __get_files( self, trans, repository, folder_path ): - def print_ticks( d ): - pass - cmd = "ls -p '%s'" % folder_path - output = pexpect.run( cmd, - events={ pexpect.TIMEOUT : print_ticks }, - timeout=10 ) - if 'No such file or directory' in output: - if 'root' in output: - # The repository is empty - return [] - else: - # Some strange error occurred, the selected file was displayed, but - # does not exist in the sub-directory from which it was displayed. - # This should not happen... - status = 'error' - message = "No folder named (%s) exists." % folder_path - return trans.response.send_redirect( web.url_for( controller='repository', - action='browse_repositories', - operation="view_or_manage_repository", - id=trans.security.encode_id( repository.id ), - changeset_revision=repository.tip, - status=status, - message=message ) ) - return output.split( '\r\n' ) + def __get_files( self, trans, folder_path ): + contents = [] + for item in os.listdir( folder_path ): + # Skip .hg directories + if str( item ).startswith( '.hg' ): + continue + if os.path.isdir( os.path.join( folder_path, item ) ): + # Append a '/' character so that our jquery dynatree will + # function properly. + item = '%s/' % item + contents.append( item ) + if contents: + contents.sort() + return contents @web.json def get_file_contents( self, trans, file_path ): # Avoid caching Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Be more forgiving about running the disk accounting scripts from outside the galaxy-dist directory.
by Bitbucket 07 Sep '11

07 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/af3673244a6f/ changeset: af3673244a6f user: natefoo date: 2011-09-07 15:05:52 summary: Be more forgiving about running the disk accounting scripts from outside the galaxy-dist directory. affected #: 2 files (204 bytes) --- a/scripts/set_dataset_sizes.py Tue Sep 06 13:41:06 2011 -0400 +++ b/scripts/set_dataset_sizes.py Wed Sep 07 09:05:52 2011 -0400 @@ -4,8 +4,10 @@ from ConfigParser import ConfigParser from optparse import OptionParser +default_config = os.path.abspath( os.path.join( os.path.dirname( __file__ ), '..', 'universe_wsgi.ini') ) + parser = OptionParser() -parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default='universe_wsgi.ini' ) +parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default=default_config ) ( options, args ) = parser.parse_args() def init(): --- a/scripts/set_user_disk_usage.py Tue Sep 06 13:41:06 2011 -0400 +++ b/scripts/set_user_disk_usage.py Wed Sep 07 09:05:52 2011 -0400 @@ -4,8 +4,10 @@ from ConfigParser import ConfigParser from optparse import OptionParser +default_config = os.path.abspath( os.path.join( os.path.dirname( __file__ ), '..', 'universe_wsgi.ini') ) + parser = OptionParser() -parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default='universe_wsgi.ini' ) +parser.add_option( '-c', '--config', dest='config', help='Path to Galaxy config file (universe_wsgi.ini)', default=default_config ) parser.add_option( '-u', '--username', dest='username', help='Username of user to update', default='all' ) parser.add_option( '-e', '--email', dest='email', help='Email address of user to update', default='all' ) parser.add_option( '--dry-run', dest='dryrun', help='Dry run (show changes but do not save to database)', action='store_true', default=False ) Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Add new sample config to point to tools installed from a tool shed and add additional directories for checking/creating at startup.
by Bitbucket 06 Sep '11

06 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/502e3902ed9d/ changeset: 502e3902ed9d user: greg date: 2011-09-06 19:41:06 summary: Add new sample config to point to tools installed from a tool shed and add additional directories for checking/creating at startup. affected #: 3 files (681 bytes) --- a/lib/galaxy/config.py Tue Sep 06 11:51:01 2011 -0400 +++ b/lib/galaxy/config.py Tue Sep 06 13:41:06 2011 -0400 @@ -5,7 +5,7 @@ import sys, os, tempfile import logging, logging.config import ConfigParser -from galaxy.util import string_as_bool, listify +from galaxy.util import string_as_bool, listify, parse_xml from galaxy import eggs import pkg_resources @@ -172,10 +172,21 @@ else: return default def check( self ): + paths_to_check = [ self.root, self.tool_path, self.tool_data_path, self.template_path ] + # Look for any tool shed configs and retrieve the tool_path attribute from the <toolbox> tag. + for config_filename in self.tool_configs: + tree = parse_xml( config_filename ) + root = tree.getroot() + tool_path = root.get( 'tool_path' ) + if tool_path not in [ None, False ]: + paths_to_check.append( resolve_path( tool_path, self.root ) ) # Check that required directories exist - for path in self.root, self.tool_path, self.tool_data_path, self.template_path: - if not os.path.isdir( path ): - raise ConfigurationError("Directory does not exist: %s" % path ) + for path in paths_to_check: + if path not in [ None, False ] and not os.path.isdir( path ): + try: + os.makedirs( path ) + except Exception, e: + raise ConfigurationError( "Unable to create missing directory: %s\n%s" % ( path, e ) ) # Create the directories that it makes sense to create for path in self.file_path, \ self.new_file_path, \ --- a/run.sh Tue Sep 06 11:51:01 2011 -0400 +++ b/run.sh Tue Sep 06 13:41:06 2011 -0400 @@ -6,11 +6,13 @@ [ $? -ne 0 ] && exit 1 SAMPLES=" + datatypes_conf.xml.sample external_service_types_conf.xml.sample - datatypes_conf.xml.sample reports_wsgi.ini.sample + shed_tool_conf.xml.sample tool_conf.xml.sample tool_data_table_conf.xml.sample + tool_sheds_conf.xml.sample universe_wsgi.ini.sample tool-data/shared/ucsc/builds.txt.sample tool-data/*.sample Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: natefoo: Add the "Galaxy ls" script to contrib/. Thanks, Simon McGowan.
by Bitbucket 06 Sep '11

06 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/36221b56dfcd/ changeset: 36221b56dfcd user: natefoo date: 2011-09-06 17:51:01 summary: Add the "Galaxy ls" script to contrib/. Thanks, Simon McGowan. affected #: 2 files (239 bytes) --- a/contrib/README Tue Sep 06 10:44:44 2011 -0400 +++ b/contrib/README Tue Sep 06 11:51:01 2011 -0400 @@ -23,3 +23,9 @@ SMF Manifest for Solaris 10 and OpenSolaris. Import with `svccfg import galaxy.solaris-smf.xml`. + +gls.pl: + + "Galaxy ls", for sites where Galaxy logins match system logins, this script + can be used to list the filesystem paths to a user's history datasets. + Requires site modifications. Written and submitted by Simon McGowan. Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix for browsing tool shed repo files whose names include apsces, and display a better message if repository metadata cannot be set due to lack of tools.
by Bitbucket 06 Sep '11

06 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/ba5c95886cef/ changeset: ba5c95886cef user: greg date: 2011-09-06 16:44:44 summary: Fix for browsing tool shed repo files whose names include apsces, and display a better message if repository metadata cannot be set due to lack of tools. affected #: 2 files (197 bytes) --- a/lib/galaxy/webapps/community/controllers/common.py Tue Sep 06 09:43:17 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/common.py Tue Sep 06 10:44:44 2011 -0400 @@ -295,6 +295,9 @@ repository_metadata.metadata = metadata_dict trans.sa_session.add( repository_metadata ) trans.sa_session.flush() + else: + message = "Changeset revision '%s' includes no tools or exported workflows for which metadata can be set." % str( changeset_revision ) + status = "done" else: # change_set is None message = "Repository does not include changeset revision '%s'." % str( changeset_revision ) --- a/lib/galaxy/webapps/community/controllers/repository.py Tue Sep 06 09:43:17 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/repository.py Tue Sep 06 10:44:44 2011 -0400 @@ -1396,7 +1396,7 @@ changeset_revision=repository.tip, status=status, message=message ) ) - return output.split() + return output.split( '\r\n' ) @web.json def get_file_contents( self, trans, file_path ): # Avoid caching Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: datatime import fixes in the base controller.
by Bitbucket 06 Sep '11

06 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/8d261709b1e1/ changeset: 8d261709b1e1 user: greg date: 2011-09-06 15:43:17 summary: datatime import fixes in the base controller. affected #: 2 files (36 bytes) --- a/lib/galaxy/web/base/controller.py Mon Sep 05 07:07:43 2011 -0400 +++ b/lib/galaxy/web/base/controller.py Tue Sep 06 09:43:17 2011 -0400 @@ -2,7 +2,7 @@ Contains functionality needed in every web interface """ import os, time, logging, re, string, sys, glob, shutil, tempfile, subprocess -from datetime import * +from datetime import date, datetime, timedelta from time import strftime from galaxy import config, tools, web, util from galaxy.web import error, form, url_for --- a/lib/galaxy/webapps/community/controllers/repository.py Mon Sep 05 07:07:43 2011 -0400 +++ b/lib/galaxy/webapps/community/controllers/repository.py Tue Sep 06 09:43:17 2011 -0400 @@ -1,7 +1,6 @@ import os, logging, urllib, ConfigParser, tempfile, shutil, pexpect from time import strftime -from datetime import * - +from datetime import date, datetime from galaxy import util from galaxy.datatypes.checkers import * from galaxy.web.base.controller import * Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0

commit/galaxy-central: greg: Fix for defining the relative file path for a tool automatically installed from a tool shed.
by Bitbucket 05 Sep '11

05 Sep '11

1 new changeset in galaxy-central: http://bitbucket.org/galaxy/galaxy-central/changeset/6f321d52b8af/ changeset: 6f321d52b8af user: greg date: 2011-09-05 13:07:43 summary: Fix for defining the relative file path for a tool automatically installed from a tool shed. affected #: 1 file (288 bytes) --- a/lib/galaxy/web/base/controller.py Fri Sep 02 18:32:13 2011 -0400 +++ b/lib/galaxy/web/base/controller.py Mon Sep 05 07:07:43 2011 -0400 @@ -2768,11 +2768,8 @@ try: repository_tool = trans.app.toolbox.load_tool( full_path ) if repository_tool: - # At this point, we need to lstrip tool_path from relative_path,m but we - # have to be careful, so we do this the following way instead of using lstrip(). - items = relative_path.split( '/' ) - lstriped_items = items[ 2: ] - tup_path = '/'.join( lstriped_items ) + # At this point, we need to lstrip tool_path from relative_path. + tup_path = relative_path.replace( tool_path, '' ).lstrip( '/' ) repository_tools_tups.append( ( tup_path, repository_tool ) ) except Exception, e: # We have an inavlid .xml file, so not a tool config. @@ -2894,7 +2891,7 @@ Generate a tool path that guarantees repositories with the same name will always be installed in different directories. The tool path will be of the form: <tool shed url>/repos/<repository owner>/<repository name>/<changeset revision> - http://test@gvk.bx.psu.edu:9009/repos/test/filter + http://test@bx.psu.edu:9009/repos/test/filter """ tmp_url = self.__clean_repository_clone_url( repository_clone_url ) # Now tmp_url is something like: bx.psu.edu:9009/repos/some_username/column Repository URL: https://bitbucket.org/galaxy/galaxy-central/ -- This is a commit notification from bitbucket.org. You are receiving this because you have the service enabled, addressing the recipient of this email.

1 0