March 2010 - galaxy-dev - lists.galaxyproject.org

problem with getting the tables up in Profile Annotations
by CHAN Chee Seng 23 Apr '10

23 Apr '10

Hi, I have configured and built my own galaxy server. I have set up most of the genome databases but I have a problem with the getting the "Tables to Use" to be displayed on the web interface. I have looked at the following files. 1. annotation_profiler_options.xml 2. annotation_profiler_valid_builds.txt I did not change the annotation_profiler_options.xml file (used as is) and annotation_profiler_valid_builds.txt contains just one line, hg18 which is fine since I am starting with human. Where do I specify the location of my hg18? Please let me know if you need more information. Thanks for your help. Best regards, Chee Seng, Chan Genome Institute of Singapore 60 Biopolis Street, Genome #02-01 Singapore 138672 DID 64788065 ------------------------------- This email is confidential and may be privileged. If you are not the intended recipient, please delete it and notify us immediately. Please do not copy or use it for any purpose, or disclose its contents to any other person. Thank you. -------------------------------

2 1

Issue with deleting multiple histories
by Tam, Oliver 15 Apr '10

15 Apr '10

Hi, I recently discovered an issue that prevents me from easily deleting multiple histories at once. This is the method I use: Click ³Options² on the right side menu -> Go to ³Saved Histories² -> Click on the check box of the history to be deleted -> Click ³Delete² button at the bottom (next to ³For selected histories:²). When I do this, nothing happens, and the history remains. However, if I click on the the downward triangle and click on ³Delete² from the pull down menu, the history is correctly deleted. Deleting using the check-boxes and the Delete button works in changeset 3446:143c920af25c But fails in changeset 3447:f5d383525d68. Please let me know if you cannot reproduce the problem. Cheers, Oliver

2 1

run.sh paste error
by Nathaniel Street 14 Apr '10

14 Apr '10

Hi I have a problem that I've not been able to track down. I've tried searching the mailing list archive and googling. When I enable paste in universe_wsgi.ini and then run run.sh I get this error. The same occurs for both the stable and development branches. Traceback (most recent call last): File "./scripts/paster.py", line 34, in <module> command.run() File "/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/command.py", line 84, in run invoke(command, command_name, options, args[1:]) File "/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/command.py", line 123, in invoke exit_code = runner.run(args) File "/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/command.py", line 218, in run result = self.command() File "/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/serve.py", line 274, in command relative_to=base, global_conf=vars) File "/home/nat/work/software/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg/paste/script/serve.py", line 308, in loadserver relative_to=relative_to, **kw) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 210, in loadserver return loadobj(SERVER, uri, name=name, **kw) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 224, in loadobj global_conf=global_conf) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 248, in loadcontext global_conf=global_conf) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 278, in _loadconfig return loader.get_context(object_type, name, global_conf) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 409, in get_context section) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 431, in _context_from_use object_type, name=use, global_conf=global_conf) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 361, in get_context global_conf=global_conf) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 248, in loadcontext global_conf=global_conf) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 285, in _loadegg return loader.get_context(object_type, name, global_conf) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 561, in get_context object_type, name=name) File "/home/nat/work/software/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg/paste/deploy/loadwsgi.py", line 600, in find_egg_entry_point for prot in protocol_options] or '(no entry points)')))) LookupError: Entry point 'gzip' not found in egg 'Paste' (dir: /home/nat/work/software/galaxy-central/eggs/Paste-1.6-py2.6.egg; protocols: paste.server_factory, paste.server_runner; entry_points: ) The strange thing is on another machine I don't get the error but I can't find out what the missing dependency is on the machine the generates the error despite comparing installed packages etc. I'm running Ubunutu 9.1 64bit on both machines. Can anyone tell me what I'm missing that leads to the above error? Many thanks Nathaniel -- Nathaniel Street Umeå Plant Science Centre Department of Plant Physiology University of Umeå SE-901 87 Umeå SWEDEN email: nathaniel.street(a)plantphys.umu.se tel: +46-90-786 5473 fax: +46-90-786 6676 www.popgenie.org

2 1

Re: [galaxy-dev] Weird problem with importing datasets
by Chris Cole 13 Apr '10

13 Apr '10

On 09/03/10 15:42, Chris Cole wrote: > On 09/03/10 14:53, Nate Coraor wrote: >> Chris Cole wrote: >>> Anyone got any ideas on this? >>> >>> It's still not working (following the most recent updates) and we've >>> got some NGS data to import into Galaxy. >> >> Hi Chris, >> >> To use this feature, the contents of library_import_dir should >> themselves be directories (or symlinks to the same). Selecting that >> directory from the dropdown in the library upload form will then import >> the contents of those directories. > > Ah, right. That's not clear in the docs. > > How come it works with locally symlinked files, then? Just checked it again (sorry I shouldn't have sent the previous email) with a directory and it still isn't working. www-galaxy@ge-002: tmp> cd ~/data_import/ www-galaxy@ge-002: data_import> ls README www-galaxy@ge-002: data_import> ln -s /homes/pschofield/data/TOH www-galaxy@ge-002: data_import> ls TOH/ 0min_1.txt 30m_1.txt 60min_1.txt Cd_inuc_1.txt Cmono_1.txt Dd_inuc_1.txt Dmono_1.txt processed 0min_2.txt 30m_2.txt 60min_2.txt Cd_inuc_2.txt Cmono_2.txt Dd_inuc_2.txt Dmono_2.txt www-galaxy@ge-002: data_import> ls -l total 96 -rw-r--r-- 1 www-galaxy barton 142 Mar 9 14:14 README lrwxrwxrwx 1 www-galaxy barton 26 Mar 9 15:59 TOH -> /homes/pschofield/data/TOH I got the TOH option in the 'Upload directory of files', which I selected, but the upload failed. Again, this is the error I get when selecting one of the filenames in the dataset: Traceback (most recent call last): File "/homes/www-galaxy/galaxy_devel/tools/data_source/upload.py", line 326, in __main__() File "/homes/www-galaxy/galaxy_devel/tools/data_source/upload.py", line 318, in __main__ add_file( dataset, error Thanks for help. Chris

3 7

Wiki Addition: Site Map and Site Index
by Kelly Vincent 06 Apr '10

06 Apr '10

Everyone, Bitbucket (our code and wiki host) does not offer any way to search the wiki, so there are now two new pages to fill the void: SiteMap and SiteIndex. These are both generated automatically. The idea is that the pages should be generated by a script that is scheduled to run each night, but I'm still getting that going--in the meantime, I'll be running the script manually. SiteMap is a simple listing of all the pages found under the base wiki directory. You can get a pretty good idea what the page is about just by the name of it, which is all that's included in this list. You can see SiteMap at http://bitbucket.org/galaxy/galaxy-central/wiki/SiteMap. SiteIndex is more complicated. It is a traditional index, which means that (almost) every word that appears in the wiki is included with a list of the pages on which it appears following it. A stoplist was used to remove useless or meaningless words, but there is still some junk that has made it past this filter. The index involves multiple pages, divided up alphabetically. It's available at http://bitbucket.org/galaxy/galaxy-central/wiki/SiteIndex . Regards, Kelly

3 3

change_format and conditonal vars
by Edward Kirton 05 Apr '10

05 Apr '10

hi, how do i reference conditional variables from within the change_format tag? i couldn't find any examples that did this. an example tool config xml file follows. thanks! ed kirton us doe jgi <tool id="fasta_get_seqs" name="Get Sequences"> <description>Create a Fasta/Qual file of selected sequences</description> <command interpreter="perl">fasta_get_seqs.pl $intype.infile $input_table $id_column $ignorecase $cosorted $output #for $i in $filters "${i.condition} ${i.column} ${i.value}" #end for </command> <inputs> <conditional name='intype'> <param name='sel' type='select' label='Input file type'> <option value='Fasta'>Fasta</option> <option value='Qual454'>Qual454</option> </param> <when value='Fasta'> <param name="infile" type="data" format="fasta" label="Fasta file"/> </when> <when value='Qual454'> <param name="infile" type="data" format="qual454" label="Qual454 file"/> </when> </conditional> <param name="input_table" type="data" format="tabular" label="File containing target IDs"/> <param name='id_column' type='data_column' data_ref='input_table' label='Column containing sequence IDs'/> <param name='ignorecase' type='boolean' truevalue='1' falsevalue='0' label='Ignore case?' /> <param name="cosorted" type="boolean" checked="true" truevalue='1' falsevalue='0' label='Sequences appear in same order in both files'/> <repeat name='filters' title='Filter'> <param name='condition' type='select' label='Condition'> <option value='s_eq'>text equals</option> <option value='s_ne'>text not equals</option> <option value='s_contains'>text contains</option> <option value='s_startswith'>text starts with</option> <option value='s_endswith'>text ends with</option> <option value='n_eq'>number ==</option> <option value='n_ne'>number !=</option> <option value='n_gt'>number ></option> <option value='n_lt'>number <</option> </param> <param name='column' type='data_column' data_ref='input_table' label='On column'/> <param name='value' type='text' label='Value'/> </repeat> </inputs> <outputs> <data name="output" format="fasta"> <change_format> <when input="intype.sel" value="Qual454" format="qual454" /> </change_format> </data> </outputs> <help> **What it does** Produces a Fasta/Qual file of selected sequences. If the files are cosorted, a much faster algorithm is used. If it fails, it assumes the files were not cosorted and automatically tries again using the slower algorithm which does not require cosorted files. One or more filters may be included to evaluate text (equal, not equal, contains, starts with) or numeric data (==, !=, >, <). </help> </tool>

2 1

Patch: show User menu's history and dataset options show independent of app.config.use_remote_user setting
by Ry4an Brase 30 Mar '10

30 Mar '10

It's not much, but we're using a remote_user setup and the History and Datasets menu items were not showing up under the User menu, which didn't seem to be by design. Attached is a micro patch to the template, which is also available here: http://bitbucket.org/Ry4an/galaxy-umn-msi-changes/src/tip/always-show-users… Also, What's the preferred patch submission mechanism? Patchbomb? Bitbucket pull-request? Thanks, -- Ry4an Brase 612-626-6575 University of Minnesota Supercomputing Institute for Advanced Computational Research http://www.msi.umn.edu

3 4

'Never ending' jobs in history
by Chris Cole 26 Mar '10

26 Mar '10

Hi, Occasionally, we see jobs that are constantly in the 'job running' state in the history. This is despite the fact that the job completed correctly. I can also see in the paster.log file that Galaxy has picked up on the fact that the job ended, but it just hasn't updated the UI. Clicking the eye for the 'running' history items does show the results of the run. This does not happen all the time. Is this a known issue and/or how can I resolve it? Thanks, Chris

2 6

Re: [galaxy-dev] Python crashing after latest changeset update (OSX) (Fixed)
by Roy Weckiewicz 25 Mar '10

25 Mar '10

Solved this problem by creating a new instance of galaxy via hg clone and creating a new MySQL database followed by the setup.sh, modifying universe_wsgi.ini to point to my MySQL database and finally run.sh which migrated the database and started the server without a Python crash. On Thu, Mar 25, 2010 at 4:35 PM, Roy Weckiewicz <roystefan(a)gmail.com> wrote: > Hello, > > > After doing a hg pull and update a few minutes ago, my Python (2.5.1) is > crashing on OSX (10.5.8) after I run.sh daemon. The galaxy log doesn't seem > to contain any information about the error and seems to start the galaxy > server just fine (localhost). I've attached osx error report details. Any > ideas? > > > > > Thank you, > > > Roy Weckiewicz > > -- > Roy Weckiewicz > Texas A&M University > -- Roy Weckiewicz Texas A&M University

1 0

Python crashing after latest changeset update (OSX)
by Roy Weckiewicz 25 Mar '10

25 Mar '10

Hello, After doing a hg pull and update a few minutes ago, my Python (2.5.1) is crashing on OSX (10.5.8) after I run.sh daemon. The galaxy log doesn't seem to contain any information about the error and seems to start the galaxy server just fine (localhost). I've attached osx error report details. Any ideas? Thank you, Roy Weckiewicz -- Roy Weckiewicz Texas A&M University

1 0

problems with using the <conditional> after upgrade
by Hotz, Hans-Rudolf 25 Mar '10

25 Mar '10

Hi (I am sorry, if this has been reported already, but I couldn't find it in the archive) This morning, I upgraded one of our local galaxy servers from changeset 2833 to 3545....so far, I haven't encountered any major problems, except for the cases, where we use a conditional, eg: <command> #if $range.mode=="part":#clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_format1 -SEQNOS=$out_format2 -RANGE=$range.seq_range_start,$range.seq_range_end #else :#clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_format1 -SEQNOS=$out_format2 #end if </command> which is pretty much the same as the example for the <conditional> tag set in the wiki (ToolConfigSyntax): <command interpreter="python"> #if $source.source_select=="database":#blat_wrapper.py 0 $source.dbkey $input_query $output1 $iden $tile_size $one_off #else:#blat_wrapper.py 1 $source.input_target $input_query $output1 $iden $tile_size $one_off #end if </command> However, I got the following error (after the upgrade): //// File "/work2/scratch/galaxy/galaxy_dist/eggs/Cheetah-2.2.2-py2.5-linux-x86_64-ucs 4.egg/Cheetah/Parser.py", line 2645, in popFromOpenDirectivesStack raise ParseError(self, msg="#end found, but nothing to end") ParseError: #end found, but nothing to end Line 4, column 1 Line|Cheetah Code ----|------------------------------------------------------------- 2 | #else:#clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_format1 -SEQNOS=$out_format2 3 | #end if 4 | ^ //// after looking around in similar tool config files which have been changed in the distribution, I noticed that the colons are no longer present. I removed both ":" in front of "#clustalw2", resulting in: <command> #if $range.mode=="part" #clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_format1 -SEQNOS=$out_format2 -RANGE=$range.seq_range_start,$range.seq_range_end #else #clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_format1 -SEQNOS=$out_format2 #end if </command> and it worked! was this the correct fix? and if so, could you please update the wiki page, ie removing the two ":" in front of "#blat_wrapper.py" Thank you very much for your help Hans

2 1

[hg] galaxy 3560: Next rev of codingSnps tool.
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/4c95f1a101f1 changeset: 3560:4c95f1a101f1 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Wed Mar 24 14:14:58 2010 -0400 description: Next rev of codingSnps tool. diffstat: tools/evolution/codingSnps.pl | 268 ++++++++++++++++++---------------------- tools/evolution/codingSnps.xml | 2 +- 2 files changed, 124 insertions(+), 146 deletions(-) diffs (423 lines): diff -r bc2e61c2dac1 -r 4c95f1a101f1 tools/evolution/codingSnps.pl --- a/tools/evolution/codingSnps.pl Tue Mar 23 15:43:58 2010 -0400 +++ b/tools/evolution/codingSnps.pl Wed Mar 24 14:14:58 2010 -0400 @@ -9,75 +9,32 @@ # those that cause a frameshift or substitution in the amino acid. ######################################################################### -my $uniq = 0; # flag for whether want uniq positions -my $syn = 0; # flag for if want synonomous changes rather than non-syn -my $seqFlag = "2bit"; # flag to set sequence type 2bit|nib -my $nibDir; # directory containg data -my $nibTag; # tag for directory above - -################################################################################ -# Parse command line arguments # -################################################################################ - -# make sure we have enough arguments if (!@ARGV or scalar @ARGV < 3) { - print STDERR "Usage: codingSnps.pl snps.bed genes.bed locfile.loc [chr=# start=# end=# snp=#] output_file\n"; + print "Usage: codingSnps.pl snps.bed genes.bed (/dir/nib/|Galaxy build= loc=) [chr=# start=# end=# snp=#] > codingSnps.txt\n"; exit; } - -# get first three command line arguments -my $snpFile = shift @ARGV; +my $uniq = 0; #flag for whether want uniq positions +my $syn = 0; #flag for if want synonomous changes rather than non-syn +my $snpFile = shift @ARGV; my $geneFile = shift @ARGV; -my $locFile = shift @ARGV; - -# read $locFile to get $nibDir (ignoring commets) -# FIXME: the last entry is the one you get -open(LF, "< $locFile") || die "open($locFile): $!\n"; -while(<LF>) { - s/#.*$//; - s/(?:^\s+|\s+$)//g; - next if (/^$/); - - # $tag and $path are set for each "valid" line in the file - ($nibTag, $nibDir) = split(/\t/); -} -close(LF); - -# bed like columns in default positions -my $col0 = 0; +my $nibDir = shift @ARGV; +if ($nibDir eq 'Galaxy') { getGalaxyInfo(); } +my $seqFlag = "2bit"; #flag to set sequence type 2bit|nib +my $col0 = 0; #bed like columns in default positions my $col1 = 1; my $col2 = 2; my $col3 = 3; - -# get column positions for chr, start, end, snp -# column positions 1 based coming in (for Galaxy) +#column positions 1 based coming in (for Galaxy) foreach (@ARGV) { - if (/^chr=(\d+)$/) { - $col0 = $1 - 1; - } elsif (/^start=(\d+)$/) { - $col1 = $1 - 1; - } elsif (/^end=(\d+)$/) { - $col2 = $1 - 1; - } elsif (/^snp=(\d+)$/) { - $col3 = $1 - 1; - } + if (/chr=(\d+)/) { $col0 = $1 -1; } + elsif (/start=(\d+)/) { $col1 = $1 -1; } + elsif (/end=(\d+)/) { $col2 = $1 -1; } + elsif (/snp=(\d+)/) { $col3 = $1 -1; } } - -# make sure the column positions are sane if ($col0 < 0 || $col1 < 0 || $col2 < 0 || $col3 < 0) { print STDERR "ERROR column numbers are given with origin 1\n"; exit 1; } - -# get the output_file from the command line arguments -my $outFile = $ARGV[$#ARGV]; - -open(OUTFILE, "> $outFile") || die "open($outFile): $!\n"; - -################################################################################ -# Initialization # -################################################################################ - my @genes; #bed lines for genes, sorted by chrom and start my %chrSt; #index in array where each chrom starts my %codon; #hash of codon amino acid conversions @@ -97,13 +54,7 @@ "V" => "A/C/G", "N" => "A/C/G/T" ); - fill_codon(); - -################################################################################ -# Main # -################################################################################ - open(FH, "cat $geneFile | sort -k1,1 -k2,2n |") or die "Couldn't open and sort $geneFile, $!\n"; my $i = 0; @@ -117,7 +68,7 @@ } close FH or die "Couldn't close $geneFile, $!\n"; -if ($ends) { print STDERR "TESTING using block ends rather than sizes\n"; } +if ($ends) { print STDERR "WARNING using block ends rather than sizes\n"; } #open snps sorted as well my $s1 = $col0 + 1; #sort order is origin 1 @@ -129,6 +80,7 @@ my %done; while(<FH>) { chomp; + if (/^\s*#/) { next; } #comment my @s = split(/\t/); #SNP fields if (!@s or !$s[$col0]) { die "ERROR missing SNP data, $_\n"; } my $size = $#s; @@ -200,14 +152,10 @@ } } close FH or die "Couldn't close $snpFile, $!\n"; -close(OUTFILE) || die "close($outFile): $!\n"; exit; -################################################################################ -# Subroutines # -################################################################################ - +######################################################################## sub processSnp { my $sref = shift; my $gref = shift; @@ -220,7 +168,7 @@ my $i = 0; my @st = split(/,/, $gref->[11]); my @size = split(/,/, $gref->[10]); - if (scalar @st ne $gref->[9]) { die "bad gene $gref->[3]\n"; } + if (scalar @st ne $gref->[9]) { return; } #cant do this gene #die "bad gene $gref->[3]\n"; } my @pos; my $in = 0; for($i = 0; $i < $gref->[9]; $i++) { @@ -246,12 +194,12 @@ my $c = ($copy =~ tr/-//); if ($c % 3 == 0) { return; } #not frameshift #handle bed4 to bed4 + 4 (pgSnp) - print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + print "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; #if ($sref->[4]) { print "\t$sref->[4]"; } #if ($sref->[5]) { print "\t$sref->[5]"; } #if ($sref->[6]) { print "\t$sref->[6]"; } #if ($sref->[7]) { print "\t$sref->[7]"; } - print OUTFILE "\t$gref->[3]\tframeshift\n"; + print "\t$gref->[3]\tframeshift\n"; $done{"$sref->[$col0] $sref->[$col1] $sref->[$col2]"}++; return; }elsif ($sref->[$col1] == $sref->[$col2]) { #insertion @@ -259,12 +207,12 @@ my $c = ($copy =~ tr/\[ACTG]+//); if ($c % 3 == 0) { return; } #not frameshift #handle bed4 to bed4 + 4 (pgSnp) - print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + print "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; #if ($sref->[4]) { print "\t$sref->[4]"; } #if ($sref->[5]) { print "\t$sref->[5]"; } #if ($sref->[6]) { print "\t$sref->[6]"; } #if ($sref->[7]) { print "\t$sref->[7]"; } - print OUTFILE "\t$gref->[3]\tframeshift\n"; + print "\t$gref->[3]\tframeshift\n"; $done{"$sref->[$col0] $sref->[$col1] $sref->[$col2]"}++; return; } @@ -310,6 +258,7 @@ my @vars = split(/\//, $sref->[$col3]); if ($gref->[5] eq '-') { #complement oldnts and revcomp vars $oldnts = compl($oldnts); + if (!$oldnts) { return; } #skip this one $oldnts = join('', (reverse(split(/ */, $oldnts)))); foreach (@vars) { $_ = reverse(split(/ */)); @@ -320,6 +269,7 @@ my @newnts; my $changed = ''; foreach my $v (@vars) { + if (!$v or length($v) != 1) { return; } #only simple changes my @new = split(/ */, $oldnts); $changed = splice(@new, $r, $len, split(/ */, $v)); #should only change single nt @@ -335,8 +285,8 @@ push(@newaa, $t); } if (!$change && $syn) { - print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; - print OUTFILE "\t$gref->[3]\t$oldaa:", join("/", @newaa), "\n"; + print "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + print "\t$gref->[3]\t$oldaa:", join("/", @newaa), "\n"; return; }elsif ($syn) { return; } #only want synonymous changes if (!$change) { return; } #no change in amino acids @@ -346,13 +296,14 @@ #print STDERR "oldnt $oldnts, strand $gref->[5]\n"; #exit; #} - print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + print "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; #if (defined $sref->[4]) { print "\t$sref->[4]"; } #if (defined $sref->[5]) { print "\t$sref->[5]"; } #if (defined $sref->[6]) { print "\t$sref->[6]"; } #if (defined $sref->[7]) { print "\t$sref->[7]"; } if ($gref->[5] eq '-') { $changed = compl($changed); } #use plus for ref - print OUTFILE "\t$gref->[3]\t$oldaa:", join("/", @newaa), "\t$cdNum\t$changed\n"; + if (!$changed) { return; } #skip this one + print "\t$gref->[3]\t$oldaa:", join("/", @newaa), "\t$cdNum\t$changed\n"; $done{"$sref->[$col0] $sref->[$col1] $sref->[$col2]"}++; } } @@ -415,7 +366,7 @@ my $end = shift; my $strand = '+'; $st--; #change to UCSC numbering - open (BIT, "twoBitToFa -seq=$chr -start=$st -end=$end $nibDir/$nibTag.2bit stdout |") or + open (BIT, "twoBitToFa -seq=$chr -start=$st -end=$end $nibDir stdout |") or die "Couldn't run twoBitToFa, $!\n"; my $seq = ''; while (<BIT>) { @@ -423,7 +374,7 @@ if (/^>/) { next; } #header $seq .= $_; } - close BIT or die "Couldn't finish nibFrag on $chr $st $end, $!\n"; + close BIT or die "Couldn't finish twoBitToFa on $chr $st $end, $!\n"; return $seq; } @@ -454,7 +405,7 @@ elsif ($n eq 'G') { $comp .= 'C'; } elsif ($n eq 'N') { $comp .= 'N'; } elsif ($n eq '-') { $comp .= '-'; } #deletion - else { die "Couldn't do complement of $n for $nts\n"; } + else { $comp = undef; } } return $comp; } @@ -473,69 +424,96 @@ } sub fill_codon { - $codon{GCA} = 'Ala'; - $codon{GCC} = 'Ala'; - $codon{GCG} = 'Ala'; - $codon{GCT} = 'Ala'; - $codon{CGG} = 'Arg'; - $codon{CGT} = 'Arg'; - $codon{CGC} = 'Arg'; - $codon{AGA} = 'Arg'; - $codon{AGG} = 'Arg'; - $codon{CGA} = 'Arg'; - $codon{AAC} = 'Asn'; - $codon{AAT} = 'Asn'; - $codon{GAC} = 'Asp'; - $codon{GAT} = 'Asp'; - $codon{TGC} = 'Cys'; - $codon{TGT} = 'Cys'; - $codon{CAG} = 'Gln'; - $codon{CAA} = 'Gln'; - $codon{GAA} = 'Glu'; - $codon{GAG} = 'Glu'; - $codon{GGG} = 'Gly'; - $codon{GGA} = 'Gly'; - $codon{GGC} = 'Gly'; - $codon{GGT} = 'Gly'; - $codon{CAC} = 'His'; - $codon{CAT} = 'His'; - $codon{ATA} = 'Ile'; - $codon{ATT} = 'Ile'; - $codon{ATC} = 'Ile'; - $codon{CTA} = 'Leu'; - $codon{CTC} = 'Leu'; - $codon{CTG} = 'Leu'; - $codon{CTT} = 'Leu'; - $codon{TTG} = 'Leu'; - $codon{TTA} = 'Leu'; - $codon{AAA} = 'Lys'; - $codon{AAG} = 'Lys'; - $codon{ATG} = 'Met'; - $codon{TTC} = 'Phe'; - $codon{TTT} = 'Phe'; - $codon{CCT} = 'Pro'; - $codon{CCA} = 'Pro'; - $codon{CCC} = 'Pro'; - $codon{CCG} = 'Pro'; - $codon{TCA} = 'Ser'; - $codon{AGC} = 'Ser'; - $codon{AGT} = 'Ser'; - $codon{TCC} = 'Ser'; - $codon{TCT} = 'Ser'; - $codon{TCG} = 'Ser'; - $codon{TGA} = 'Stop'; - $codon{TAG} = 'Stop'; - $codon{TAA} = 'Stop'; - $codon{ACT} = 'Thr'; - $codon{ACA} = 'Thr'; - $codon{ACC} = 'Thr'; - $codon{ACG} = 'Thr'; - $codon{TGG} = 'Trp'; - $codon{TAT} = 'Tyr'; - $codon{TAC} = 'Tyr'; - $codon{GTC} = 'Val'; - $codon{GTA} = 'Val'; - $codon{GTG} = 'Val'; - $codon{GTT} = 'Val'; +$codon{GCA} = 'Ala'; +$codon{GCC} = 'Ala'; +$codon{GCG} = 'Ala'; +$codon{GCT} = 'Ala'; +$codon{CGG} = 'Arg'; +$codon{CGT} = 'Arg'; +$codon{CGC} = 'Arg'; +$codon{AGA} = 'Arg'; +$codon{AGG} = 'Arg'; +$codon{CGA} = 'Arg'; +$codon{AAC} = 'Asn'; +$codon{AAT} = 'Asn'; +$codon{GAC} = 'Asp'; +$codon{GAT} = 'Asp'; +$codon{TGC} = 'Cys'; +$codon{TGT} = 'Cys'; +$codon{CAG} = 'Gln'; +$codon{CAA} = 'Gln'; +$codon{GAA} = 'Glu'; +$codon{GAG} = 'Glu'; +$codon{GGG} = 'Gly'; +$codon{GGA} = 'Gly'; +$codon{GGC} = 'Gly'; +$codon{GGT} = 'Gly'; +$codon{CAC} = 'His'; +$codon{CAT} = 'His'; +$codon{ATA} = 'Ile'; +$codon{ATT} = 'Ile'; +$codon{ATC} = 'Ile'; +$codon{CTA} = 'Leu'; +$codon{CTC} = 'Leu'; +$codon{CTG} = 'Leu'; +$codon{CTT} = 'Leu'; +$codon{TTG} = 'Leu'; +$codon{TTA} = 'Leu'; +$codon{AAA} = 'Lys'; +$codon{AAG} = 'Lys'; +$codon{ATG} = 'Met'; +$codon{TTC} = 'Phe'; +$codon{TTT} = 'Phe'; +$codon{CCT} = 'Pro'; +$codon{CCA} = 'Pro'; +$codon{CCC} = 'Pro'; +$codon{CCG} = 'Pro'; +$codon{TCA} = 'Ser'; +$codon{AGC} = 'Ser'; +$codon{AGT} = 'Ser'; +$codon{TCC} = 'Ser'; +$codon{TCT} = 'Ser'; +$codon{TCG} = 'Ser'; +$codon{TGA} = 'Stop'; +$codon{TAG} = 'Stop'; +$codon{TAA} = 'Stop'; +$codon{ACT} = 'Thr'; +$codon{ACA} = 'Thr'; +$codon{ACC} = 'Thr'; +$codon{ACG} = 'Thr'; +$codon{TGG} = 'Trp'; +$codon{TAT} = 'Tyr'; +$codon{TAC} = 'Tyr'; +$codon{GTC} = 'Val'; +$codon{GTA} = 'Val'; +$codon{GTG} = 'Val'; +$codon{GTT} = 'Val'; } - + +sub getGalaxyInfo { + my $build; + my $locFile; + foreach (@ARGV) { + if (/build=(.*)/) { $build = $1; } + elsif (/loc=(.*)/) { $locFile = $1; } + } + if (!$build or !$locFile) { + print STDERR "ERROR missing build or locfile for Galaxy input\n"; + exit 1; + } + # read $locFile to get $nibDir (ignoring commets) + open(LF, "< $locFile") || die "open($locFile): $!\n"; + while(<LF>) { + s/#.*$//; + s/(?:^\s+|\s+$)//g; + next if (/^$/); + + my @t = split(/\t/); + if ($t[0] eq $build) { $nibDir = $t[1]; } + } + close(LF); + if ($nibDir eq 'Galaxy') { + print STDERR "Failed to find sequence directory in locfile $locFile\n"; + } + $nibDir .= "/$build.2bit"; #we want full path and filename +} diff -r bc2e61c2dac1 -r 4c95f1a101f1 tools/evolution/codingSnps.xml --- a/tools/evolution/codingSnps.xml Tue Mar 23 15:43:58 2010 -0400 +++ b/tools/evolution/codingSnps.xml Wed Mar 24 14:14:58 2010 -0400 @@ -1,7 +1,7 @@ <tool id="codingSnps" name="Amino-acid changes"> <description>caused by a set of SNPs</description> <command interpreter="perl"> - codingSnps.pl $input1 $input2 ${GALAXY_DATA_INDEX_DIR}/codingSnps.loc chr=${input1.metadata.chromCol} start=${input1.metadata.startCol} end=${input1.metadata.endCol} snp=$col1 $out_file1 + codingSnps.pl $input1 $input2 Galaxy build=${input1.metadata.dbkey} loc=${GALAXY_DATA_INDEX_DIR}/codingSnps.loc chr=${input1.metadata.chromCol} start=${input1.metadata.startCol} end=${input1.metadata.endCol} snp=$col1 > $out_file1 </command> <inputs> <param format="interval" name="input1" type="data" label="SNPs"/>

1 0

[hg] galaxy 3559: Add the add_scores tool.
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/bc2e61c2dac1 changeset: 3559:bc2e61c2dac1 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Tue Mar 23 15:43:58 2010 -0400 description: Add the add_scores tool. diffstat: test-data/add_scores_input1.interval | 20 +++++++++++ test-data/add_scores_input2.bed | 25 ++++++++++++++ test-data/add_scores_output1.interval | 20 +++++++++++ test-data/add_scores_output2.interval | 25 ++++++++++++++ tool-data/add_scores.loc.sample | 21 ++++++++++++ tool_conf.xml.sample | 1 + tools/evolution/add_scores.xml | 60 +++++++++++++++++++++++++++++++++++ 7 files changed, 172 insertions(+), 0 deletions(-) diffs (206 lines): diff -r dfaa18960944 -r bc2e61c2dac1 test-data/add_scores_input1.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/add_scores_input1.interval Tue Mar 23 15:43:58 2010 -0400 @@ -0,0 +1,20 @@ +chr20 74149 74150 G G +chr22 14642921 14642922 C A +chr20 74148 74149 T C +chr22 15452519 15452520 C C +chr22 15472687 15472688 C N +chr22 15508088 15508089 G G +chr22 15534573 15534574 C C +chr20 24770 24771 C C +chr20 24961 24962 T T +chr22 15451993 15451994 C C +chr22 14667850 14667851 G G +chr22 15452482 15452483 A G +chr20 71317 71318 T T +chr20 74223 74224 A A +chr22 15453065 15453066 A G +chr20 74284 74285 T T +chr20 74309 74310 A A +chr22 15472610 15472611 G N +chr20 86193 86194 C C +chr20 87418 87419 C C diff -r dfaa18960944 -r bc2e61c2dac1 test-data/add_scores_input2.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/add_scores_input2.bed Tue Mar 23 15:43:58 2010 -0400 @@ -0,0 +1,25 @@ +chr1 90000 90001 A +chr2 90000 90001 A +chr3 90000 90001 A +chr4 90000 90001 A +chr5 90000 90001 A +chr6 90000 90001 A +chr7 90000 90001 A +chr8 90000 90001 A +chr9 90000 90001 A +chr10 90000 90001 A +chr11 90000 90001 A +chr12 90000 90001 A +chr13 90000 90001 A +chr14 90000 90001 A +chr15 90000 90001 A +chr16 90000 90001 A +chr17 90000 90001 A +chr18 90000 90001 A +chr19 90000 90001 A +chr20 90000 90001 A +chr21 90000 90001 A +chr22 90000 90001 A +chrX 90000 90001 A +chrY 90000 90001 A +chrM 9000 9001 A diff -r dfaa18960944 -r bc2e61c2dac1 test-data/add_scores_output1.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/add_scores_output1.interval Tue Mar 23 15:43:58 2010 -0400 @@ -0,0 +1,20 @@ +chr20 74149 74150 G G 0.885 +chr22 14642921 14642922 C A -1.844 +chr20 74148 74149 T C -3.161 +chr22 15452519 15452520 C C -1.138 +chr22 15472687 15472688 C N NA +chr22 15508088 15508089 G G -1.398 +chr22 15534573 15534574 C C 0.460 +chr20 24770 24771 C C -1.374 +chr20 24961 24962 T T -1.599 +chr22 15451993 15451994 C C 0.645 +chr22 14667850 14667851 G G 0.469 +chr22 15452482 15452483 A G -1.246 +chr20 71317 71318 T T -0.825 +chr20 74223 74224 A A -1.451 +chr22 15453065 15453066 A G -0.776 +chr20 74284 74285 T T -0.701 +chr20 74309 74310 A A -0.863 +chr22 15472610 15472611 G N NA +chr20 86193 86194 C C 0.887 +chr20 87418 87419 C C -1.703 diff -r dfaa18960944 -r bc2e61c2dac1 test-data/add_scores_output2.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/add_scores_output2.interval Tue Mar 23 15:43:58 2010 -0400 @@ -0,0 +1,25 @@ +chr1 90000 90001 A 0.431 +chr2 90000 90001 A 0.514 +chr3 90000 90001 A 0.808 +chr4 90000 90001 A 0.456 +chr5 90000 90001 A 0.446 +chr6 90000 90001 A 0.397 +chr7 90000 90001 A 0.446 +chr8 90000 90001 A NA +chr9 90000 90001 A 0.470 +chr10 90000 90001 A 0.463 +chr11 90000 90001 A 0.369 +chr12 90000 90001 A 0.557 +chr13 90000 90001 A NA +chr14 90000 90001 A NA +chr15 90000 90001 A NA +chr16 90000 90001 A 0.819 +chr17 90000 90001 A -0.993 +chr18 90000 90001 A 0.657 +chr19 90000 90001 A 0.372 +chr20 90000 90001 A 0.360 +chr21 90000 90001 A NA +chr22 90000 90001 A NA +chrX 90000 90001 A 0.414 +chrY 90000 90001 A 0.414 +chrM 9000 9001 A -0.587 diff -r dfaa18960944 -r bc2e61c2dac1 tool-data/add_scores.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/add_scores.loc.sample Tue Mar 23 15:43:58 2010 -0400 @@ -0,0 +1,21 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of gzipped genome files for use with add_scores. You will +#need to supply these files and then create a add_scores.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The add_scores.loc +#file has this format (white space characters are TAB characters): +# +#<build> <file_path> +# +#So, for example, if your add_scores.loc began like this: +# +#hg18 /afs/bx.psu.edu/depot/data/genome/hg18/misc/phyloP/ +# +#then your /afs/bx.psu.edu/depot/data/genome/hg18/misc/phyloP/ directory +#would need to contain the following gzipped files, among others: +# +#-rw-r--r-- 1 rico rico 161981190 2010-03-19 12:48 chr10.phyloP44way.primate.wigFix.gz +#-rw-r--r-- 1 rico rico 54091 2010-03-19 12:56 chr10_random.phyloP44way.primate.wigFix.gz +#-rw-r--r-- 1 rico rico 158621990 2010-03-19 12:46 chr11.phyloP44way.primate.wigFix.gz +# +hg18 /galaxy/data/hg18/misc/phyloP diff -r dfaa18960944 -r bc2e61c2dac1 tool_conf.xml.sample --- a/tool_conf.xml.sample Tue Mar 23 13:53:21 2010 -0400 +++ b/tool_conf.xml.sample Tue Mar 23 15:43:58 2010 -0400 @@ -162,6 +162,7 @@ <tool file="hyphy/hyphy_dnds_wrapper.xml" /> <tool file="evolution/mutate_snp_codon.xml" /> <tool file="evolution/codingSnps.xml" /> + <tool file="evolution/add_scores.xml" /> </section> <section name="Metagenomic analyses" id="tax_manipulation"> <tool file="taxonomy/gi2taxonomy.xml" /> diff -r dfaa18960944 -r bc2e61c2dac1 tools/evolution/add_scores.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/evolution/add_scores.xml Tue Mar 23 15:43:58 2010 -0400 @@ -0,0 +1,60 @@ +<tool id="add_scores" name="Add scores"> + <description>for interspecies conservation at each SNPs</description> + <command> + add_scores $input1 ${input1.metadata.dbkey} ${input1.metadata.chromCol} ${input1.metadata.startCol} ${GALAXY_DATA_INDEX_DIR}/add_scores.loc $out_file1 + </command> + <inputs> + <param format="interval" name="input1" type="data" label="SNPs"/> + </inputs> + <outputs> + <data format="input" name="out_file1" /> + </outputs> + <tests> + <test> + <param name="input1" value="add_scores_input1.interval" dbkey="hg18" /> + <output name="output" file="add_scores_output1.interval" /> + </test> + <test> + <param name="input1" value="add_scores_input2.bed" dbkey="hg18" /> + <output name="output" file="add_scores_output2.interval" /> + </test> + </tests> + + <help> +This tool adds a column that measures interspecies conservation at each SNP position, using conservation scores for primates computed by the phyloP program. It currently works only for hg18. + +**Example** + +- input file, with SNPs:: + + chr22 16440426 14440427 C/T + chr22 15494851 14494852 A/G + chr22 14494911 14494912 A/T + chr22 14550435 14550436 A/G + chr22 14611956 14611957 G/T + chr22 14612076 14612077 A/G + chr22 14668537 14668538 C + chr22 14668703 14668704 A/T + chr22 14668775 14668776 G + chr22 14680074 14680075 A/T + etc. + +- output file, showing non-synonymous substitutions in coding regions:: + + chr22 16440426 14440427 C/T 0.509 + chr22 15494851 14494852 A/G 0.427 + chr22 14494911 14494912 A/T NA + chr22 14550435 14550436 A/G NA + chr22 14611956 14611957 G/T -2.142 + chr22 14612076 14612077 A/G 0.369 + chr22 14668537 14668538 C 0.419 + chr22 14668703 14668704 A/T -1.462 + chr22 14668775 14668776 G 0.470 + chr22 14680074 14680075 A/T 0.000 + chr22 14680074 14680075 A/T 0.303 + etc. + +"NA", means that the phyloP score was not available. + +</help> +</tool>

1 0

[hg] galaxy 3558: Add the codingSnps tool.
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/dfaa18960944 changeset: 3558:dfaa18960944 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Tue Mar 23 13:53:21 2010 -0400 description: Add the codingSnps tool. diffstat: test-data/codingSnps_input1.interval | 21 + test-data/codingSnps_input2.bed | 20 + test-data/codingSnps_output.interval | 21 + tool-data/codingSnps.loc.sample | 25 + tool_conf.xml.sample | 1 + tools/evolution/codingSnps.pl | 541 +++++++++++++++++++++++++++++++++++ tools/evolution/codingSnps.xml | 89 +++++ tools/evolution/codingSnps_filter.py | 43 ++ 8 files changed, 761 insertions(+), 0 deletions(-) diffs (799 lines): diff -r a67ca0795efb -r dfaa18960944 test-data/codingSnps_input1.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/codingSnps_input1.interval Tue Mar 23 13:53:21 2010 -0400 @@ -0,0 +1,21 @@ +chr1 1415785 1415786 C C S N C N C N C +chr1 1420777 1420778 C C Y N C N C N C +chr1 1469195 1469196 A G R R G G G G G +chr1 1541789 1541790 T C Y Y N Y N T N +chr1 1548654 1548655 T T C N C N N N N +chr1 1549089 1549090 T C A A T A N A N +chr1 1551984 1551985 C C Y N C N N N N +chr1 1571349 1571350 G A R N N N N N N +chr1 1571354 1571355 G G R N N N N N N +chr1 1589750 1589751 A G G N G N G N G +chr1 1675899 1675900 G A C C G C G C N +chr1 1714578 1714579 G G R N A N G N G +chr1 1837838 1837839 T C Y N T N T N C +chr1 1839388 1839389 A A T T A T A T A +chr1 1839389 1839390 T T Y N T N T N C +chr1 1839603 1839604 G G R N G N G N R +chr1 1843968 1843969 A G G G R R A A G +chr1 1844405 1844406 C C Y Y C C N C Y +chr1 1876878 1876879 A G G N N N N N N +chr1 1886192 1886193 G N R N G N N N N +chr1 1890091 1890092 T C Y Y C C N C N diff -r a67ca0795efb -r dfaa18960944 test-data/codingSnps_input2.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/codingSnps_input2.bed Tue Mar 23 13:53:21 2010 -0400 @@ -0,0 +1,20 @@ +chr1 67051161 67163158 ENST00000371026 0 - 67052400 67163102 0 17 1290,157,227,99,122,158,152,87,203,195,156,140,157,113,185,175,226, 0,9470,13929,14921,20694,21100,22735,24819,27578,34593,49256,58479,61890,78263,80338,92310,111771, +chr1 67075869 67163055 ENST00000371023 0 - 67075923 67162979 0 10 198,203,195,156,140,157,113,185,175,123, 0,2870,9885,24548,33771,37182,53555,55630,67602,87063, +chr1 1843259 1849228 ENST00000378596 0 - 1843585 1847183 0 10 428,135,161,133,155,130,156,120,56,1278, 0,628,1024,1406,1814,2430,3822,4267,4496,4691, +chr1 1874611 1925136 ENST00000270720 0 - 1876876 1912255 0 18 2538,165,90,67,119,174,156,199,158,103,111,174,105,99,144,85,86,137, 0,3307,5807,6651,10436,11575,13058,15322,17346,18667,19624,20712,32073,33624,35199,35576,37577,50388, +chr1 1838889 1840572 ENST00000310991 0 - 1839180 1840564 0 5 572,179,42,44,92, 0,662,1302,1454,1591, +chr1 1838888 1840096 ENST00000378602 0 - 1839180 1839855 0 2 573,545, 0,663, +chr1 1672537 1699769 ENST00000344463 0 - 1674202 1686705 0 14 1822,83,158,100,155,103,86,155,204,143,169,84,219,182, 0,2328,2812,3045,3305,4135,5019,5264,5868,7862,8495,10713,13989,27050, +chr1 1836125 1838593 ENST00000307786 0 + 1836579 1838492 0 6 481,51,175,145,101,148, 0,858,1614,1925,2147,2320, +chr1 1672530 1701368 ENST00000378625 0 - 1674202 1686705 0 14 1829,83,158,100,155,103,86,155,204,143,169,84,219,165, 0,2335,2819,3052,3312,4142,5026,5271,5875,7869,8502,10720,13996,28673, +chr1 1672537 1699769 ENST00000341426 0 - 1674202 1686705 0 12 1822,83,158,100,155,103,86,106,130,84,219,182, 0,2328,2812,3045,3305,4135,5019,5264,5942,10713,13989,27050, +chr1 1540746 1555847 ENST00000378710 0 + 1540873 1555773 0 19 130,107,311,172,107,195,143,105,163,134,149,157,161,127,234,179,182,66,313, 0,1004,7885,8270,9291,9487,9782,11146,11333,11570,11792,12169,12515,12769,12985,13629,13881,14135,14788, +chr1 1672530 1700089 ENST00000341991 0 - 1674202 1686705 0 12 1829,83,158,100,155,103,86,106,130,84,219,45, 0,2335,2819,3052,3312,4142,5026,5271,5949,10720,13996,27514, +chr1 1540746 1555847 ENST00000355826 0 + 1540873 1555773 0 20 130,107,311,172,107,195,143,108,105,163,134,149,157,161,127,234,179,182,66,313, 0,1004,7885,8270,9291,9487,9782,10042,11146,11333,11570,11792,12169,12515,12769,12985,13629,13881,14135,14788, +chr1 1836125 1838593 ENST00000378604 0 + 1836579 1838492 0 5 481,175,145,101,148, 0,1614,1925,2147,2320, +chr1 1540746 1555847 ENST00000357882 0 + 1540873 1555773 0 19 130,107,311,172,107,143,108,105,163,134,149,157,161,127,234,179,182,66,313, 0,1004,7885,8270,9291,9782,10042,11146,11333,11570,11792,12169,12515,12769,12985,13629,13881,14135,14788, +chr1 1540746 1555847 ENST00000357882 0 + 1540873 1555773 0 19 130,107,311,172,107,143,108,105,163,134,149,157,161,127,234,179,182,66,313, 0,1004,7885,8270,9291,9782,10042,11146,11333,11570,11792,12169,12515,12769,12985,13629,13881,14135,14788, +chr1 67075991 67163158 ENST00000395250 0 - 67075991 67113089 0 11 27,45,203,195,156,140,157,113,185,175,226, 0,31,2748,9763,24426,33649,37060,53433,55508,67480,86941, +chr1 201326404 201403155 ENST00000309502 0 + 201364592 201401651 0 6 81,18,100,155,398,2144, 0,1039,37175,37624,38131,74607, +chr1 8335052 8508585 ENST00000377464 0 - 8337733 8508430 0 17 2715,181,147,721,223,1379,114,162,200,93,163,81,99,100,125,49,181, 0,3013,3694,5790,7358,7706,9357,10277,11650,12340,13406,70321,113519,142657,144999,156220,173352, +chr1 8335054 8800286 ENST00000400908 0 - 8337733 8638943 0 23 2713,181,147,721,223,1379,114,162,200,93,163,81,99,100,125,49,105,97,106,126,71,469,481, 0,3011,3692,5788,7356,7704,9355,10275,11648,12338,13404,70319,113517,142655,144997,156218,188805,204066,205009,262152,271901,303564,464751, diff -r a67ca0795efb -r dfaa18960944 test-data/codingSnps_output.interval --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/codingSnps_output.interval Tue Mar 23 13:53:21 2010 -0400 @@ -0,0 +1,21 @@ +chr1 1541789 1541790 C/T ENST00000355826 Phe:Leu/Phe 15 T +chr1 1541789 1541790 C/T ENST00000357882 Phe:Leu/Phe 15 T +chr1 1541789 1541790 C/T ENST00000357882 Phe:Leu/Phe 15 T +chr1 1541789 1541790 C/T ENST00000378710 Phe:Leu/Phe 15 T +chr1 1548654 1548655 C ENST00000355826 Met:Thr 45 T +chr1 1548654 1548655 C ENST00000357882 Met:Thr 45 T +chr1 1548654 1548655 C ENST00000357882 Met:Thr 45 T +chr1 1548654 1548655 C ENST00000378710 Met:Thr 45 T +chr1 1675899 1675900 C ENST00000341991 Asn:Lys 262 G +chr1 1675899 1675900 C ENST00000378625 Asn:Lys 407 G +chr1 1675899 1675900 C ENST00000341426 Asn:Lys 262 G +chr1 1675899 1675900 C ENST00000344463 Asn:Lys 407 G +chr1 1837838 1837839 C/T ENST00000307786 Trp:Arg/Trp 60 T +chr1 1837838 1837839 C/T ENST00000378604 Trp:Arg/Trp 43 T +chr1 1839388 1839389 T ENST00000378602 Met:Lys 126 A +chr1 1839388 1839389 T ENST00000310991 Met:Lys 141 A +chr1 1839389 1839390 C/T ENST00000378602 Met:Val/Met 126 T +chr1 1839389 1839390 C/T ENST00000310991 Met:Val/Met 141 T +chr1 1844405 1844406 C/T ENST00000378596 Glu:Glu/Lys 187 C +chr1 1876878 1876879 G ENST00000270720 Stop:Gln 763 A +chr1 1890091 1890092 C/T ENST00000270720 Ile:Val/Ile 363 T diff -r a67ca0795efb -r dfaa18960944 tool-data/codingSnps.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/codingSnps.loc.sample Tue Mar 23 13:53:21 2010 -0400 @@ -0,0 +1,25 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of nib genome files for use with codingSnps. You will +#need to supply these files and then create a codingSnps.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The codingSnps.loc +#file has this format (white space characters are TAB characters): +# +#<build> <file_path> +# +#So, for example, if your codingSnps.loc began like this: +# +#hg18 /afs/bx.psu.edu/depot/data/genome/hg18/ + +# +#then your /afs/bx.psu.edu/depot/data/genome/hg18/ directory +#would need to contain the following 2bit file: +# +# +#-rw-r--r-- 1 g2data g2data 807604784 Dec 8 13:21 hg18.2bit + +#Your codingSnps.loc file should include an entry per line for +#each file you have stored that you want to be available. Note that +#your files should all have the extension '2bit'. + +hg18 /afs/bx.psu.edu/depot/data/genome/hg18 diff -r a67ca0795efb -r dfaa18960944 tool_conf.xml.sample --- a/tool_conf.xml.sample Tue Mar 23 13:15:56 2010 -0400 +++ b/tool_conf.xml.sample Tue Mar 23 13:53:21 2010 -0400 @@ -161,6 +161,7 @@ <tool file="hyphy/hyphy_nj_tree_wrapper.xml" /> <tool file="hyphy/hyphy_dnds_wrapper.xml" /> <tool file="evolution/mutate_snp_codon.xml" /> + <tool file="evolution/codingSnps.xml" /> </section> <section name="Metagenomic analyses" id="tax_manipulation"> <tool file="taxonomy/gi2taxonomy.xml" /> diff -r a67ca0795efb -r dfaa18960944 tools/evolution/codingSnps.pl --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/evolution/codingSnps.pl Tue Mar 23 13:53:21 2010 -0400 @@ -0,0 +1,541 @@ +#!/usr/bin/perl -w +use strict; + +######################################################################### +# codingSnps.pl +# This takes a bed file with the names being / separated nts +# and a gene bed file with cds start and stop. +# It then checks for changes in coding regions, reporting +# those that cause a frameshift or substitution in the amino acid. +######################################################################### + +my $uniq = 0; # flag for whether want uniq positions +my $syn = 0; # flag for if want synonomous changes rather than non-syn +my $seqFlag = "2bit"; # flag to set sequence type 2bit|nib +my $nibDir; # directory containg data +my $nibTag; # tag for directory above + +################################################################################ +# Parse command line arguments # +################################################################################ + +# make sure we have enough arguments +if (!@ARGV or scalar @ARGV < 3) { + print STDERR "Usage: codingSnps.pl snps.bed genes.bed locfile.loc [chr=# start=# end=# snp=#] output_file\n"; + exit; +} + +# get first three command line arguments +my $snpFile = shift @ARGV; +my $geneFile = shift @ARGV; +my $locFile = shift @ARGV; + +# read $locFile to get $nibDir (ignoring commets) +# FIXME: the last entry is the one you get +open(LF, "< $locFile") || die "open($locFile): $!\n"; +while(<LF>) { + s/#.*$//; + s/(?:^\s+|\s+$)//g; + next if (/^$/); + + # $tag and $path are set for each "valid" line in the file + ($nibTag, $nibDir) = split(/\t/); +} +close(LF); + +# bed like columns in default positions +my $col0 = 0; +my $col1 = 1; +my $col2 = 2; +my $col3 = 3; + +# get column positions for chr, start, end, snp +# column positions 1 based coming in (for Galaxy) +foreach (@ARGV) { + if (/^chr=(\d+)$/) { + $col0 = $1 - 1; + } elsif (/^start=(\d+)$/) { + $col1 = $1 - 1; + } elsif (/^end=(\d+)$/) { + $col2 = $1 - 1; + } elsif (/^snp=(\d+)$/) { + $col3 = $1 - 1; + } +} + +# make sure the column positions are sane +if ($col0 < 0 || $col1 < 0 || $col2 < 0 || $col3 < 0) { + print STDERR "ERROR column numbers are given with origin 1\n"; + exit 1; +} + +# get the output_file from the command line arguments +my $outFile = $ARGV[$#ARGV]; + +open(OUTFILE, "> $outFile") || die "open($outFile): $!\n"; + +################################################################################ +# Initialization # +################################################################################ + +my @genes; #bed lines for genes, sorted by chrom and start +my %chrSt; #index in array where each chrom starts +my %codon; #hash of codon amino acid conversions +my $ends = 0; #ends vs sizes in bed 11 position, starts relative to chrom +my $ignoreN = 1; #skip N + +my %amb = ( +"R" => "A/G", +"Y" => "C/T", +"S" => "C/G", +"W" => "A/T", +"K" => "G/T", +"M" => "A/C", +"B" => "C/G/T", +"D" => "A/G/T", +"H" => "A/C/T", +"V" => "A/C/G", +"N" => "A/C/G/T" +); + +fill_codon(); + +################################################################################ +# Main # +################################################################################ + +open(FH, "cat $geneFile | sort -k1,1 -k2,2n |") + or die "Couldn't open and sort $geneFile, $!\n"; +my $i = 0; +while(<FH>) { + chomp; + if (/refGene.cdsEnd|ccdsGene.exonEnds/) { $ends = 1; next; } + push(@genes, "$_"); + my @f = split(/\t/); + if (!exists $chrSt{$f[0]}) { $chrSt{$f[0]} = $i; } + $i++; +} +close FH or die "Couldn't close $geneFile, $!\n"; + +if ($ends) { print STDERR "TESTING using block ends rather than sizes\n"; } + +#open snps sorted as well +my $s1 = $col0 + 1; #sort order is origin 1 +my $s2 = $col1 + 1; +open(FH, "cat $snpFile | sort -k$s1,$s1 -k$s2,${s2}n |") + or die "Couldn't open and sort $snpFile, $!\n"; +$i = 0; +my @g; #one genes fields, should be used repeatedly +my %done; +while(<FH>) { + chomp; + my @s = split(/\t/); #SNP fields + if (!@s or !$s[$col0]) { die "ERROR missing SNP data, $_\n"; } + my $size = $#s; + if ($col0 > $size || $col1 > $size || $col2 > $size || $col3 > $size) { + print STDERR "ERROR file has fewer columns than requested, requested columns (0 based) $col0 $col1 $col2 $col3, file has $size\n"; + exit 1; + } + if ($s[$col1] =~ /\D/) { + print STDERR "ERROR the start point must be an integer not $s[$col1]\n"; + exit 1; + } + if ($s[$col2] =~ /\D/) { + print STDERR "ERROR the start point must be an integer not $s[$col2]\n"; + exit 1; + } + if ($s[$col3] eq 'N' && $ignoreN) { next; } + if (exists $amb{$s[$col3]}) { $s[$col3] = $amb{$s[$col3]}; } + if (!@g && exists $chrSt{$s[$col0]}) { #need to fetch first gene row + $i = $chrSt{$s[$col0]}; + @g = split(/\t/, $genes[$i]); + }elsif (!@g) { + next; #no gene for this chrom + }elsif ($s[$col0] ne $g[0] && exists $chrSt{$s[$col0]}) { #new chrom + $i = $chrSt{$s[$col0]}; + @g = split(/\t/, $genes[$i]); + }elsif ($s[$col0] ne $g[0]) { + next; #no gene for this chrom + }elsif ($s[$col1] < $g[1] && $i == $chrSt{$s[$col0]}) { + next; #before any genes + }elsif ($s[$col1] > $g[2] && ($i == $#genes or $genes[$i+1] !~ $s[$col0])) { + next; #after all genes on chr + }else { + while ($s[$col1] > $g[2] && $i < $#genes) { + $i++; + @g = split(/\t/, $genes[$i]); + if ($s[$col0] ne $g[0]) { last; } #end of gene + } + if ($s[$col0] ne $g[0] or $s[$col1] < $g[1] or $s[$col1] > $g[2]) { + next; #no overlap with genes + } + } + + processSnp(\@s, \@g); + if ($uniq && exists $done{"$s[$col0] $s[$col1] $s[$col2]"}) { next; } + + my $k = $i + 1; #check for more genes without losing data of first + if ($k <= $#genes) { + my @g2 = split(/\t/, $genes[$k]); + while (@g2 && $k <= $#genes) { + @g2 = split(/\t/, $genes[$k]); + if ($s[$col0] ne $g2[0]) { + undef @g2; + last; #not same chrom + }else { + while ($s[$col1] > $g2[2] && $k <= $#genes) { + $k++; + @g2 = split(/\t/, $genes[$k]); + if ($s[$col0] ne $g2[0]) { last; } #end of chrom + } + if ($s[$col0] ne $g2[0] or $s[$col1] < $g2[1] or $s[$col1] > $g2[2]) { + undef @g2; + last; #no overlap with more genes + } + processSnp(\@s, \@g2); + if ($uniq && exists $done{"$s[$col0] $s[$col1] $s[$col2]"}) { last; } + } + $k++; + } + } +} +close FH or die "Couldn't close $snpFile, $!\n"; +close(OUTFILE) || die "close($outFile): $!\n"; + +exit; + +################################################################################ +# Subroutines # +################################################################################ + +sub processSnp { + my $sref = shift; + my $gref = shift; + #overlaps gene, but maybe not coding seq + #inside cds + if ($sref->[$col1] + 1 < $gref->[6] or $sref->[$col2] > $gref->[7]) { + return; #outside of coding + } + #now check exon + my $i = 0; + my @st = split(/,/, $gref->[11]); + my @size = split(/,/, $gref->[10]); + if (scalar @st ne $gref->[9]) { die "bad gene $gref->[3]\n"; } + my @pos; + my $in = 0; + for($i = 0; $i < $gref->[9]; $i++) { + my $sta = $gref->[1] + $st[$i] + 1; #1 based position + my $end = $sta + $size[$i] - 1; # + if ($ends) { $end = $size[$i]; $sta = $st[$i] + 1; } #ends instead of sizes + if ($end < $gref->[6]) { next; } #utr only + if ($sta > $gref->[7]) { next; } #utr only + #shorten to coding only + if ($sta < $gref->[6]) { $sta = $gref->[6] + 1; } + if ($end > $gref->[7]) { $end = $gref->[7]; } + if ($sref->[$col1] + 1 >= $sta && $sref->[$col2] <= $end) { $in = 1; } + elsif ($sref->[$col1] == $sref->[$col2] && $sref->[$col2] <= $end && $sref->[$col2] >= $sta) { $in = 1; } + push(@pos, ($sta .. $end)); #add exon worth of positions + } + #@pos has coding positions for whole gene (chr coors), + #and $in has whether we need to continue + if (!$in) { return; } #not in coding exon + if ((scalar @pos) % 3 != 0) { return; } #partial gene? not even codons + if ($sref->[$col3] =~ /^-+\/[ACTG]+$/ or $sref->[$col3] =~ /^[ACTG]+\/-+$/ or + $sref->[$col3] =~ /^-+$/) { #indel or del + my $copy = $sref->[$col3]; + my $c = ($copy =~ tr/-//); + if ($c % 3 == 0) { return; } #not frameshift + #handle bed4 to bed4 + 4 (pgSnp) + print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + #if ($sref->[4]) { print "\t$sref->[4]"; } + #if ($sref->[5]) { print "\t$sref->[5]"; } + #if ($sref->[6]) { print "\t$sref->[6]"; } + #if ($sref->[7]) { print "\t$sref->[7]"; } + print OUTFILE "\t$gref->[3]\tframeshift\n"; + $done{"$sref->[$col0] $sref->[$col1] $sref->[$col2]"}++; + return; + }elsif ($sref->[$col1] == $sref->[$col2]) { #insertion + my $copy = $sref->[$col3]; + my $c = ($copy =~ tr/\[ACTG]+//); + if ($c % 3 == 0) { return; } #not frameshift + #handle bed4 to bed4 + 4 (pgSnp) + print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + #if ($sref->[4]) { print "\t$sref->[4]"; } + #if ($sref->[5]) { print "\t$sref->[5]"; } + #if ($sref->[6]) { print "\t$sref->[6]"; } + #if ($sref->[7]) { print "\t$sref->[7]"; } + print OUTFILE "\t$gref->[3]\tframeshift\n"; + $done{"$sref->[$col0] $sref->[$col1] $sref->[$col2]"}++; + return; + } + #check for amino acid substitutions + my $s = $sref->[$col1] + 1; + my $e = $sref->[$col2]; + my $len = $sref->[$col2] - $sref->[$col1]; + if ($gref->[5] eq '-') { + @pos = reverse(@pos); + my $t = $s; + $s = $e; + $e = $t; + } + $i = 0; + my $found = 0; + foreach (@pos) { + if ($s == $_) { + $found = 1; + last; + } + $i++; + } + if ($found) { + my $fs = $i; #keep original start index + #have index where substitution starts + my $cp = $i % 3; + $i -= $cp; #i is now first position in codon + my $cdNum = int($i / 3) + 1; + my $ls = $i; + if (!defined $ls) { die "ERROR not defined ls for $fs $sref->[$col2]\n"; } + if (!@pos) { die "ERROR not defined array pos\n"; } + if (!defined $pos[$ls]) { die "ERROR not defined pos at $ls\n"; } + if (!defined $e) { die "ERROR not defined e for $pos[0] $pos[1] $pos[2]\n"; } + while ($ls <= $#pos && $pos[$ls] ne $e) { + $ls++; + } + my $i2 = $ls + (2 - ($ls % 3)); + if ($i2 > $#pos) { return; } #not a full codon, partial gene? + + if ($i2 - $i < 2) { die "not a full codon positions $i to $i2 for $sref->[3]\n"; } + my $oldnts = getnts($sref->[$col0], @pos[$i..$i2]); + if (!$oldnts) { die "Failed to get sequence for $sref->[$col0] $pos[$i] .. $pos[$i2]\n"; } + my @vars = split(/\//, $sref->[$col3]); + if ($gref->[5] eq '-') { #complement oldnts and revcomp vars + $oldnts = compl($oldnts); + $oldnts = join('', (reverse(split(/ */, $oldnts)))); + foreach (@vars) { + $_ = reverse(split(/ */)); + $_ = compl($_); + } + } + my $r = $fs - $i; #difference in old indexes gives new index + my @newnts; + my $changed = ''; + foreach my $v (@vars) { + my @new = split(/ */, $oldnts); + $changed = splice(@new, $r, $len, split(/ */, $v)); + #should only change single nt + push(@newnts, join("", @new)); + } + #now compute amino acids + my $oldaa = getaa($oldnts); + my @newaa; + my $change = 0; #flag for if there is a change + foreach my $v (@newnts) { + my $t = getaa($v); + if ($t ne $oldaa) { $change = 1; } + push(@newaa, $t); + } + if (!$change && $syn) { + print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + print OUTFILE "\t$gref->[3]\t$oldaa:", join("/", @newaa), "\n"; + return; + }elsif ($syn) { return; } #only want synonymous changes + if (!$change) { return; } #no change in amino acids +#if (abs($pos[$i] - $pos[$i2]) > 200) { +#print STDERR "TESTING found mutation at splice site $sref->[0]\t$sref->[1]\t$sref->[2]\n"; +#print STDERR "old $oldaa, new ", join(', ', @newaa), "\n"; +#print STDERR "oldnt $oldnts, strand $gref->[5]\n"; +#exit; +#} + print OUTFILE "$sref->[$col0]\t$sref->[$col1]\t$sref->[$col2]\t$sref->[$col3]"; + #if (defined $sref->[4]) { print "\t$sref->[4]"; } + #if (defined $sref->[5]) { print "\t$sref->[5]"; } + #if (defined $sref->[6]) { print "\t$sref->[6]"; } + #if (defined $sref->[7]) { print "\t$sref->[7]"; } + if ($gref->[5] eq '-') { $changed = compl($changed); } #use plus for ref + print OUTFILE "\t$gref->[3]\t$oldaa:", join("/", @newaa), "\t$cdNum\t$changed\n"; + $done{"$sref->[$col0] $sref->[$col1] $sref->[$col2]"}++; + } +} + +sub getnts { + my $chr = shift; + my @pos = @_; #list of positions not necessarily in order + #list may be reversed or have gaps(introns), at least 3 bps + my $seq = ''; + if (scalar @pos < 3) { die "too small region for $chr $pos[0]\n"; } + if ($pos[0] < $pos[1]) { #not reversed + my $s = $pos[0]; + for(my $i = 1; $i <= $#pos; $i++) { + if ($pos[$i] == $pos[$i-1] + 1) { next; } + if ($seqFlag eq '2bit') { + $seq .= fetchSeq2bit($chr, $s, $pos[$i-1]); + }else { + $seq .= fetchSeqNib($chr, $s, $pos[$i-1]); + } + $s = $pos[$i]; + } + if (length $seq != scalar @pos) { #still need to fetch seq +#if (abs($pos[$#pos]-$pos[0]) > 200) { +#print STDERR "TESTING have split codon $chr $pos[0] $pos[$#pos]\n"; +#exit; +#} + if ($seqFlag eq '2bit') { + $seq .= fetchSeq2bit($chr, $s, $pos[$#pos]); + }else { + $seq .= fetchSeqNib($chr, $s, $pos[$#pos]); + } + } + }else { #reversed + my $s = $pos[$#pos]; + for(my $i = $#pos -1; $i >= 0; $i--) { + if ($pos[$i] == $pos[$i+1] + 1) { next; } + if ($seqFlag eq '2bit') { + $seq .= fetchSeq2bit($chr, $s, $pos[$i+1]); + }else { + $seq .= fetchSeqNib($chr, $s, $pos[$i+1]); + } + $s = $pos[$i]; + } + if (length $seq != scalar @pos) { #still need to fetch seq +#if (abs($pos[$#pos]-$pos[0]) > 200) { +#print STDERR "TESTING have split codon $pos[0] .. $pos[$#pos]\n"; +#} + if ($seqFlag eq '2bit') { + $seq .= fetchSeq2bit($chr, $s, $pos[0]); + }else { + $seq .= fetchSeqNib($chr, $s, $pos[0]); + } + } + } +} + +sub fetchSeq2bit { + my $chr = shift; + my $st = shift; + my $end = shift; + my $strand = '+'; + $st--; #change to UCSC numbering + open (BIT, "twoBitToFa -seq=$chr -start=$st -end=$end $nibDir/$nibTag.2bit stdout |") or + die "Couldn't run twoBitToFa, $!\n"; + my $seq = ''; + while (<BIT>) { + chomp; + if (/^>/) { next; } #header + $seq .= $_; + } + close BIT or die "Couldn't finish nibFrag on $chr $st $end, $!\n"; + return $seq; +} + +sub fetchSeqNib { + my $chr = shift; + my $st = shift; + my $end = shift; + my $strand = '+'; + $st--; #change to UCSC numbering + open (NIB, "nibFrag -upper $nibDir/${chr}.nib $st $end $strand stdout |") or die "Couldn't run nibFrag, $!\n"; + my $seq = ''; + while (<NIB>) { + chomp; + if (/^>/) { next; } #header + $seq .= $_; + } + close NIB or die "Couldn't finish nibFrag on $chr $st $end, $!\n"; + return $seq; +} + +sub compl { + my $nts = shift; + my $comp = ''; + foreach my $n (split(/ */, $nts)) { + if ($n eq 'A') { $comp .= 'T'; } + elsif ($n eq 'T') { $comp .= 'A'; } + elsif ($n eq 'C') { $comp .= 'G'; } + elsif ($n eq 'G') { $comp .= 'C'; } + elsif ($n eq 'N') { $comp .= 'N'; } + elsif ($n eq '-') { $comp .= '-'; } #deletion + else { die "Couldn't do complement of $n for $nts\n"; } + } + return $comp; +} + +sub getaa { + my $nts = shift; #in multiples of 3 + my $aa = ''; + my @n = split(/ */, $nts); + while (@n) { + my @t = splice(@n, 0, 3); + my $n = uc(join("", @t)); + if (!exists $codon{$n}) { $aa .= 'N'; next; } + $aa .= $codon{$n}; + } + return $aa; +} + +sub fill_codon { + $codon{GCA} = 'Ala'; + $codon{GCC} = 'Ala'; + $codon{GCG} = 'Ala'; + $codon{GCT} = 'Ala'; + $codon{CGG} = 'Arg'; + $codon{CGT} = 'Arg'; + $codon{CGC} = 'Arg'; + $codon{AGA} = 'Arg'; + $codon{AGG} = 'Arg'; + $codon{CGA} = 'Arg'; + $codon{AAC} = 'Asn'; + $codon{AAT} = 'Asn'; + $codon{GAC} = 'Asp'; + $codon{GAT} = 'Asp'; + $codon{TGC} = 'Cys'; + $codon{TGT} = 'Cys'; + $codon{CAG} = 'Gln'; + $codon{CAA} = 'Gln'; + $codon{GAA} = 'Glu'; + $codon{GAG} = 'Glu'; + $codon{GGG} = 'Gly'; + $codon{GGA} = 'Gly'; + $codon{GGC} = 'Gly'; + $codon{GGT} = 'Gly'; + $codon{CAC} = 'His'; + $codon{CAT} = 'His'; + $codon{ATA} = 'Ile'; + $codon{ATT} = 'Ile'; + $codon{ATC} = 'Ile'; + $codon{CTA} = 'Leu'; + $codon{CTC} = 'Leu'; + $codon{CTG} = 'Leu'; + $codon{CTT} = 'Leu'; + $codon{TTG} = 'Leu'; + $codon{TTA} = 'Leu'; + $codon{AAA} = 'Lys'; + $codon{AAG} = 'Lys'; + $codon{ATG} = 'Met'; + $codon{TTC} = 'Phe'; + $codon{TTT} = 'Phe'; + $codon{CCT} = 'Pro'; + $codon{CCA} = 'Pro'; + $codon{CCC} = 'Pro'; + $codon{CCG} = 'Pro'; + $codon{TCA} = 'Ser'; + $codon{AGC} = 'Ser'; + $codon{AGT} = 'Ser'; + $codon{TCC} = 'Ser'; + $codon{TCT} = 'Ser'; + $codon{TCG} = 'Ser'; + $codon{TGA} = 'Stop'; + $codon{TAG} = 'Stop'; + $codon{TAA} = 'Stop'; + $codon{ACT} = 'Thr'; + $codon{ACA} = 'Thr'; + $codon{ACC} = 'Thr'; + $codon{ACG} = 'Thr'; + $codon{TGG} = 'Trp'; + $codon{TAT} = 'Tyr'; + $codon{TAC} = 'Tyr'; + $codon{GTC} = 'Val'; + $codon{GTA} = 'Val'; + $codon{GTG} = 'Val'; + $codon{GTT} = 'Val'; +} + diff -r a67ca0795efb -r dfaa18960944 tools/evolution/codingSnps.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/evolution/codingSnps.xml Tue Mar 23 13:53:21 2010 -0400 @@ -0,0 +1,89 @@ +<tool id="codingSnps" name="Amino-acid changes"> + <description>caused by a set of SNPs</description> + <command interpreter="perl"> + codingSnps.pl $input1 $input2 ${GALAXY_DATA_INDEX_DIR}/codingSnps.loc chr=${input1.metadata.chromCol} start=${input1.metadata.startCol} end=${input1.metadata.endCol} snp=$col1 $out_file1 + </command> + <inputs> + <param format="interval" name="input1" type="data" label="SNPs"/> + <param format="interval" name="input2" type="data" label="genes"/> + <param name="col1" label="Column with SNPs" type="data_column" data_ref="input1" /> + </inputs> + <outputs> + <data format="input" name="out_file1" /> + </outputs> + <code file="codingSnps_filter.py"></code> + <requirements> + <requirement type="binary">twoBitToFa</requirement> + </requirements> + <tests> + <test> + <param name="input1" value="codingSnps_input1.interval" dbkey="hg18" /> + <param name="input2" value="codingSnps_input2.bed" dbkey="hg18" /> + <param name="col1" value="6" /> + <output name="output" file="codingSnps_output.interval" /> + </test> + </tests> + + <help> +This tool identifies which SNPs create amino-acid changes in the specified coding regions. + +**Example** + +- first input file, with SNPs:: + + chr22 14440426 14440427 C/T + chr22 14494851 14494852 A/G + chr22 14494911 14494912 A/T + chr22 14550435 14550436 A/G + chr22 14611956 14611957 G/T + chr22 14612076 14612077 A/G + chr22 14668537 14668538 C + chr22 14668703 14668704 A/T + chr22 14668775 14668776 G + chr22 14680074 14680075 A/T + etc. + + alternatively indicating polymorphisms using ambiguous-nucleotide symbols: + + chr22 14440426 14440427 Y + chr22 14494851 14494852 R + chr22 14494911 14494912 W + chr22 14550435 14550436 R + chr22 14611956 14611957 K + chr22 14612076 14612077 R + chr22 14668537 14668538 C + chr22 14668703 14668704 W + chr22 14668775 14668776 G + chr22 14680074 14680075 W + etc. + +- second input file, with UCSC annotations for human genes:: + + chr22 14504263 14572999 uc002zkr.2 0 - 14504263 14504263 0 5 710,91,136,138,94, 0,38133,62547,62901,68642, + chr22 14527995 14572999 uc010gqo.1 0 - 14527995 14527995 0 4 3826,91,136,94, 0,14401,38815,44910, + chr22 14542065 14552264 uc002zkt.2 0 + 14542065 14542065 0 3 323,88,313, 0,2416,9886, + chr22 14559619 14561004 uc002zku.2 0 - 14559619 14559619 0 1 1385, 0, + chr22 14567164 14572999 uc002zkv.2 0 - 14567164 14567164 0 5 138,112,115,111,94, 0,1867,2099,3516,5741, + chr22 14620243 14620281 uc002zkw.1 0 - 14620243 14620243 0 1 38, 0, + chr22 14620300 14620339 uc002zkx.1 0 - 14620300 14620300 0 1 39, 0, + chr22 14621086 14621125 uc002zky.1 0 + 14621086 14621086 0 1 39, 0, + chr22 14622000 14622030 uc002zkz.1 0 - 14622000 14622000 0 1 30, 0, + chr22 14623380 14623414 uc002zla.1 0 - 14623380 14623380 0 1 34, 0, + etc. + +- output file, showing non-synonymous substitutions in coding regions:: + + chr22 15452482 15452483 G uc002zlp.1 Trp:Arg 320 A + chr22 15644564 15644565 T uc002zlv.1 His:Asn 442 G + chr22 15645123 15645124 C uc002zlv.1 Phe:Leu 255 A + chr22 15645193 15645194 A/G uc002zlv.1 Pro:Leu/Pro 232 G + chr22 15660821 15660822 A/G uc002zlv.1 Thr:Met/Thr 143 G + chr22 15969208 15969209 C/T uc002zly.1 Ala:Ala/Val 367 C + chr22 15969208 15969209 C/T uc010gqt.1 Ala:Ala/Val 315 C + chr22 15999075 15999076 C/G uc002zmd.1 Arg:Arg/Ser 180 C + chr22 15999075 15999076 C/G uc002zme.1 Arg:Arg/Ser 161 C + chr22 15999075 15999076 C/G uc002zmf.1 Arg:Arg/Ser 369 C + etc. + +</help> +</tool> diff -r a67ca0795efb -r dfaa18960944 tools/evolution/codingSnps_filter.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/evolution/codingSnps_filter.py Tue Mar 23 13:53:21 2010 -0400 @@ -0,0 +1,43 @@ +# runs after the job (and after the default post-filter) +import os +from galaxy import eggs +from galaxy import jobs +from galaxy.tools.parameters import DataToolParameter +# Older py compatibility +try: + set() +except: + from sets import Set as set + +def validate_input( trans, error_map, param_values, page_param_map ): + dbkeys = set() + data_param_names = set() + data_params = 0 + for name, param in page_param_map.iteritems(): + if isinstance( param, DataToolParameter ): + # for each dataset parameter + if param_values.get(name, None) != None: + dbkeys.add( param_values[name].dbkey ) + data_params += 1 + # check meta data + try: + param = param_values[name] + startCol = int( param.metadata.startCol ) + endCol = int( param.metadata.endCol ) + chromCol = int( param.metadata.chromCol ) + if param.metadata.strandCol is not None: + strandCol = int ( param.metadata.strandCol ) + else: + strandCol = 0 + except: + error_msg = "The attributes of this dataset are not properly set. " + \ + "Click the pencil icon in the history item to set the chrom, start, end and strand columns." + error_map[name] = error_msg + data_param_names.add( name ) + if len( dbkeys ) > 1: + for name in data_param_names: + error_map[name] = "All datasets must belong to same genomic build, " \ + "this dataset is linked to build '%s'" % param_values[name].dbkey + if data_params != len(data_param_names): + for name in data_param_names: + error_map[name] = "A dataset of the appropriate type is required"

1 0

[hg] galaxy 3557: lims: fixed a bug in the csv importer for samples
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/a67ca0795efb changeset: 3557:a67ca0795efb user: rc date: Tue Mar 23 13:15:56 2010 -0400 description: lims: fixed a bug in the csv importer for samples diffstat: lib/galaxy/web/controllers/requests.py | 14 ++++++++++++-- lib/galaxy/web/controllers/requests_admin.py | 11 ++++++++++- 2 files changed, 22 insertions(+), 3 deletions(-) diffs (59 lines): diff -r 8f6fa47b21c4 -r a67ca0795efb lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Tue Mar 23 12:45:08 2010 -0400 +++ b/lib/galaxy/web/controllers/requests.py Tue Mar 23 13:15:56 2010 -0400 @@ -438,18 +438,28 @@ current_samples, details, edit_mode, libraries = self.__update_samples( trans, request, **kwd ) if params.get('import_samples_button', False) == 'Import samples': try: + lib_widget, folder_widget = self.__library_widgets(trans, request.user, + len(current_samples), + libraries, None, **kwd) file_obj = params.get('file_data', '') import csv reader = csv.reader(file_obj.file) for row in reader: - current_samples.append([row[0], row[1:]]) - return trans.fill_template( '/requests/show_request.mako', + current_samples.append(dict(name=row[0], + barcode='', + library=None, + folder=None, + lib_widget=lib_widget, + folder_widget=folder_widget, + field_values=row[1:])) + return trans.fill_template( '/admin/requests/show_request.mako', request=request, request_details=self.request_details(trans, request.id), current_samples=current_samples, sample_copy=self.__copy_sample(current_samples), details=details, edit_mode=edit_mode) + except: return trans.response.send_redirect( web.url_for( controller='requests', action='list', diff -r 8f6fa47b21c4 -r a67ca0795efb lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Tue Mar 23 12:45:08 2010 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Tue Mar 23 13:15:56 2010 -0400 @@ -946,11 +946,20 @@ current_samples, details, edit_mode, libraries = self.__update_samples( trans, request, **kwd ) if params.get('import_samples_button', False) == 'Import samples': try: + lib_widget, folder_widget = self.__library_widgets(trans, request.user, + len(current_samples), + libraries, None, **kwd) file_obj = params.get('file_data', '') import csv reader = csv.reader(file_obj.file) for row in reader: - current_samples.append([row[0], row[1:]]) + current_samples.append(dict(name=row[0], + barcode='', + library=None, + folder=None, + lib_widget=lib_widget, + folder_widget=folder_widget, + field_values=row[1:])) return trans.fill_template( '/admin/requests/show_request.mako', request=request, request_details=self.request_details(trans, request.id),

1 0

[hg] galaxy 3556: Fix bug in upload where source import files co...
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/8f6fa47b21c4 changeset: 3556:8f6fa47b21c4 user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Mar 23 12:45:08 2010 -0400 description: Fix bug in upload where source import files could be removed if an error occurs during detection and galaxy owns the source files. diffstat: tools/data_source/upload.py | 3 +++ 1 files changed, 3 insertions(+), 0 deletions(-) diffs (13 lines): diff -r 4affff3421ed -r 8f6fa47b21c4 tools/data_source/upload.py --- a/tools/data_source/upload.py Tue Mar 23 10:44:13 2010 -0400 +++ b/tools/data_source/upload.py Tue Mar 23 12:45:08 2010 -0400 @@ -24,6 +24,9 @@ ext = 'data', dataset_id = dataset.dataset_id, stderr = msg ) ) + "\n" ) + # never remove a server-side upload + if dataset.type in ( 'server_dir', 'path_paste' ): + return try: os.remove( dataset.path ) except:

1 0

[hg] galaxy 3555: Added 'Multivariate analysis' section to tool_...
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/4affff3421ed changeset: 3555:4affff3421ed user: gua110 date: Tue Mar 23 10:44:13 2010 -0400 description: Added 'Multivariate analysis' section to tool_conf.xml.main diffstat: tool_conf.xml.main | 6 ++++++ 1 files changed, 6 insertions(+), 0 deletions(-) diffs (16 lines): diff -r a2d3d9514c76 -r 4affff3421ed tool_conf.xml.main --- a/tool_conf.xml.main Tue Mar 23 10:09:12 2010 -0400 +++ b/tool_conf.xml.main Tue Mar 23 10:44:13 2010 -0400 @@ -141,6 +141,12 @@ <tool file="regVariation/best_regression_subsets.xml" /> <tool file="regVariation/rcve.xml" /> </section> + <section name="Multivariate Analysis" id="multVar"> + <tool file="multivariate_stats/pca.xml" /> + <tool file="multivariate_stats/cca.xml" /> + <tool file="multivariate_stats/kpca.xml" /> + <tool file="multivariate_stats/kcca.xml" /> + </section> <section name="Evolution" id="hyphy"> <tool file="hyphy/hyphy_branch_lengths_wrapper.xml" /> <tool file="hyphy/hyphy_nj_tree_wrapper.xml" />

1 0

[hg] galaxy 3554: lims: data transfer bug fix
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/a2d3d9514c76 changeset: 3554:a2d3d9514c76 user: rc date: Tue Mar 23 10:09:12 2010 -0400 description: lims: data transfer bug fix diffstat: scripts/galaxy_messaging/server/data_transfer.py | 6 +++--- 1 files changed, 3 insertions(+), 3 deletions(-) diffs (26 lines): diff -r 96776367bea1 -r a2d3d9514c76 scripts/galaxy_messaging/server/data_transfer.py --- a/scripts/galaxy_messaging/server/data_transfer.py Mon Mar 22 18:02:40 2010 -0400 +++ b/scripts/galaxy_messaging/server/data_transfer.py Tue Mar 23 10:09:12 2010 -0400 @@ -158,11 +158,11 @@ cj = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(cj)) f = opener.open(url) - if f.read().find("Now logged in as "+self.datatx_email) == -1: + if f.read().find("ogged in as "+self.datatx_email) == -1: # if the user doesnt exist, create the user url = "%s/user/create?email=%s&username=%s&password=%s&confirm=%s&create_user_button=Submit" % ( base_url, self.datatx_email, self.datatx_email, self.datatx_password, self.datatx_password ) f = opener.open(url) - if f.read().find("Now logged in as "+self.datatx_email) == -1: + if f.read().find("ogged in as "+self.datatx_email) == -1: raise DataTransferException("The "+self.datatx_email+" user could not login to Galaxy") # after login, add dataset to the library params = urllib.urlencode(dict( cntrller='library_admin', @@ -185,7 +185,7 @@ raise DataTransferException("Dataset could not be uploaded to the data library") # finally logout f = opener.open(base_url+'/user/logout') - if f.read().find("You are no longer logged in.") == -1: + if f.read().find("You have been logged out.") == -1: raise DataTransferException("The "+self.datatx_email+" user could not logout of Galaxy") except DataTransferException, (e): self.error_and_exit(e.msg)

1 0

[hg] galaxy 3553: Least Recently Used (LRU) cache for python
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/96776367bea1 changeset: 3553:96776367bea1 user: Kanwei Li <kanwei(a)gmail.com> date: Mon Mar 22 18:02:40 2010 -0400 description: Least Recently Used (LRU) cache for python diffstat: lib/galaxy/util/lrucache.py | 72 +++++++++++++++++++++++++++++++++++++++++++++ 1 files changed, 72 insertions(+), 0 deletions(-) diffs (77 lines): diff -r 2bda9c59b992 -r 96776367bea1 lib/galaxy/util/lrucache.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/util/lrucache.py Mon Mar 22 18:02:40 2010 -0400 @@ -0,0 +1,72 @@ +""" +Kanwei Li, 03/2010 + +Simple LRU cache that uses a dictionary to store a specified number of objects +at a time. +""" + +class LRUCache: + def clear(self): + ''' Clears/initiates storage variables''' + self.key_ary = [] + self.obj_cache = {} + + def __init__(self, num_elements): + self.num_elements = num_elements + self.clear() + + def __getitem__(self, key): + ''' Return value of key, or None if key is not in cache ''' + try: + index = self.key_ary.index(key) + except ValueError: + return None + # Move this key to the end + self.key_ary.remove(key) + self.key_ary.append(key) + return self.obj_cache[key] + + def __setitem__(self, key, value): + ''' Sets a new value to a key ''' + if key not in self.obj_cache: + if len(self.key_ary) >= self.num_elements: + deleted_key = self.key_ary.pop(0) # Remove first element + del self.obj_cache[deleted_key] + self.key_ary.append(key) + self.obj_cache[key] = value + return value + +if __name__ == "__main__": + import unittest + + class TestLRUCache(unittest.TestCase): + def test_lru(self): + lru = LRUCache(2) + for i in range(0, 4): # Insert 4 numbers + lru[i] = i + self.assertEqual( lru[0], None ) + self.assertEqual( lru[1], None ) + self.assertEqual( lru[2], 2 ) + self.assertEqual( lru[3], 3 ) + + self.assertEqual( lru.__setitem__("hello", "world"), "world") + self.assertEqual( lru[2], None ) + + lru.clear() + self.assertEqual( lru["hello"], None ) + self.assertEqual( lru[3], None ) + + # Test if recently used item is kept + lru[0] = 0 + lru[1] = 1 + # Now saturated + ping = lru[0] + lru[2] = 2 + # Should keep 0, delete 1 + self.assertEqual( lru[0], 0 ) + self.assertEqual( lru[1], None ) + self.assertEqual( lru[2], 2 ) + + unittest.main() + + \ No newline at end of file

1 0

[hg] galaxy 3552: Fix saving annotations in workflow editor
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/2bda9c59b992 changeset: 3552:2bda9c59b992 user: James Taylor <james(a)jamestaylor.org> date: Mon Mar 22 17:11:10 2010 -0400 description: Fix saving annotations in workflow editor diffstat: static/scripts/galaxy.workflow_editor.canvas.js | 6 +--- templates/workflow/editor.mako | 39 ++++++++++-------------- templates/workflow/editor_tool_form.mako | 15 +++++--- 3 files changed, 26 insertions(+), 34 deletions(-) diffs (104 lines): diff -r 84386da2a3f3 -r 2bda9c59b992 static/scripts/galaxy.workflow_editor.canvas.js --- a/static/scripts/galaxy.workflow_editor.canvas.js Mon Mar 22 16:59:20 2010 -0400 +++ b/static/scripts/galaxy.workflow_editor.canvas.js Mon Mar 22 17:11:10 2010 -0400 @@ -448,12 +448,8 @@ // If active form has changed, save it if (this.active_form_has_changes) { this.has_changes = true; - // Get annotation and add to form. - var annotation = $("textarea[name=annotation]").val(); - var tool_form = $("#right-content").find("form"); - tool_form.append( "<input type='hidden' name='annotation' value='"+annotation+"' />" ); // Submit form. - tool_form.submit(); + $("#right-content").find("form").submit(); this.active_form_has_changes = false; } }, diff -r 84386da2a3f3 -r 2bda9c59b992 templates/workflow/editor.mako --- a/templates/workflow/editor.mako Mon Mar 22 16:59:20 2010 -0400 +++ b/templates/workflow/editor.mako Mon Mar 22 17:11:10 2010 -0400 @@ -310,7 +310,22 @@ function show_form_for_tool( text, node ) { $("#edit-attributes").hide(); - $("#right-content").show().html( text ); + $("#right-content").show().html( text ); + + // Add metadata form to tool. + if (node) { + $("#right-content").find(".toolForm").after( "<p><div class='metadataForm'> \ + <div class='metadataFormTitle'>Edit Step Attributes</div> \ + <div class='form-row'> \ + <label>Annotation / Notes:</label> \ + <div style='margin-right: 10px;'> \ + <textarea name='annotation' rows='3' style='width: 100%'>" + node.annotation + "</textarea> \ + <div class='toolParamHelp'>Add an annotation or notes to this step; annotations are available when a workflow is viewed.</div> \ + </div> \ + </div> \ + </div>" ); + } + $("#right-content").find( "form" ).ajaxForm( { type: 'POST', dataType: 'json', @@ -352,28 +367,6 @@ }); }); }); - - - // Add metadata form to tool. - if (node) { - var metadata_div = - $( "<p><div class='metadataForm'> \ - <div class='metadataFormTitle'>Edit Step Attributes</div> \ - <div class='form-row'> \ - <label>Annotation / Notes:</label> \ - <div style='margin-right: 10px;'> \ - <textarea name='annotation' rows='3' style='width: 100%'>" + node.annotation + "</textarea> \ - <div class='toolParamHelp'>Add an annotation or notes to this step; annotations are available when a workflow is viewed.</div> \ - </div> \ - </div> \ - </div>"); - // See above comment: this is necessary to handle autosaving. - var textarea = $(metadata_div).find("textarea"); - textarea.focus( function () { - workflow.active_form_has_changes = true; - }); - $("#right-content").find(".toolForm").after( metadata_div ); - } } var close_editor = function() { diff -r 84386da2a3f3 -r 2bda9c59b992 templates/workflow/editor_tool_form.mako --- a/templates/workflow/editor_tool_form.mako Mon Mar 22 16:59:20 2010 -0400 +++ b/templates/workflow/editor_tool_form.mako Mon Mar 22 17:11:10 2010 -0400 @@ -94,10 +94,11 @@ </div> </%def> -<div class="toolForm"> - <div class="toolFormTitle">Tool: ${tool.name}</div> - <div class="toolFormBody"> - <form method="post" action="${h.url_for( action='editor_form_post' )}"> +<form method="post" action="${h.url_for( action='editor_form_post' )}"> + + <div class="toolForm"> + <div class="toolFormTitle">Tool: ${tool.name}</div> + <div class="toolFormBody"> <input type="hidden" name="tool_id" value="${tool.id}" /> %for i, inputs in enumerate( tool.inputs_by_page ): %if tool.has_multiple_pages: @@ -105,6 +106,8 @@ %endif ${do_inputs( inputs, values, errors, "" )} %endfor - </form> + </div> </div> -</div> + + +</form> \ No newline at end of file

1 0

[hg] galaxy 3551: Can customize main logo link url, rename viz l...
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/84386da2a3f3 changeset: 3551:84386da2a3f3 user: Kanwei Li <kanwei(a)gmail.com> date: Mon Mar 22 16:59:20 2010 -0400 description: Can customize main logo link url, rename viz links diffstat: templates/base_panels.mako | 8 ++++---- universe_wsgi.ini.sample | 2 ++ 2 files changed, 6 insertions(+), 4 deletions(-) diffs (45 lines): diff -r 8938319bf173 -r 84386da2a3f3 templates/base_panels.mako --- a/templates/base_panels.mako Mon Mar 22 12:32:14 2010 -0400 +++ b/templates/base_panels.mako Mon Mar 22 16:59:20 2010 -0400 @@ -205,9 +205,9 @@ Visualization <div class="submenu"> <ul> - <li><a href="${h.url_for( controller='/tracks', action='index' )}">Build track browser</a></li> + <li><a href="${h.url_for( controller='/tracks', action='index' )}">New Track Browser</a></li> <li><hr style="color: inherit; background-color: gray"/></li> - <li><a href="${h.url_for( controller='/visualization', action='list' )}">Stored visualizations</a></li> + <li><a href="${h.url_for( controller='/visualization', action='list' )}">Saved Visualizations</a></li> </ul> </div> </td> @@ -287,11 +287,11 @@ ## Logo, layered over tabs to be clickable <div class="title" style="position: absolute; top: 0; left: 0;"> - <a href="/"> + <a href="${app.config.get( 'logo_url', '/' )}"> <img border="0" src="${h.url_for('/static/images/galaxyIcon_noText.png')}" style="width: 26px; vertical-align: top;"> Galaxy %if app.config.brand: - <span class='brand'>/${app.config.brand}</span> + <span class='brand'>/ ${app.config.brand}</span> %endif </a> </div> diff -r 8938319bf173 -r 84386da2a3f3 universe_wsgi.ini.sample --- a/universe_wsgi.ini.sample Mon Mar 22 12:32:14 2010 -0400 +++ b/universe_wsgi.ini.sample Mon Mar 22 16:59:20 2010 -0400 @@ -126,10 +126,12 @@ ## for a local mirror where you are doing private software development ## ## Brand: appends "/[brand]" to the "Galaxy" text in the masthead +## logo_url: replaces the default "Galaxy + brand" link url ## wiki_url: replaces the default galaxy main wiki ## bugs_email: replaces the default galaxy bugs email list ##citation_url: point to a URL listing citations #brand = Private local mirror +#logo_url = / #wiki_url = /path/to/my/local/wiki #bugs_email = mailto:galaxy-bugs@example.org #citation_url = /path/to/my/citations

1 0

[hg] galaxy 3550: Assume plink is on the executing node path for...
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/8938319bf173 changeset: 3550:8938319bf173 user: fubar: ross Lazarus at gmail period com date: Mon Mar 22 12:32:14 2010 -0400 description: Assume plink is on the executing node path for converters Add a non-specific exception catcher to archive creation code in library_common diffstat: lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml | 2 +- lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml | 2 +- lib/galaxy/datatypes/genetics.py | 5 ++++- lib/galaxy/web/controllers/dataset.py | 2 +- lib/galaxy/web/controllers/library_common.py | 5 +++++ 5 files changed, 12 insertions(+), 4 deletions(-) diffs (66 lines): diff -r 7120c4848270 -r 8938319bf173 lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml --- a/lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml Mon Mar 22 11:06:40 2010 -0400 +++ b/lib/galaxy/datatypes/converters/lped_to_pbed_converter.xml Mon Mar 22 12:32:14 2010 -0400 @@ -3,7 +3,7 @@  <command interpreter="python"> lped_to_pbed_converter.py '$input1.extra_files_path/$input1.metadata.base_name' - '$output1' '$output1.files_path' '${GALAXY_DATA_INDEX_DIR}/rg/bin/plink' + '$output1' '$output1.files_path' 'plink' </command> <inputs> <param format="lped" name="input1" type="data" label="Choose linkage pedigree file"/> diff -r 7120c4848270 -r 8938319bf173 lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml --- a/lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml Mon Mar 22 11:06:40 2010 -0400 +++ b/lib/galaxy/datatypes/converters/pbed_to_lped_converter.xml Mon Mar 22 12:32:14 2010 -0400 @@ -3,7 +3,7 @@  <command interpreter="python"> pbed_to_lped_converter.py '$input1.extra_files_path/$input1.metadata.base_name' - '$output1' '$output1.files_path' '${GALAXY_DATA_INDEX_DIR}/rg/bin/plink' + '$output1' '$output1.files_path' 'plink' </command> <inputs> <param format="pbed" name="input1" type="data" label="Choose compressed Plink binary format genotype file"/> diff -r 7120c4848270 -r 8938319bf173 lib/galaxy/datatypes/genetics.py --- a/lib/galaxy/datatypes/genetics.py Mon Mar 22 11:06:40 2010 -0400 +++ b/lib/galaxy/datatypes/genetics.py Mon Mar 22 12:32:14 2010 -0400 @@ -114,7 +114,10 @@ npeek = 5 out = ['<table cellspacing="0" cellpadding="3">'] f = open(dataset.file_name,'r') - d = [f.next() for x in range(npeek)] + d = f.readlines()[:5] + if len(d) == 0: + out = "Cannot find anything to parse in %s" % dataset.name + return out hasheader = 0 try: test = ['%f' % x for x in d[0][1:]] # first is name - see if starts all numerics diff -r 7120c4848270 -r 8938319bf173 lib/galaxy/web/controllers/dataset.py --- a/lib/galaxy/web/controllers/dataset.py Mon Mar 22 11:06:40 2010 -0400 +++ b/lib/galaxy/web/controllers/dataset.py Mon Mar 22 12:32:14 2010 -0400 @@ -332,7 +332,7 @@ trans.response.set_content_type( mime ) return open( file_path ) else: - return "Could not find '%s' on the extra files path." % filename + return "Could not find '%s' on the extra files path %s." % (filename,file_path) mime = trans.app.datatypes_registry.get_mimetype_by_extension( data.extension.lower() ) trans.response.set_content_type(mime) diff -r 7120c4848270 -r 8938319bf173 lib/galaxy/web/controllers/library_common.py --- a/lib/galaxy/web/controllers/library_common.py Mon Mar 22 11:06:40 2010 -0400 +++ b/lib/galaxy/web/controllers/library_common.py Mon Mar 22 12:32:14 2010 -0400 @@ -1334,6 +1334,11 @@ log.exception( "Unable to create archive for download" ) msg = "Unable to create archive for download, please report this error" messagetype = 'error' + except: + error = True + log.exception( "Unexpected error %s in create archive for download" % sys.exc_info()[0]) + msg = "Unable to create archive for download, please report - %s" % sys.exc_info()[0] + messagetype = 'error' if not error: composite_extensions = trans.app.datatypes_registry.get_composite_extensions( ) seen = []

1 0

[hg] galaxy 3549: Make boxplot tool respect exit codes when dete...
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/7120c4848270 changeset: 3549:7120c4848270 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Mon Mar 22 11:06:40 2010 -0400 description: Make boxplot tool respect exit codes when determining job errors: makes e.g. 'Could not find/open font when opening font "arial", using internal non-scalable font' a non-fatal warning. Add version attribute to gnuplot requirement tag. diffstat: tools/plotting/boxplot.xml | 5 +++-- 1 files changed, 3 insertions(+), 2 deletions(-) diffs (22 lines): diff -r ff39f033ce68 -r 7120c4848270 tools/plotting/boxplot.xml --- a/tools/plotting/boxplot.xml Fri Mar 19 15:09:13 2010 -0400 +++ b/tools/plotting/boxplot.xml Mon Mar 22 11:06:40 2010 -0400 @@ -1,8 +1,8 @@ <tool id="qual_stats_boxplot" name="Boxplot" version="1.0.0"> <description>of quality statistics</description> - <command>gnuplot < '$gnuplot_commands' > '$output_file'</command> + <command>gnuplot < '$gnuplot_commands' 2>&1 || echo "Error running gnuplot." >&2</command> <requirements> - <requirement type="binary">gnuplot</requirement> + <requirement type="binary" version="gnuplot 4.2 patchlevel 2">gnuplot</requirement> </requirements> <inputs> <param name="input_file" type="data" format="tabular" label="Quality Statistics File"/> @@ -30,6 +30,7 @@ </inputs> <configfiles> <configfile name="gnuplot_commands"> +set output '$output_file' set term png size ${graph_size} set boxwidth 0.8 set key right tmargin

1 0

[hg] galaxy 3548: lims: fixed the search bug on the requests grid
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/ff39f033ce68 changeset: 3548:ff39f033ce68 user: rc date: Fri Mar 19 15:09:13 2010 -0400 description: lims: fixed the search bug on the requests grid diffstat: lib/galaxy/web/controllers/requests.py | 2 +- lib/galaxy/web/controllers/requests_admin.py | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diffs (24 lines): diff -r 49a7de2c4707 -r ff39f033ce68 lib/galaxy/web/controllers/requests.py --- a/lib/galaxy/web/controllers/requests.py Thu Mar 18 22:41:15 2010 -0400 +++ b/lib/galaxy/web/controllers/requests.py Fri Mar 19 15:09:13 2010 -0400 @@ -107,7 +107,7 @@ link=( lambda item: iff( item.deleted, None, dict( operation="events", id=item.id ) ) ) ) ] columns.append( grids.MulticolFilterColumn( "Search", - cols_to_filter=[ columns[0], columns[1], columns[6] ], + cols_to_filter=[ columns[0], columns[1] ], key="free-text-search", visible=False, filterable="standard" ) ) diff -r 49a7de2c4707 -r ff39f033ce68 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Thu Mar 18 22:41:15 2010 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Fri Mar 19 15:09:13 2010 -0400 @@ -124,7 +124,7 @@ ] columns.append( grids.MulticolFilterColumn( "Search", - cols_to_filter=[ columns[0], columns[1], columns[6] ], + cols_to_filter=[ columns[0], columns[1] ], key="free-text-search", visible=False, filterable="standard" ) )

1 0

[hg] galaxy 3547: Fix tag filtering bug for published item grids.
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/49a7de2c4707 changeset: 3547:49a7de2c4707 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Mar 18 22:41:15 2010 -0400 description: Fix tag filtering bug for published item grids. diffstat: templates/display_base.mako | 2 +- templates/grid_base.mako | 2 +- templates/history/view.mako | 2 +- 3 files changed, 3 insertions(+), 3 deletions(-) diffs (36 lines): diff -r be396d94ca5a -r 49a7de2c4707 templates/display_base.mako --- a/templates/display_base.mako Thu Mar 18 16:02:09 2010 -0400 +++ b/templates/display_base.mako Thu Mar 18 22:41:15 2010 -0400 @@ -43,7 +43,7 @@ <% controller_name = get_controller_name( item ) %> var href = '${h.url_for ( controller='/' + controller_name , action='list_published')}'; href = href + "?f-tags=" + tag_name; - if (tag_value != null && tag_value != "") + if (tag_value != undefined && tag_value != "") href = href + ":" + tag_value; self.location = href; } diff -r be396d94ca5a -r 49a7de2c4707 templates/grid_base.mako --- a/templates/grid_base.mako Thu Mar 18 16:02:09 2010 -0400 +++ b/templates/grid_base.mako Thu Mar 18 22:41:15 2010 -0400 @@ -345,7 +345,7 @@ // Add tag to grid filter. function add_tag_to_grid_filter(tag_name, tag_value) { // Put tag name and value together. - var tag = tag_name + (tag_value !== null && tag_value != "" ? ":" + tag_value : ""); + var tag = tag_name + (tag_value !== undefined && tag_value != "" ? ":" + tag_value : ""); $('#more-search-options').show('fast'); add_filter_condition("tags", tag, true); } diff -r be396d94ca5a -r 49a7de2c4707 templates/history/view.mako --- a/templates/history/view.mako Thu Mar 18 16:02:09 2010 -0400 +++ b/templates/history/view.mako Thu Mar 18 22:41:15 2010 -0400 @@ -258,7 +258,7 @@ { var href = '${h.url_for( controller='/history', action='list_published')}'; href = href + "?f-tags=" + tag_name; - if (tag_value != null && tag_value != "") + if (tag_value != undefined && tag_value != "") href = href + ":" + tag_value; self.location = href; }

1 0

[hg] galaxy 3546: Eliminate the pop-up menus for folders and dat...
by Greg Von Kuster 24 Mar '10

24 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/be396d94ca5a changeset: 3546:be396d94ca5a user: Greg Von Kuster <greg(a)bx.psu.edu> date: Thu Mar 18 16:02:09 2010 -0400 description: Eliminate the pop-up menus for folders and datasets if the library is deleted. diffstat: templates/library/common/browse_library.mako | 130 +++++++++++++------------- 1 files changed, 67 insertions(+), 63 deletions(-) diffs (187 lines): diff -r 2590120aed68 -r be396d94ca5a templates/library/common/browse_library.mako --- a/templates/library/common/browse_library.mako Thu Mar 18 12:57:29 2010 -0400 +++ b/templates/library/common/browse_library.mako Thu Mar 18 16:02:09 2010 -0400 @@ -208,38 +208,40 @@ %if ldda.library_dataset.deleted: </span> %endif - <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> - <div popupmenu="dataset-${ldda.id}-popup"> - %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( cntrller == 'library_admin' or can_modify ): - <a class="action-button" href="${h.url_for( controller='library_common', action='ldda_edit_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit information</a> - %else: - <a class="action-button" href="${h.url_for( controller='library_common', action='ldda_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">View information</a> - %endif - %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( ( cntrller == 'library_admin' or can_modify ) and not info_association ): - <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a> - %endif - %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( ( cntrller == 'library_admin' or can_modify ) and info_association ): - <a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a> - <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a> - %endif - %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( cntrller == 'library_admin' or can_manage ): - <a class="action-button" href="${h.url_for( controller='library_common', action='ldda_permissions', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit permissions</a> - %endif - %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( cntrller == 'library_admin' or can_modify ): - <a class="action-button" href="${h.url_for( controller='library_common', action='upload_library_dataset', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), replace_id=trans.security.encode_id( library_dataset.id ), show_deleted=show_deleted )}">Upload a new version of this dataset</a> - %endif - %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ldda.has_data: - <a class="action-button" href="${h.url_for( controller='library_common', action='act_on_multiple_datasets', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), ldda_ids=trans.security.encode_id( ldda.id ), do_action='import_to_history', use_panels=use_panels, show_deleted=show_deleted )}">Import this dataset into your current history</a> - <a class="action-button" href="${h.url_for( controller='library_common', action='download_dataset_from_folder', cntrller=cntrller, id=trans.security.encode_id( ldda.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels )}">Download this dataset</a> - %endif - %if cntrller in [ 'library_admin', 'requests_admin' ]: - %if not library.deleted and not branch_deleted( folder ) and not ldda.library_dataset.deleted: - <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( library_dataset.id ), item_type='library_dataset', show_deleted=show_deleted )}">Delete this dataset</a> - %elif not library.deleted and not branch_deleted( folder ) and not ldda.library_dataset.purged and ldda.library_dataset.deleted: - <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( library_dataset.id ), item_type='library_dataset', show_deleted=show_deleted )}">Undelete this dataset</a> + %if not library.deleted: + <a id="dataset-${ldda.id}-popup" class="popup-arrow" style="display: none;">▼</a> + <div popupmenu="dataset-${ldda.id}-popup"> + %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( cntrller == 'library_admin' or can_modify ): + <a class="action-button" href="${h.url_for( controller='library_common', action='ldda_edit_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit information</a> + %else: + <a class="action-button" href="${h.url_for( controller='library_common', action='ldda_info', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">View information</a> %endif - %endif - </div> + %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( ( cntrller == 'library_admin' or can_modify ) and not info_association ): + <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a> + %endif + %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( ( cntrller == 'library_admin' or can_modify ) and info_association ): + <a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a> + <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='ldda', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), ldda_id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a> + %endif + %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( cntrller == 'library_admin' or can_manage ): + <a class="action-button" href="${h.url_for( controller='library_common', action='ldda_permissions', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), id=trans.security.encode_id( ldda.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit permissions</a> + %endif + %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ( cntrller == 'library_admin' or can_modify ): + <a class="action-button" href="${h.url_for( controller='library_common', action='upload_library_dataset', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), replace_id=trans.security.encode_id( library_dataset.id ), show_deleted=show_deleted )}">Upload a new version of this dataset</a> + %endif + %if not branch_deleted( folder ) and not ldda.library_dataset.deleted and ldda.has_data: + <a class="action-button" href="${h.url_for( controller='library_common', action='act_on_multiple_datasets', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), ldda_ids=trans.security.encode_id( ldda.id ), do_action='import_to_history', use_panels=use_panels, show_deleted=show_deleted )}">Import this dataset into your current history</a> + <a class="action-button" href="${h.url_for( controller='library_common', action='download_dataset_from_folder', cntrller=cntrller, id=trans.security.encode_id( ldda.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels )}">Download this dataset</a> + %endif + %if cntrller in [ 'library_admin', 'requests_admin' ]: + %if not library.deleted and not branch_deleted( folder ) and not ldda.library_dataset.deleted: + <a class="action-button" confirm="Click OK to delete dataset '${ldda.name}'." href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( library_dataset.id ), item_type='library_dataset', show_deleted=show_deleted )}">Delete this dataset</a> + %elif not library.deleted and not branch_deleted( folder ) and not ldda.library_dataset.purged and ldda.library_dataset.deleted: + <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( library_dataset.id ), item_type='library_dataset', show_deleted=show_deleted )}">Undelete this dataset</a> + %endif + %endif + </div> + %endif </td> <td id="libraryItemInfo">${render_library_item_info( ldda )}</td> <td>${uploaded_by}</td> @@ -252,7 +254,7 @@ %endif </%def> -<%def name="render_folder( cntrller, folder, folder_pad, created_ldda_ids, library_id, hidden_folder_ids, tracked_datasets, show_deleted=False, parent=None, row_counter=None, root_folder=False )"> +<%def name="render_folder( cntrller, folder, folder_pad, created_ldda_ids, library, hidden_folder_ids, tracked_datasets, show_deleted=False, parent=None, row_counter=None, root_folder=False )"> <% from galaxy.web.controllers.library_common import active_folders, active_folders_and_lddas, activatable_folders_and_lddas, branch_deleted @@ -300,40 +302,42 @@ %if folder.deleted: <span class="libraryItem-error"> %endif - <a href="${h.url_for( controller='library_common', action='folder_info', cntrller=cntrller, use_panels=use_panels, id=trans.security.encode_id( folder.id ), library_id=library_id, show_deleted=show_deleted )}">${folder.name}</a> + <a href="${h.url_for( controller='library_common', action='folder_info', cntrller=cntrller, use_panels=use_panels, id=trans.security.encode_id( folder.id ), library_id=trans.security.encode_id( library.id ), show_deleted=show_deleted )}">${folder.name}</a> %if folder.description: <i>- ${folder.description}</i> %endif %if folder.deleted: </span> %endif - <a id="folder_img-${folder.id}-popup" class="popup-arrow" style="display: none;">▼</a> - <div popupmenu="folder_img-${folder.id}-popup"> - %if not branch_deleted( folder ) and ( cntrller == 'library_admin' or can_add ): - <a class="action-button" href="${h.url_for( controller='library_common', action='upload_library_dataset', cntrller=cntrller, library_id=library_id, folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add datasets</a> - <a class="action-button" href="${h.url_for( controller='library_common', action='create_folder', cntrller=cntrller, parent_id=trans.security.encode_id( folder.id ), library_id=library_id, use_panels=use_panels, show_deleted=show_deleted )}">Add sub-folder</a> - %endif - %if not branch_deleted( folder ) and ( cntrller == 'library_admin' or can_modify ): - <a class="action-button" href="${h.url_for( controller='library_common', action='folder_info', cntrller=cntrller, id=trans.security.encode_id( folder.id ), library_id=library_id, use_panels=use_panels, show_deleted=show_deleted )}">Edit information</a> - %endif - %if not branch_deleted( folder ) and ( ( cntrller == 'library_admin' or can_modify ) and not info_association ): - <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a> - %endif - %if not branch_deleted( folder ) and ( ( cntrller == 'library_admin' or can_modify ) and info_association ): - <a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a> - <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a> - %endif - %if not branch_deleted( folder ) and ( cntrller == 'library_admin' or can_manage ): - <a class="action-button" href="${h.url_for( controller='library_common', action='folder_permissions', cntrller=cntrller, id=trans.security.encode_id( folder.id ), library_id=library_id, use_panels=use_panels, show_deleted=show_deleted )}">Edit permissions</a> - %endif - %if cntrller in [ 'library_admin', 'requests_admin' ]: - %if not library.deleted and not folder.deleted: - <a class="action-button" confirm="Click OK to delete the folder '${folder.name}.'" href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=library_id, item_id=trans.security.encode_id( folder.id ), item_type='folder', show_deleted=show_deleted )}">Delete this folder</a> - %elif not library.deleted and folder.deleted and not folder.purged: - <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=library_id, item_id=trans.security.encode_id( folder.id ), item_type='folder', show_deleted=show_deleted )}">Undelete this folder</a> + %if not library.deleted: + <a id="folder_img-${folder.id}-popup" class="popup-arrow" style="display: none;">▼</a> + <div popupmenu="folder_img-${folder.id}-popup"> + %if not branch_deleted( folder ) and ( cntrller == 'library_admin' or can_add ): + <a class="action-button" href="${h.url_for( controller='library_common', action='upload_library_dataset', cntrller=cntrller, library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add datasets</a> + <a class="action-button" href="${h.url_for( controller='library_common', action='create_folder', cntrller=cntrller, parent_id=trans.security.encode_id( folder.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add sub-folder</a> %endif - %endif - </div> + %if not branch_deleted( folder ) and ( cntrller == 'library_admin' or can_modify ): + <a class="action-button" href="${h.url_for( controller='library_common', action='folder_info', cntrller=cntrller, id=trans.security.encode_id( folder.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit information</a> + %endif + %if not branch_deleted( folder ) and ( ( cntrller == 'library_admin' or can_modify ) and not info_association ): + <a class="action-button" href="${h.url_for( controller='library_common', action='add_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Add template</a> + %endif + %if not branch_deleted( folder ) and ( ( cntrller == 'library_admin' or can_modify ) and info_association ): + <a class="action-button" href="${h.url_for( controller='library_common', action='edit_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit template</a> + <a class="action-button" href="${h.url_for( controller='library_common', action='delete_template', cntrller=cntrller, item_type='folder', library_id=trans.security.encode_id( library.id ), folder_id=trans.security.encode_id( folder.id ), use_panels=use_panels, show_deleted=show_deleted )}">Delete template</a> + %endif + %if not branch_deleted( folder ) and ( cntrller == 'library_admin' or can_manage ): + <a class="action-button" href="${h.url_for( controller='library_common', action='folder_permissions', cntrller=cntrller, id=trans.security.encode_id( folder.id ), library_id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=show_deleted )}">Edit permissions</a> + %endif + %if cntrller in [ 'library_admin', 'requests_admin' ]: + %if not library.deleted and not folder.deleted: + <a class="action-button" confirm="Click OK to delete the folder '${folder.name}.'" href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( folder.id ), item_type='folder', show_deleted=show_deleted )}">Delete this folder</a> + %elif not library.deleted and folder.deleted and not folder.purged: + <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( folder.id ), item_type='folder', show_deleted=show_deleted )}">Undelete this folder</a> + %endif + %endif + </div> + %endif </div> <td colspan="3"></td> </tr> @@ -345,7 +349,7 @@ %if cntrller == 'library': <% sub_folders = active_folders( trans, folder ) %> %for sub_folder in sub_folders: - ${render_folder( cntrller, sub_folder, pad, created_ldda_ids, library_id, hidden_folder_ids, tracked_datasets, show_deleted=show_deleted, parent=my_row, row_counter=row_counter, root_folder=False )} + ${render_folder( cntrller, sub_folder, pad, created_ldda_ids, library, hidden_folder_ids, tracked_datasets, show_deleted=show_deleted, parent=my_row, row_counter=row_counter, root_folder=False )} %endfor %for library_dataset in folder.active_library_datasets: <% @@ -365,7 +369,7 @@ sub_folders, lddas = active_folders_and_lddas( trans, folder ) %> %for sub_folder in sub_folders: - ${render_folder( cntrller, sub_folder, pad, created_ldda_ids, library_id, [], tracked_datasets, show_deleted=show_deleted, parent=my_row, row_counter=row_counter, root_folder=False )} + ${render_folder( cntrller, sub_folder, pad, created_ldda_ids, library, [], tracked_datasets, show_deleted=show_deleted, parent=my_row, row_counter=row_counter, root_folder=False )} %endfor %for ldda in lddas: <% @@ -470,12 +474,12 @@ </tr> <% row_counter = RowCounter() %> %if cntrller in [ 'library', 'requests' ]: - ${self.render_folder( 'library', library.root_folder, 0, created_ldda_ids, trans.security.encode_id( library.id ), hidden_folder_ids, tracked_datasets, show_deleted=show_deleted, parent=None, row_counter=row_counter, root_folder=True )} + ${self.render_folder( 'library', library.root_folder, 0, created_ldda_ids, library, hidden_folder_ids, tracked_datasets, show_deleted=show_deleted, parent=None, row_counter=row_counter, root_folder=True )} %if not library.deleted: ${render_actions_on_multiple_items()} %endif %elif cntrller in [ 'library_admin', 'requests_admin' ]: - ${self.render_folder( 'library_admin', library.root_folder, 0, created_ldda_ids, trans.security.encode_id( library.id ), [], tracked_datasets, show_deleted=show_deleted, parent=None, row_counter=row_counter, root_folder=True )} + ${self.render_folder( 'library_admin', library.root_folder, 0, created_ldda_ids, library, [], tracked_datasets, show_deleted=show_deleted, parent=None, row_counter=row_counter, root_folder=True )} %if not library.deleted and not show_deleted: ${render_actions_on_multiple_items()} %endif

1 0

help with dynamic select parameters
by Lee, Joshua 24 Mar '10

24 Mar '10

Hi, I'm trying to create a tool where there are several select parameters whose choices are determine by the previous parameter(s). I have a toy example with three parameters: Category, Food, and Prep method. Depending on the chosen Category, only certain Foods are shown, which in turn determines which Prep methods are available. I'm trying to use the <options> tag with the "from_file" attribute. I have one column per parameter and one row per valid combination. My problem is that the front end can get into a state where a certain valid combinations will be unselectable. In the example below, I can never select "Fruit", "Kiwi", and "Raw". When I change the 1st select, the values for the 2nd select are loaded, but the values for the 3rd select cannot be updated. This is particularly problematic if there is only one choice for the 2nd select, because I cannot get it's "onchange" handler to fire (so the 3rd select is always empty). In my case, it would be nice if the first value of the 2nd select is chosen as a default, and the 3rd select is populated accordingly. Any help would be appreciated. Perhaps I'm not using these features as intended, but it seemed like a natural application. Thanks, Josh My data file looks like: Meat Chicken Fried Meat Chicken Grilled Meat Beef Grilled Meat Beef Stir-fried Veg Carrot Boiled Veg Fennel Raw Fruit Kiwi Raw And my tool's <inputs> section is: <inputs> <param name="paramA" type="select" label="Category"> <options from_file="test_select_options.txt"> <column name="value" index="0"/> <column name="name" index="0"/> <filter type="unique_value" name="unique" column="0"/> </options> </param> <param name="paramB" type="select" label="Food" > <options from_file="test_select_options.txt"> <column name="value" index="1"/> <column name="name" index="1"/> <filter type="unique_value" name="unique" column="1"/> <filter type="param_value" ref="paramA" name="A" column="0"/> </options> </param> <param name="paramC" type="select" label="How prepared"> <options from_file="test_select_options.txt"> <column name="value" index="2"/> <column name="name" index="2"/> <filter type="param_value" ref="paramA" name="A" column="0"/> <filter type="param_value" ref="paramB" name="B" column="1"/> </options> </param> </inputs>

2 1

Binary datatypes
by Pieter Neerincx 24 Mar '10

24 Mar '10

Hi Galaxy team, Some time ago I added a binary data type to my Galaxy development machine. I simply defined the input for a tool as the standard binary data type. Recently I upgraded my Galaxy instance and afterwards I could no longer upload binary data successfully :(. So, I looked at the docs to properly define a new binary data specific for that tool. I created a Python class, wrote a sniffer and listed the new stuff in the datatypes_conf.xml. To my surprise that did not work... After some digging I found that for a binary datatype I also had to hack the data upload tool in two places (see below). The word hack is maybe a bit too much for simply copying the lines for the already supported bam and Sff data types, but having to change code to support a new datatype sounds like a bad plan to me. Would it be possible to make sure support for a new binary data type is completely handled by config files and maybe a new python class, but without hacking code just like for non-binary data types? Cheers, Pi ------------------- def check_bam( temp_name ): return Bam().sniff( temp_name ) def check_sff( temp_name ): return Sff().sniff( temp_name ) # # Added mod for Thermo Finnigan RAW files START # def check_raw( temp_name ): return RAW().sniff( temp_name ) # # Added mod for Thermo Finnigan RAW files END # ..... # Is dataset content supported sniffable binary? elif check_bam( dataset.path ): ext = 'bam' data_type = 'bam' elif check_sff( dataset.path ): ext = 'sff' data_type = 'sff' # # Added mod for Thermo Finnigan RAW files START # elif check_raw( dataset.path ): ext = 'raw' data_type = 'raw' # # Added mod for Thermo Finnigan RAW files END #

2 2

Feature Request: customize name of history item in a collected primary dataset
by Lee, Joshua 23 Mar '10

23 Mar '10

Hi, I have a tool that produces a variable number of outputs, which are written to the tmp database path with the specially formatted name "%s_%s_%s_%s_%s" % ( 'primary', output1.id, name, 'visible', file_type ). In lib/galaxy/tools/__init__.py, the history item's "designation" is set to "name" and the item's "name" is set to output1.name. This potentially creates many items with the same name, which must be differentiated either through meta data or by examining the contents of the file. I would like to request a means to customize the name of the collected dataset. A simple but hack-y method would be to append another token to the name of the file. If this token exists, it would be used as the history item's name e.g. "primary_123_NAME123_visible_txt_dbkey_NEWNAME". This would also require that the optional DBKEY token would have to be validated for non-blank values. Josh

1 0

format for csv file to import a sequencing request sample
by nsfox＠uwaterloo.ca 23 Mar '10

23 Mar '10

Hi, What is the order of the parameters/format for a csv file that I can use to import a sequencing request sample? Thanks, Natalie

2 3

Re: [galaxy-dev] Connect a local UCSC mirror to galaxy
by Greg Von Kuster 23 Mar '10

23 Mar '10

Hello Emeric, Please send your questions to the galaxy mailing lists ( galaxy-bugs(a)bx.psu.ed, galaxy-dev(a)bx.psu.edu, galaxy-user(a)bx.psu.edu ) instead of private email addresses as you will be much more likely to get answers in a timely fashion. Given the context of your question, I assume you want to point another UCSC-like "get data" tool to your mirror. If that is the case, simply copy the ~/tools/data_source/ucsc_tablebrowser.xml file to a different file name (e.g., my_mirror.xml) , and edit the following line in it to point to your mirror: <inputs action="http://genome.ucsc.edu/cgi-bin/hgTables" check_values="false" method="get"> Next, add an entry for it in your tool_conf.xml file and restart your Galaxy instance. That's all you should need. On Mar 23, 2010, at 10:22 AM, Emeric Dubois wrote: > Hello Greg > > I have installed a partial mirror of UCSC and Galaxy on my server. > I want use my UCSC mirror to get data and display in my gallaxy installation. > Is it possible to do that ? How ? > Please, can you help me ? > > Thanks > > Emeric > > -- > ***************************************** > > Emeric Dubois > Plateforme MGX > Institut de Génomique Fonctionnelle > UMR 5203 CNRS – U 661 INSERM – Universite de Montpellier > 141 rue de la cardonille > 34094 Montpellier Cedex 05, France > Tel: 04 67 14 29 32 > > Emeric.Dubois(a)igf.cnrs.fr > > ***************************************** > > > -- > Ce message a été vérifié par MailScanner > pour des virus ou des polluriels et rien de > suspect n'a été trouvé. > Greg Von Kuster Galaxy Development Team greg(a)bx.psu.edu

1 0

transfer dataset failed because user could not login
by nsfox＠uwaterloo.ca 23 Mar '10

23 Mar '10

Hi, I know that I have had the data transfer functionality working in the past but it's currently failing ending with the following: 127.0.0.1 - - [23/Mar/2010:08:37:50 -0400] "GET /user/create?username=nsfox1%40example.org&confirm=testuser&messagetype=error&msg=User+with+that+email+already+exists&password=testuser&email=nsfox1%40example.org HTTP/1.1" 200 - "-" "Python-urllib/2.5" ERROR:root:Traceback (most recent call last): File "scripts/galaxy_messaging/server/data_transfer.py", line 166, in add_to_library raise DataTransferException("The "+self.datatx_email+" user could not login to Galaxy") DataTransferException: 'The nsfox1(a)example.org user could not login to Galaxy' ERROR:root:FATAL ERROR.The nsfox1(a)example.org user could not login to Galaxy DEBUG:root:[[u'data/ATC_AA', u'Error'], [u'data/ATC_AB', u'Error'], [u'data/CRA_AC', u'Error'], [u'data/CRA_AE', u'In progress']] DEBUG:root:###################### [u'data/CRA_AE', u'Error.The nsfox1(a)example.org user could not login to Galaxy'] I re-downloaded the Galaxy instance again but I'm still having this issue. The user I'm using here is an admin user with permission to add to the data library and when I go and login galaxy it works. Any suggestions as to what I might be wrong would be great. Thanks, Natalie

2 1

addition to ".hgignore"
by Assaf Gordon 22 Mar '10

22 Mar '10

Hi, the following path: database/reports/compiled_templates can be added to ".hgignore" file to remove non-relevant compiled python files from "hg st". -gordon

1 0

feature suggestion: XY-Plot with manually set axis range
by Assaf Gordon 21 Mar '10

21 Mar '10

Hello, A small feature requested by our users: The ability to set the axis ranges in the plotting tool (xy_plot.xml). The attached patch adds this ability as an optional parameter in the tool. Note1: if the input data goes beyond the user's suggest range, the range is extended. Note2: the patch contains CR/LF because it appears the 'xy_plot.xml' tool has windows-style newlines. -gordon

1 0

Searching Sequencing Requests
by nsfox＠uwaterloo.ca 19 Mar '10

19 Mar '10

Hi, I'm getting an error "AttributeError: 'StateColumn' object has no attribute 'get_filter'" if I search anything on the sequencing request page. Searching specifically within the Name search or Description search does work though. Is this a known bug or did I possibly miss setting up something in my Galaxy Instance? Also, that search, which is currently not working for me, it only searches the information the sequencing requests page, right? I'd like to request being able to search the requests for something within the request or have some where of quickly determining the information of the sample with the requests without browsing to each one. Any information is appreciated. Thanks, Natalie

2 1

[hg] galaxy 3545: Style and functional fixes for embedded items.
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/2590120aed68 changeset: 3545:2590120aed68 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Thu Mar 18 12:57:29 2010 -0400 description: Style and functional fixes for embedded items. diffstat: static/june_2007_style/blue/embed_item.css | 4 ++-- static/june_2007_style/embed_item.css.tmpl | 4 ++-- templates/display_base.mako | 18 ++++++++++++++++++ templates/history/display.mako | 7 +------ templates/history/view.mako | 2 +- templates/page/display.mako | 10 +++++++++- templates/workflow/display.mako | 8 +------- 7 files changed, 34 insertions(+), 19 deletions(-) diffs (147 lines): diff -r cb9b4a967ff2 -r 2590120aed68 static/june_2007_style/blue/embed_item.css --- a/static/june_2007_style/blue/embed_item.css Wed Mar 17 20:59:47 2010 -0400 +++ b/static/june_2007_style/blue/embed_item.css Thu Mar 18 12:57:29 2010 -0400 @@ -4,8 +4,8 @@ .embedded-item.history p{background:#C1C9E5 no-repeat 2px 2px;margin-top:0;margin-bottom:0;} .embedded-item.dataset{background-color:#CFC} .embedded-item.dataset p{background:#CFC no-repeat 2px 2px;margin-top:0;margin-bottom:0;} -.embedded-item.workflow{background-color:#EBD9B2} -.embedded-item.workflow p{background:#EBD9B2 no-repeat 2px 2px;margin-top:0;margin-bottom:0;} +.embedded-item.workflow{background-color:#FBDDB3} +.embedded-item.workflow p{background:#FBDDB3 no-repeat 2px 2px;margin-top:0;margin-bottom:0;} .embedded-item.placeholder{} .embedded-item .item-content{max-height:25em;overflow:auto;display:none;} .embedded-item .title{vertical-align:top;text-align:center;font-weight:bold;} diff -r cb9b4a967ff2 -r 2590120aed68 static/june_2007_style/embed_item.css.tmpl --- a/static/june_2007_style/embed_item.css.tmpl Wed Mar 17 20:59:47 2010 -0400 +++ b/static/june_2007_style/embed_item.css.tmpl Thu Mar 18 12:57:29 2010 -0400 @@ -32,11 +32,11 @@ } .embedded-item.workflow { - background-color:#EBD9B2 + background-color:#FBDDB3 } .embedded-item.workflow p { - background:#EBD9B2 no-repeat 2px 2px; + background:#FBDDB3 no-repeat 2px 2px; margin-top:0; margin-bottom:0; } diff -r cb9b4a967ff2 -r 2590120aed68 templates/display_base.mako --- a/templates/display_base.mako Wed Mar 17 20:59:47 2010 -0400 +++ b/templates/display_base.mako Thu Mar 18 12:57:29 2010 -0400 @@ -92,6 +92,24 @@ border: 2px solid #DDDDDD; border-top: 4px solid #DDDDDD; } + + ## Make sure that history items and workflow steps do not get too long. + .historyItemContainer, .toolForm { + max-width: 500px; + } + + ## Space out tool forms in workflows. + div.toolForm{ + margin-top: 10px; + margin-bottom: 10px; + } + + ## Add border to history item container. + .historyItemContainer { + padding-right: 3px; + border-right-style: solid; + border-right-color: #66AA66; + } </style> </%def> diff -r cb9b4a967ff2 -r 2590120aed68 templates/history/display.mako --- a/templates/history/display.mako Wed Mar 17 20:59:47 2010 -0400 +++ b/templates/history/display.mako Thu Mar 18 12:57:29 2010 -0400 @@ -208,11 +208,6 @@ ${parent.stylesheets()} ${h.css( "history" )} <style type="text/css"> - .visible-right-border { - padding-right: 3px; - border-right-style: solid; - border-right-color: #66AA66; - } .historyItemBody { display: none; } @@ -252,7 +247,7 @@ %else: ## Render requested datasets, ordered from newest to oldest, including annotations. <table class="annotated-item"> - <tr><th>Dataset</th><th class="annotation">Description/Notes</th></tr> + <tr><th>Dataset</th><th class="annotation">Annotation</th></tr> %for data in datasets: <tr> %if data.visible: diff -r cb9b4a967ff2 -r 2590120aed68 templates/history/view.mako --- a/templates/history/view.mako Wed Mar 17 20:59:47 2010 -0400 +++ b/templates/history/view.mako Thu Mar 18 12:57:29 2010 -0400 @@ -269,7 +269,7 @@ ${parent.stylesheets()} ${h.css( "history", "autocomplete_tagging" )} <style type="text/css"> - .visible-right-border { + .historyItemContainer { padding-right: 3px; border-right-style: solid; border-right-color: #66AA66; diff -r cb9b4a967ff2 -r 2590120aed68 templates/page/display.mako --- a/templates/page/display.mako Wed Mar 17 20:59:47 2010 -0400 +++ b/templates/page/display.mako Thu Mar 18 12:57:29 2010 -0400 @@ -47,6 +47,15 @@ container.find(".item-content").html(item_content).show("fast"); container.find(".toggle-expand").hide(); container.find(".toggle-contract").show(); + + // Init needed for history items. + setupHistoryItem( container.find("div.historyItemWrapper") ); + container.find( "div.historyItemBody:visible" ).each( function() { + if ( $.browser.mozilla ) { + $(this).find( "pre.peek" ).css( "overflow", "hidden" ); + } + $(this).hide(); + }); } }); else @@ -218,7 +227,6 @@ ${h.css( "base", "history", "autocomplete_tagging" )} <style type="text/css"> .toggle-contract { display: none; } - .item-content { overflow: auto; } .embedded-item h4 { margin: 0px; } diff -r cb9b4a967ff2 -r 2590120aed68 templates/workflow/display.mako --- a/templates/workflow/display.mako Wed Mar 17 20:59:47 2010 -0400 +++ b/templates/workflow/display.mako Thu Mar 18 12:57:29 2010 -0400 @@ -8,12 +8,6 @@ <%def name="stylesheets()"> ${parent.stylesheets()} ${h.css( "workflow" )} - <style type="text/css"> - div.toolForm{ - margin-top: 10px; - margin-bottom: 10px; - } - </style> </%def> <%def name="do_inputs( inputs, values, prefix, step, other_values=None )"> @@ -87,7 +81,7 @@ trans.get_history( create=True ) %> <table class="annotated-item"> - <tr><th>Step</th><th class="annotation">Description/Notes</th></tr> + <tr><th>Step</th><th class="annotation">Annotation</th></tr> %for i, step in enumerate( steps ): <tr><td> %if step.type == 'tool' or step.type is None:

1 0

[hg] galaxy 3544: lims: workflow field now appears as a link to ...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/cb9b4a967ff2 changeset: 3544:cb9b4a967ff2 user: rc date: Wed Mar 17 20:59:47 2010 -0400 description: lims: workflow field now appears as a link to workflow run page diffstat: templates/admin/requests/show_request.mako | 7 ++++++- 1 files changed, 6 insertions(+), 1 deletions(-) diffs (17 lines): diff -r 1d98e3705f35 -r cb9b4a967ff2 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Wed Mar 17 17:10:24 2010 -0400 +++ b/templates/admin/requests/show_request.mako Wed Mar 17 20:59:47 2010 -0400 @@ -311,7 +311,12 @@ %for field_index, field in fields_dict.items(): <td> %if sample_values[field_index]: - ${sample_values[field_index]} + %if field['type'] == 'WorkflowField': + <% workflow = trans.sa_session.query( trans.app.model.StoredWorkflow ).get( int(sample_values[field_index]) ) %> + <a href="${h.url_for( controller='workflow', action='run', id=trans.security.encode_id(workflow.id) )}">${workflow.name}</a> + %else: + ${sample_values[field_index]} + %endif %else: <i>None</i> %endif

1 0

[hg] galaxy 3543: lims: added workflow field type to form_builder
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/1d98e3705f35 changeset: 3543:1d98e3705f35 user: rc date: Wed Mar 17 17:10:24 2010 -0400 description: lims: added workflow field type to form_builder diffstat: lib/galaxy/model/__init__.py | 4 ++++ lib/galaxy/model/mapping.py | 4 +++- lib/galaxy/web/form_builder.py | 30 +++++++++++++++++++++++++++++- templates/admin/requests/show_request.mako | 10 ++++++++++ 4 files changed, 46 insertions(+), 2 deletions(-) diffs (95 lines): diff -r 032aae80bbb0 -r 1d98e3705f35 lib/galaxy/model/__init__.py --- a/lib/galaxy/model/__init__.py Wed Mar 17 16:40:36 2010 -0400 +++ b/lib/galaxy/model/__init__.py Wed Mar 17 17:10:24 2010 -0400 @@ -1319,6 +1319,10 @@ field_widget.user = user field_widget.value = value field_widget.params = params + elif field['type'] == 'WorkflowField': + field_widget.user = user + field_widget.value = value + field_widget.params = params elif field[ 'type' ] == 'SelectField': for option in field[ 'selectlist' ]: if option == value: diff -r 032aae80bbb0 -r 1d98e3705f35 lib/galaxy/model/mapping.py --- a/lib/galaxy/model/mapping.py Wed Mar 17 16:40:36 2010 -0400 +++ b/lib/galaxy/model/mapping.py Wed Mar 17 17:10:24 2010 -0400 @@ -1304,7 +1304,9 @@ assign_mapper( context, StoredWorkflow, StoredWorkflow.table, - properties=dict( user=relation( User ), + properties=dict( user=relation( User, + primaryjoin=( User.table.c.id == StoredWorkflow.table.c.user_id ), + backref='stored_workflows' ), workflows=relation( Workflow, backref='stored_workflow', cascade="all, delete-orphan", primaryjoin=( StoredWorkflow.table.c.id == Workflow.table.c.stored_workflow_id ) ), diff -r 032aae80bbb0 -r 1d98e3705f35 lib/galaxy/web/form_builder.py --- a/lib/galaxy/web/form_builder.py Wed Mar 17 16:40:36 2010 -0400 +++ b/lib/galaxy/web/form_builder.py Wed Mar 17 17:10:24 2010 -0400 @@ -12,7 +12,7 @@ raise TypeError( "Abstract Method" ) @staticmethod def form_field_types(): - return ['TextField', 'TextArea', 'SelectField', 'CheckboxField', 'AddressField'] + return ['TextField', 'TextArea', 'SelectField', 'CheckboxField', 'AddressField', 'WorkflowField'] class TextField(BaseField): """ @@ -433,6 +433,34 @@ else: self.select_address.add_option('Add a new address', 'new') return self.select_address.get_html()+address_html + + +class WorkflowField(BaseField): + def __init__(self, name, user=None, value=None, params=None): + self.name = name + self.user = user + self.value = value + self.select_workflow = None + self.params = params + def get_html(self): + from galaxy import util + add_ids = ['none'] + if self.user: + for a in self.user.stored_workflows: + add_ids.append(str(a.id)) + self.select_workflow = SelectField(self.name) + if self.value == 'none': + self.select_workflow.add_option('Select one', 'none', selected=True) + else: + self.select_workflow.add_option('Select one', 'none') + if self.user: + for a in self.user.stored_workflows: + if not a.deleted: + if self.value == str(a.id): + self.select_workflow.add_option(a.name, str(a.id), selected=True) + else: + self.select_workflow.add_option(a.name, str(a.id)) + return self.select_workflow.get_html() def get_suite(): diff -r 032aae80bbb0 -r 1d98e3705f35 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Wed Mar 17 16:40:36 2010 -0400 +++ b/templates/admin/requests/show_request.mako Wed Mar 17 17:10:24 2010 -0400 @@ -284,6 +284,16 @@ %endif %endfor </select> + %elif field['type'] == 'WorkflowField': + <select name="sample_${index}_field_${field_index}"> + %for option_index, option in enumerate(request.user.stored_workflows): + %if option == sample_values[field_index]: + <option value="${option.id}" selected>${option.name}</option> + %else: + <option value="${option.id}">${option.name}</option> + %endif + %endfor + </select> %elif field['type'] == 'CheckboxField': <input type="checkbox" name="sample_${index}_field_${field_index}" value="Yes"/> %endif

1 0

[hg] galaxy 3542: First pass as PerM. Also made cosmetic changes...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/032aae80bbb0 changeset: 3542:032aae80bbb0 user: Kelly Vincent <kpvincent(a)bx.psu.edu> date: Wed Mar 17 16:40:36 2010 -0400 description: First pass as PerM. Also made cosmetic changes to BWA. diffstat: buildbot_setup.sh | 2 + test-data/perm_in1.fastqsanger | 76 ++++ test-data/perm_in2.fastqsanger | 76 ++++ test-data/perm_in3.fastqsanger | 396 +++++++++++++++++++++++ test-data/perm_in4.fastqcssanger | 576 ++++++++++++++++++++++++++++++++++ test-data/perm_in5.fastqcssanger | 48 ++ test-data/perm_in6.fastqcssanger | 48 ++ test-data/perm_out1.sam | 33 + test-data/perm_out2.sam | 98 +++++ test-data/perm_out3.fastqsanger | 4 + test-data/perm_out4.sam | 53 +++ test-data/perm_out5.sam | 9 + tool-data/perm_base_index.loc.sample | 27 + tool-data/perm_color_index.loc.sample | 27 + tool_conf.xml.sample | 3 +- tools/sr_mapping/PerM.xml | 368 +++++++++++++++++++++ tools/sr_mapping/bwa_wrapper.xml | 5 +- 17 files changed, 1845 insertions(+), 4 deletions(-) diffs (1949 lines): diff -r 137d93848139 -r 032aae80bbb0 buildbot_setup.sh --- a/buildbot_setup.sh Tue Mar 16 18:54:23 2010 -0400 +++ b/buildbot_setup.sh Wed Mar 17 16:40:36 2010 -0400 @@ -42,6 +42,8 @@ /galaxy/data/location/maf_index.loc /galaxy/data/location/maf_pairwise.loc /galaxy/data/location/microbes/microbial_data.loc +/galaxy/data/location/perm_base_index.loc +/galaxy/data/location/perm_color_index.loc /galaxy/data/location/phastOdds.loc /galaxy/data/location/quality_scores.loc /galaxy/data/location/regions.loc diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_in1.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_in1.fastqsanger Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,76 @@ +@HWI-EAS91_1_30788AAXX:1:1:1761:343/1 +TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA ++/1 +IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII +@HWI-EAS91_1_30788AAXX:1:1:1578:331/1 +TGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1647:512/1 +TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1570:620/1 +GAGTAACAAAGTaaaGTTTGGAccGTTTTTGTCTCGTGCTCGTCGCTGCG ++/1 +IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1599:330/1 +AGAAGAAAACGTGCGTCAAAAATTACGTGCaGAAGGAGTGATGTAATGTC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1652:270/1 +AGCGTAAAGGCGCTCGTCTTTGGTATGTAGGacTTTGCATTGTTTAATTG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1746:351/1 +CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1582:633/1 +CCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCAC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1598:534/1 +GCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1572:324/1 +AAGGTGCTTaaaTTCgtGGGTCCTGAGCTGGCGACCCTGTTTTGTATGGC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1749:466/1 +TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1629:446/1 +AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1763:587/1 +AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1616:363/1 +TGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1768:715/1 +ACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCT ++/1 +IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1572:270/1 +TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 +TATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCT ++/1 +III""""""IIIIIIIII""FI"IIII""II+ICI"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1673:514/1 +ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII +@HWI-EAS91_1_30788AAXX:1:1:1634:330/1 +GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_in2.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_in2.fastqsanger Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,76 @@ +@HWI-EAS91_1_30788AAXX:1:1:1761:343/2 +TTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGG ++/2 +IIIIIII""IIIIIII0II?I""IIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1578:331/2 +AAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGAGATTCTCT ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1647:512/2 +TTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTG ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1570:620/2 +CTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCT ++/2 +IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1599:330/2 +TTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCA ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIII<III@II?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1652:270/2 +GCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCG ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1746:351/2 +CCACTCCTCTCCCGACTGTGTGTGTGTGTGTTTATATTGACCATGCCGCT ++/2 +IIIIIII""IIIIIIIIIIIIIIIIII?I0IIIIHIIIGIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1582:633/2 +TCTATTGACATTATGGGTCTGCAAGCTGCTTTTTTTTTTTTTTTTTTTTT ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1598:534/2 +TTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCC ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1572:324/2 +GCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGT ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1749:466/2 +GCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTG ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1629:446/2 +CAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCAGA ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1763:587/2 +CATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTC ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1616:363/2 +GTGACTATTGACGTCCTTCCCCGTACGCCGGGCAATAAtGTTTATGTTGG ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1768:715/2 +AGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGATA ++/2 +IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1572:270/2 +ACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATG ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1785:1272/2 +GACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCGTC ++/2 +III""""""IIIIIIIII""FI"IIII""II+ICI?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1673:514/2 +GCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATG ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1?I0IIIIHIIIGIII +@HWI-EAS91_1_30788AAXX:1:1:1634:330/2 +TCAAGATTGCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTaCTAT ++/2 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II?I0IIIIHIIIGIII diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_in3.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_in3.fastqsanger Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,396 @@ +@HWI-EAS91_1_30788AAXX:1:1:1513:715/1 +GTTTTTTGGGCATAGATGTTTAGTTGTGGTAGTCAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIDI?II-+I +@HWI-EAS91_1_30788AAXX:1:1:1698:516/1 +GTTGTTAGGGAGAGGAGTTGAACCTCTGAGTGTAAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIII5IIIII9I +@HWI-EAS91_1_30788AAXX:1:1:1491:637/1 +GCTAGCAGGATGGATCCGGCAATTGGGGCTTCTACA ++/1 +IIIIIII""IIIIIIIIIIIIFIIIIIIIIIIIABD +@HWI-EAS91_1_30788AAXX:1:1:1711:249/1 +GGAAGTAGGGGCCTGCGTTCAGGCGTTCTGTTTGGT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1634:211/1 +GAAGCAGGGGCTTGATACTGACACTTCGTCGACGTA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIII9IIDF +@HWI-EAS91_1_30788AAXX:1:1:1218:141/1 +GTTAAATATTGGGAGTGGGGGGGGGGGGGAGTTTTGT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIII1IIII+I +@HWI-EAS91_1_30788AAXX:1:1:1398:854/1 +GTGAAGAGGAGGGGATTTATTAGTACGGGAAGGGTG ++/1 +IIIIIII""IIIIIBIIIIIIIIIIIIIIA=IIIII +@HWI-EAS91_1_30788AAXX:1:1:1310:991/1 +GAATAGTGGTAGTATTATTCCTTCTAGGCATAGGAG ++/1 +IIIIIII""IIIIIIIIII4IIIIIIDII:IEI2:I +@HWI-EAS91_1_30788AAXX:1:1:1716:413/1 +GATCCAAGGCTTTATCAACACCTATTCTGATTCTTC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1630:59/1 +GGAGCGGGGGGTTGGTAAGGTTGGGGTCGAGTATGA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIII;IIHIIF +@HWI-EAS91_1_30788AAXX:1:1:1601:805/1 +GAAAACAGGAAAACAATCCAGTCACTTACCCTATGC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII@III +@HWI-EAS91_1_30788AAXX:1:1:1663:724/1 +GTTTGCCGGCGCCATCCTACGCTCCATTCCCAACAA ++/1 +IIIIIII""IIII8IIIIIIHIIII6IIIII1CI=3 +@HWI-EAS91_1_30788AAXX:1:1:1454:975/1 +GCTAGGCGGGAGTGGTAAAAGGCTCAGAAGAAGCCA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIEIG;IIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1461:255/1 +GTACACCGGCGCCTGAGCCCTACTAATAACTCTCAT ++/1 +IIIIIII""IIIIII9IIIIIIEI(II9.I4III,I +@HWI-EAS91_1_30788AAXX:1:1:1775:764/1 +GCATCCCGGTAGATCTAATTTTCTAAATCTGTCAAC ++/1 +IIIIIII""III@IIII+IIIIII8H8IIIIIIICI +@HWI-EAS91_1_30788AAXX:1:1:1269:520/1 +GGAGTATGGAATAAGTGATTTTAGATCGGTTTGTCG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1303:1162/1 +GAGCAAGGGCAGGAGGAGGAGTCCTAGGATGTCTTT ++/1 +IIIIIII""IIIIFII4*IGIAI(IAII49',3I6I +@HWI-EAS91_1_30788AAXX:1:1:1090:409/1 +GTTTGTTGGGAATGGAGCGTAGGATGGCGTAGGCAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIII:IIA8I +@HWI-EAS91_1_30788AAXX:1:1:1336:1000/1 +GGTAAATGGGAAATATTAAGTTTCTGTTTCTAGATC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIII9II +@HWI-EAS91_1_30788AAXX:1:1:1199:1376/1 +GTTTTCTGGAAAACCTTCACCTATTTATGGGGGTTT ++/1 +IIIIIII""IIIIIIIIIIIII;III3IIG&:/III +@HWI-EAS91_1_30788AAXX:1:1:1598:1148/1 +GATCAATGGTTTGGATCAATAAGTGATTATATATTT ++/1 +IIIIIII""IIIIIDIIIIII?IIICII=IHIIIII +@HWI-EAS91_1_30788AAXX:1:1:1723:1459/1 +GAAACCCGGACGTTTGGATGGGCCCGGAGCGAGGAT ++/1 +IIIIIII""IIIIIIIIDIIIIIIIII9HII-II=I +@HWI-EAS91_1_30788AAXX:1:1:1442:1346/1 +TATCAAGGGGCTGCTTCGAATCCGAAGTGGTGGCTG ++/1 +IIIIIII""IIIIIDIIIII1I(I4II<?<-II*,& +@HWI-EAS91_1_30788AAXX:1:1:850:117/1 +GTATGACGGTAAAGAAAATTATTACGAATGCATGGG ++/1 +IIIIIII""IIIIIIEIEIIIIIIIIEBIDD9I;:? +@HWI-EAS91_1_30788AAXX:1:1:795:325/1 +GGGTACTGGGAAGTGGAATGGTGTGAGTCCAAGTTT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIII65IIII +@HWI-EAS91_1_30788AAXX:1:1:873:453/1 +GAGTAGGGGGATTGCTAGAGTTACTTCGTATGAGAT ++/1 +IIIIIII""IIIIIIIIIIIIIIIII@IIIIIII=I +@HWI-EAS91_1_30788AAXX:1:1:1285:1334/1 +GATATGGGGTCTGGAATAGGATTGCGCTGTTATCCC ++/1 +IIIIIII""IIIIIBIIGIIIIIIIIII8IIIII8I +@HWI-EAS91_1_30788AAXX:1:1:905:406/1 +GAAAAGTGGTAGGCTATATGCAACTTCGCAAAGGAC ++/1 +IIIIIII""IIIIIIIIBIIIIBIIII=I@96D2*I +@HWI-EAS91_1_30788AAXX:1:1:1774:595/1 +TTTAGGTGGGATGTGGGGATCATGTAGGAGTCAAAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIEI +@HWI-EAS91_1_30788AAXX:1:1:1694:931/1 +TTAAATTGGCATTAGAATTGAGTAGTTTTTAGGTAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIH,III +@HWI-EAS91_1_30788AAXX:1:1:1092:1151/1 +GAGAGTTGGCTGATTTAGGCGCCCAGGGATAGCGTC ++/1 +IIIIIII""IIIIIIIIIII5III>IIIII6@III5 +@HWI-EAS91_1_30788AAXX:1:1:803:557/1 +GGTGTGTGGGCGCTTCATGGCCTGATTCAATTAAGC ++/1 +IIIIIII""IIIIIIIIIIIIIII<IIII?III406 +@HWI-EAS91_1_30788AAXX:1:1:1315:1200/1 +TAGTTTTGGGGGGTTTTCTTCAAAACCTTCACCTAT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII;I +@HWI-EAS91_1_30788AAXX:1:1:765:358/1 +GGTGTTTGGATGAGGACGGCTACGATTACTAGGGCT ++/1 +IIIIIII""IIIIIIIIIIIIDIIAII4@I0D='1I +@HWI-EAS91_1_30788AAXX:1:1:1425:1167/1 +GACCTTAGGTGTAGGACATGGTGTAATTCGGTAGCA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIII(%II+IG +@HWI-EAS91_1_30788AAXX:1:1:1775:635/1 +AATAGCCGGATAGCTAGAAGTAAGGTTGAGTTAAAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIBI +@HWI-EAS91_1_30788AAXX:1:1:1433:749/1 +GACTATGGGTGCTATTATACATGCTAGTCATAGGAA ++/1 +IIIIIII""IIIIIIIIIIIFIIIIICIIIIB/I9E +@HWI-EAS91_1_30788AAXX:1:1:798:247/1 +GGAGATTGGAAAGTAGTATGCTTAGGGTAAGGGTGA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1249:1238/1 +TATTGTTGGGGTAGCGAAAGAGGCGAATAGATTTTC ++/1 +IIIIIII""IIIIIIIIIIIBIIIICDIII7IIII@ +@HWI-EAS91_1_30788AAXX:1:1:1043:1104/1 +GGAAGGGGGAATAGGAGGGCAATTTCTAAGTCGAAT ++/1 +II&IIII""IIIIIIDIIIII;IFI<I0II.IIIC, +@HWI-EAS91_1_30788AAXX:1:1:1655:1058/1 +AAAAATCGGCTTTACAATTATATTCGTAGGGGTAAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIFIII6AIIIGI +@HWI-EAS91_1_30788AAXX:1:1:1764:1403/1 +TGATGAAGGGTTTGAGGGGGCTGGTAGGTCAATAAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIBIIIII +@HWI-EAS91_1_30788AAXX:1:1:1632:34/1 +AGGATAGGGGCTATCCGTTGGTCTTAGGAACCAAAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIFIIIH:6I +@HWI-EAS91_1_30788AAXX:1:1:1367:1208/1 +GACACGTGGCACTTCCAATCATACTATCCAGCATCC ++/1 +IIIIIII""IIIIIIII:IIII8IIEIIII-IAIII +@HWI-EAS91_1_30788AAXX:1:1:1778:108/1 +AATACACGGACCATATCAACAGCATTAAACCTTCAT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII@I +@HWI-EAS91_1_30788AAXX:1:1:1152:1115/1 +GTAGTATGGCGTAGCCTCCTAGTTTTAGTAGAATGG ++/1 +7IIIIII""IIIIIIIIIII.68IIIDII=7IIIA' +@HWI-EAS91_1_30788AAXX:1:1:1165:1121/1 +ATACTCAGGTCATTCTAGTCCTTTTTGGGTTCATTC ++/1 +IIIIIII""IIIIIIIIIIIIIIIII22?IIIIIIA +@HWI-EAS91_1_30788AAXX:1:1:1500:55/1 +ATAGAGAGGAGTGCAACTAAGAGTGGGAGGGAACCT ++/1 +IIIIIII""IIIIIIIIIIFIIIIIIICIII<IIII +@HWI-EAS91_1_30788AAXX:1:1:1142:1196/1 +TCATTTTGGTACCACTCGCAAGCACCATCGAAAACA ++/1 +IIIIIII""IIIIIIIIIIIIIIIII@I=I79I6II +@HWI-EAS91_1_30788AAXX:1:1:1693:757/1 +AAATTATGGGTTAAACCCCTATATACCTCTATGGCC ++/1 +IIIIIII""IIIIIIIIIIIIIBIDIIIII0II-IG +@HWI-EAS91_1_30788AAXX:1:1:1364:1053/1 +TTATTCAGGTGGGTATGAATCCTGATAGTGGGGGGA ++/1 +IIIIIII""IIIIIIIIIIIIIIIII?.I31G&4=5 +@HWI-EAS91_1_30788AAXX:1:1:1450:1443/1 +GTAAAAAGGTGCTCCAAGGCCTATTCATCACAATTT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIEIB8III +@HWI-EAS91_1_30788AAXX:1:1:1701:1298/1 +TAGTAGAGGCCGCGTCCTACGTGAATGAAGAGGCAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIII8II;IIIGI +@HWI-EAS91_1_30788AAXX:1:1:1729:856/1 +TCCTATTGGTTCAATACTGAAACCAAGCACTACCCG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIFIIIII@IIIH +@HWI-EAS91_1_30788AAXX:1:1:1748:933/1 +TGAGCTCGGGGCTTCATCTTCTTATTCACAGTAGGA ++/1 +IIIIIII""IIIIIICIIIIIIIIIIIIII@II5@F +@HWI-EAS91_1_30788AAXX:1:1:1662:1296/1 +TTAGTTAGGAATAGAATTACACATGCAAGTATCCGC ++/1 +IIIIIII""IIIIIIIIIIIIIHIIIEI5IIIII4I +@HWI-EAS91_1_30788AAXX:1:1:1393:345/1 +ATTTACAGGAGAATTGAGTAGTTTTTAGGTAAATTT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIE+IIEIIII +@HWI-EAS91_1_30788AAXX:1:1:943:780/1 +AGGCGTTGGGTTTGGTTGCCTCAGCGGGTGATGATA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIII;II<IH +@HWI-EAS91_1_30788AAXX:1:1:1639:968/1 +AGCTCACGGAAAATAGCAGCATCATCCTCCCCACAC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8I:I +@HWI-EAS91_1_30788AAXX:1:1:589:1114/1 +GTCATTCGGGATTAGTTGAGGTTAATTCTACTGTAG ++/1 +IIIIIII""IIIIIIIIIII1IIIIIIIIIII&II) +@HWI-EAS91_1_30788AAXX:1:1:763:408/1 +GCCCCACGGCTGGTGTTGACAACATGACTACTGCCA ++/1 +IIIIIII""IIIIIIIIIIIIII=I*5II<II'II( +@HWI-EAS91_1_30788AAXX:1:1:950:352/1 +ACGCATAGGCAACATGAAATACCATCTCATCCATAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIFIIIIIGI +@HWI-EAS91_1_30788AAXX:1:1:1164:103/1 +TTAACTAGGACATTCACCAAACCATTAAAGTATAGG ++/1 +IIIIIII""IIIIIIIIIIIAII=IIB58I=<I;II +@HWI-EAS91_1_30788AAXX:1:1:1078:1202/1 +TAGGGCTGGGCATAGTGGGGTATCTAATCCCAGTTT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIEIII +@HWI-EAS91_1_30788AAXX:1:1:1617:490/1 +AATCCTTGGTAACCGCATCGGGGATATCGGCTTCAT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIII:(D +@HWI-EAS91_1_30788AAXX:1:1:843:504/1 +ACAACATGGAATACCATCTCATCCATAGGATCTTTT ++/1 +IIIIIII""IIIIIIIIAIIIIII>IIHI=IIIIII +@HWI-EAS91_1_30788AAXX:1:1:942:318/1 +TTCATACGGGCCATGTCCAGCCTAGCTGTCTACTCA ++/1 +IIIIIII""IIIIIIIIIIHIIIIIIIIIII<IIIF +@HWI-EAS91_1_30788AAXX:1:1:1719:283/1 +TTTTGTTGGCCGAGGTCACCCCAACCGAAATTGCTG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIII3=2IGIIII +@HWI-EAS91_1_30788AAXX:1:1:1517:961/1 +TGTCACTGGTCCATATTAATATCTTCCTAGCATTCA ++/1 +IIIIIII""IIIII=III9I@IIIIIIIBIIEIII> +@HWI-EAS91_1_30788AAXX:1:1:1482:345/1 +AGGATGTGGGTTAATAGCCCTATAGCTAGAAGTAAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIII?IAHIIAAI +@HWI-EAS91_1_30788AAXX:1:1:1697:533/1 +ATGAGGTGGATTAGGAGGTGTCCGGCGGTAATGTTA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIII1>IIIII +@HWI-EAS91_1_30788AAXX:1:1:1159:1225/1 +TTTCTACGGCAAGGGACGCCCATTTTCCTCATCCCC ++/1 +IIIIIII""IIIII=I7IIII3IIIIIIII/ID@II +@HWI-EAS91_1_30788AAXX:1:1:982:332/1 +AAGGATTGGATCCCCTCCTCCTGCGGGGTCGAAGAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIII?<I7@ +@HWI-EAS91_1_30788AAXX:1:1:1073:668/1 +AGCATTTGGCAACCCCTACCTGCCAGAACTCTACTC ++/1 +IIIIIII""IIIIIIIIIIIIIII>I4@IIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1386:1163/1 +AGTTGGCGGAAAAGCAGCCATCAATTAAGAAAGCGT ++/1 +IIIIIII""IIIIIIIIIICII=GIIIII@IGIIII +@HWI-EAS91_1_30788AAXX:1:1:1196:344/1 +ATTGAAGGGAGTTGATTAGGGTATTTAGCTGTTAAC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII7 +@HWI-EAS91_1_30788AAXX:1:1:1551:1269/1 +ATTACCAGGATCCTAATAGGAGCCAATATCACCATC ++/1 +IIIIIII""IIIIIIIIGIIIIIIIIIIII@II4II +@HWI-EAS91_1_30788AAXX:1:1:928:468/1 +AGGAGATGGAAATTTTAACTTGGCGCTATAGAGAAA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIC<IHIII +@HWI-EAS91_1_30788AAXX:1:1:763:835/1 +GCTCAGAGGAAGCCAGAGAAGAAGAAGACTTCTGAG ++/1 +IIIIIII""IIIIIIIHIEFIIFI<IIIIIIDII:I +@HWI-EAS91_1_30788AAXX:1:1:1363:330/1 +TAGCCTCGGAGTTTTAGTAGAATGGCTGCTAGCACT ++/1 +IIIIIII""IIIIIIII@IIIIIIIIII5I,5C-75 +@HWI-EAS91_1_30788AAXX:1:1:1001:837/1 +ATACTATGGCTGTGAGGAATAATCATAACTAGTTCC ++/1 +IIIIIII""IIIII2IIIIIIIIIIIFIII:IIIII +@HWI-EAS91_1_30788AAXX:1:1:1189:616/1 +TTTGATAGGGTAAAACATAGAGGCTCAAACCCTCTT ++/1 +IIIIIII""IIIIIIIIIIIIIIIIICIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1212:634/1 +ATCAACAGGTATTCTGATTCTTCGGACACCCCGAAG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIAIIIIF(.I +@HWI-EAS91_1_30788AAXX:1:1:1271:421/1 +ACACGACGGCACCTAATGACCCACCAAACCCACGCT ++/1 +IIIIIII""IIIIIIIIIIIIIIII>C:IIIDI<II +@HWI-EAS91_1_30788AAXX:1:1:1582:328/1 +AGCATTAGGCTTTTAAGTTAAAGATTGAGGGTTCAA ++/1 +IIIIIII""IIIIII,IIIB;BI<IIIIII+IIIBI +@HWI-EAS91_1_30788AAXX:1:1:1133:687/1 +AGAGAGCGGATTAGGAATACGATTATTAGTGTGTGG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIII4III +@HWI-EAS91_1_30788AAXX:1:1:1231:662/1 +TCACTCTGGAGAACATATAAAACCAACATAACCTCC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIII?ICCIIIII +@HWI-EAS91_1_30788AAXX:1:1:1693:1140/1 +ATTGATAGGATGGGGGTTAGGGGGAGGAGTAGGGAG ++/1 +IIIIIII""IIIIIIIIIIIIIII:II5II7IIA-I +@HWI-EAS91_1_30788AAXX:1:1:867:279/1 +AAGCATTGGACTGTAAATCTAAAGACAGGGGTTGGA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1095:605/1 +AAGCAAGGGACTGAAAATGCCTAGATGAGTATTCTT ++/1 +IIIIIII""IIIIIIIIIIIIIIIEIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1650:1185/1 +ACCCCAGGGAACCCTCTCAGCACTCCCCCTCATATT ++/1 +IIIIIII""IIIIIIIIIIII6IIIIIIIII5I-II +@HWI-EAS91_1_30788AAXX:1:1:799:192/1 +AATGTTAGGGGTTAGCCGCACGGCTAGGGCTACAGG ++/1 +IIIIIII""IIIIIIIIII8IIIEIIIII<I::%II +@HWI-EAS91_1_30788AAXX:1:1:1082:719/1 +TCTTGAGGGTCTATGGTGCTGGTATGGGTTAATTTA ++/1 +IIIIIII""IIIIIIA8III>I92I3+3IIE0III< +@HWI-EAS91_1_30788AAXX:1:1:1746:1180/1 +AAAATTAGGGAGAAGTAATCTAGTTTGAAGCTTAGG ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIFIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:606:460/1 +TTAATTTGGATTATAATAACACTCACAATATTCATA ++/1 +IIIIIII""IIIIIIIIIIIIIIIIII?I6IIIII6 +@HWI-EAS91_1_30788AAXX:1:1:1059:362/1 +ATCGGTAGGCTCGTAGCTTCAGTATCATTGGTGGCC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIII2)</II +@HWI-EAS91_1_30788AAXX:1:1:1483:1161/1 +ATATGTGGGGGGTGGGGATGAGTGCTAGGATCAGGA ++/1 +IIIIIII""IIIIIIIIIIIIIIIHIAIIFIIIIIH +@HWI-EAS91_1_30788AAXX:1:1:1273:600/1 +TACTGAGGGGTATCCTGAGGTATGGGTGTCTAATAC ++/1 +IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII +@HWI-EAS91_1_30788AAXX:1:1:1190:1283/1 +TTTCTGGGGTACAAGACCAGGGTAATGTGCGATATA ++/1 +IIIIIII""IIIIIIIIIIIIIIIAIIIII-?IIIE diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_in4.fastqcssanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_in4.fastqcssanger Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,576 @@ +@1831_573_1004 +T00030133312212111300011021310132222 ++ +%><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050 +T03330322230322112131010221102122113 ++ +);@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, +@1831_573_1067 +T00023032023103330112220321200200002 ++ +.++#%(',%/$,+&1#&),)&+'*'*%#$&#%('$ +@1831_573_1219 +T11211130300300301021212330201121310 ++ +@@@=4/+)5)408?'665>*/5?<61';<3,:,5- +@1831_573_1242 +T02132003121011302100130302112221121 ++ +>>>::>17=A5?@@=;7A=;2.60>82<8=74+;; +@1831_573_1333 +T00200312330110101013212313222303112 ++ +)='@#%3=.>)/34*117,,/6-4+.9742456<) +@1831_573_1362 +T21203131001102231121211101111321131 ++ +CB@@?@@?@C@BA?@>@<@8A@?@'.8'?17:,+? +@1831_573_1448 +T23101211223113320132212331313312022 ++ +77=A)?,.@A@@:@@<=/7)@<-#8662%9613&+ +@1831_573_1490 +T31312310323301210002210123101021011 ++ +@@@@?,@??@$><=>+%/*>*1,)?26&12'9%7. +@1831_573_1523 +T10322001220012223202202222001230222 ++ +(,//*,#8''.6''6'2&27/80)%&#0'%#*,2' +@1831_573_1578 +T21202302100010020121100311022120111 ++ +@?=@<@C@?@@??=>@;7<<8<694)3511(+1<. +@1831_573_1647 +T10222233301013033120132223202022123 ++ +=?@@<@@???;A==@@;9?@?3=;6.4/;6:=/;4 +@1831_573_1684 +T13310013212312012302121010221231123 ++ +7>1:8<@39@@??9=;@@<>?@@<;<?7>76?9>? +@1831_573_1769 +T33220123030232212032021032302233131 ++ +754749&&767%/7;3$-7;3#,3//#,45/#&06 +@1831_573_1853 +T11000012111222211310103212122102331 ++ +64./B@@72B+/4?@?7?+@9/+99.')2<2&)2& +@1831_573_1943 +T20300123032210232001222122001132111 ++ +(>/*1,),@-)'0*>5'$/?6(a)/.&?8/(')A43, +@1831_573_1977 +T22212302221310332321002303112011311 ++ +@@?6@8@@9A@=4633A7?9?<3:+7>'@%@?%32 +@1831_574_109 +T13122332123301331032220222133301033 ++ +07651#4817>@65<2:84716=788<1995.7?6 +@1831_574_148 +T01200113123030012202302312200010231 ++ +<;->3;;3>//>0;;7=,=4-4/+>029<9<624; +@1831_574_185 +T21123333211302300321312212102123121 ++ +@<4;%%@7>#*>97%6;+8$#<07%1372$%<54# +@1831_574_243 +T30221011230013102201033131203302330 ++ +#@@@95@=9?*><45$<@<4%@9?7#=?>7&>?97 +@1831_574_257 +T00301133110002100302003000000102301 ++ +%>>B>)@?>B@B?@1%*%,#+00.'(+&5&%#$3& +@1831_574_293 +T23213210003000103010211331300320130 ++ +&')7'.*%#&$'/.$##$.$&*)+*$#8%&%#&&% +@1831_574_389 +T21032213032101122333230212301312020 ++ +))$>/>8):2@:213;;.1)@3%64%+)<7)+$92 +@1831_574_575 +T33313322100212102033032123311211302 ++ +7?@>=?@>8@@@=@6*%&<='5@<<',0<=4*5/< +@1831_574_592 +T33103330110123102223122023103310330 ++ +73-5)19,,<@>4067<2.-864346;9<1/;212 +@1831_574_617 +T20021031221222021210021322200223211 ++ +@>@?;>?=@==@>@=5?@+@:@40@><:0)')64- +@1831_574_725 +T32010020322130330333010031120313210 ++ +9'>?52+5=;4$6;<8.1<47*9+?7(+5;-).)4 +@1831_574_734 +T31132301200020012302210322213222222 ++ +.-&.$2&<*(-%):/)%5:)/%7+,9034*A.?70 +@1831_574_824 +T30212100033032123311211302122020013 ++ +;@@@;;),+@<-<7;<&89??&29?<$2:A<);8? +@1831_574_959 +T11212130220131221111002020123311211 ++ +7A=;+?@9;/<@;<8#&&/*%(%.0$0$2)+1$-1 +@1831_574_1062 +T30112230030300221001032033012211012 ++ +4@821<//:136/8<1/5.427.;>288/0<1$)/ +@1831_574_1092 +T02013221200031031212200000111130310 ++ +<8?.,98)03%#,,,(,++$'69'#9'7#';6.%2 +@1831_574_1103 +T20313113203302010303131123021310121 ++ +@??>?@=>@@A<>?=@==<:?<;58'&&):+35'1 +@1831_574_1116 +T21011310123202303021021112021231011 ++ +)(a)++,)/)?./)%<)2>.==:8?&;44&/&,)/*4 +@1831_574_1194 +T23303101033322220312200222013013312 ++ +:5>;,??9@9@?@1@@=@3=@>@4?@@94?75/,6 +@1831_574_1204 +T21330132231321322010303023221203200 ++ +AA5A5B@5:;@@,.9?A1?#.?;3),>82%)='7* +@1831_574_1306 +T10332133020311023221213100301001220 ++ +02.7&%''.$&#'%##$#'#%')')$'$%$,)'.1 +@1831_574_1387 +T12301331310032132101301303230121111 ++ +-?A??:@?@@9?@@?9C;:>&).,,);&'<&7(/' +@1831_574_1431 +T12011023331022213001123111301312011 ++ +>7?>9BA897;+8*=6#6.+5&-#26$0.,5&'$1 +@1831_574_1560 +T32212313302203320020222113111011111 ++ +=))&65<4=>99@:597(1&;+&(%&4#,#&&&*$ +@1831_574_1591 +T23202101330322130221230222201123202 ++ +==<A><?@78@<=;@&@6>8:?,><&&<7>8(8+9 +@1831_574_1624 +T20122200222132200313011102302210332 ++ +#<6.&(,7-+))7..'/;43.)927.(<85&13-) +@1831_574_1826 +T13012312120112021233030302313201111 ++ ++@<<,))459<?.+57'-'&6?1)(;1;0&%4,#$ +@1831_574_1903 +T30232100103132133321330310210101221 ++ +<956?@>;7@@@8:@>8><=9>9>@2=71?1:6;/ +@1831_574_1961 +T02333101331223303300200011100032200 ++ +6>-07-@>(2'@<#064@%5%@@6.&<<(9)=:47 +@1831_575_54 +T13331330322230200102132110132013200 ++ +>=@@68<2;<8;?@<>+9>7,,6972&57:4&9<8 +@1831_575_80 +T33133322233322221003332230323312313 ++ +*?5><@?/=5%(&.5)+#/0'/'>#$/'37#()6& +@1831_575_192 +T30013012111133003301010212123302011 ++ +0:8<,9(.=/)#%8$,4'<,:)3/.'.5<,>-;7' +@1831_575_197 +T33312113010133020301131330001310032 ++ +,-:?463@A:88?6?437<=.2&1.;@67.4@%2, +@1831_575_223 +T10121010002202131221210302100121020 ++ +@?>?8?@:?;>+$'%&,+#$.--#%$1'&#-7$&' +@1831_575_420 +T31110103220000101310112112001020212 ++ +82?.>?(-''2+..@),$%1@;')1)?+)7.').. +@1831_575_434 +T30312132120223101113223301211113311 ++ +<@@><@B@>=@@?>><@?;)@?;6.?=4,'';/3) +@1831_575_444 +T33022120112320220100202132332113320 ++ +<2@@;<.=?@<+=:A<<@?<</>@><(<8>4&5;> +@1831_575_459 +T31330310210101223330110231120131100 ++ +?@@C@?A@@A@??A@@'6@@B'=;C@'4<=9,@1. +@1831_575_506 +T31210200111210121332321310110132301 ++ +8?)2*5@3+.7=?A:8@,/&):@37/<89'+4*)* +@1831_575_569 +T10210201321323001012232322323002203 ++ +/'9-,@29+479%&>9#&08=>7#9>,69/+'*3) +@1831_575_622 +T01100031122111023002323113231210111 ++ +@A8B=@@?<@?<>>=?96<497)<4/<':4+;74+ +@1831_575_644 +T11332003221203131231202200030110130 ++ +<<8>.>&,+)8.10':5(/-62&*.=/%(.<&&18 +@1831_575_663 +T32210013303112103322311101322021210 ++ +@@@@@A</;A>@6>0792<5966:?;25+:><1,+ +@1831_575_681 +T23131132033020103031013233200101021 ++ +.72?.)25;96-14'*.03'#4#++$)/8+%/((& +@1831_575_711 +T03032331231101231020121210002332121 ++ +4%+:2(#'1+.)&*45-#,<A-%4;>+))<;##*& +@1831_575_730 +T31010102200110302123032330331011111 ++ +,%8<%-')5,*1&=#)(1*1)->7$.,4'4'&'*& +@1831_575_904 +T20111213300020123200333321131121211 ++ +?<><.689@@7@<54:4=@>69=:+6-=42;8<:# +@1831_575_938 +T13103102220022130222233301013033120 ++ +;:@@:?@;=8;>=;;:=<93<4.;<6:2<9;4)87 +@1831_575_970 +T23201311301023133303023011202220221 ++ +=@=@=;@@><@@:9<:=?;>@=?9>>?@:2===<5 +@1831_575_991 +T33312212031111111012212120321121210 ++ +@>>;7???/4<:::,#&*%'$--5-#(7)&&,-)% +@1831_575_1138 +T23320002011320012120333103233301321 ++ +<=0;%1936+?96?,?5<:2>@6@<:;4>.7;*:1 +@1831_575_1157 +T13121323330203331222022230133102321 ++ +@B@B>?A?A@?9'?;?&8?@@6;<@=+<:99+965 +@1831_575_1180 +T32003310122102323303101123331133110 ++ +/<B>5?':/78?;1;55:997@@>94=7<186->7 +@1831_575_1283 +T02232200301300220130032321323131333 ++ +%C@A54><?A78@<?2>:#>=?@2>80:'?69.'7 +@1831_575_1302 +T01201303312333123130200123201013021 ++ +&12>/#2'&-2&%'7+$%*#$/1(&&12/$,2,,* +@1831_575_1310 +T31332131312021303211310220101211133 ++ +6<<>663?99@(@7=11@:@@/7??<@<;>'3-7; +@1831_575_1321 +T11001010233200122122022023000203212 ++ +0;B@?@>=A@<A?>@>?6>@5>'4@9?)7@7?/89 +@1831_575_1373 +T21213011223311001221321132013121220 ++ +A@@@>@;=9<@??7@>@:@;@;17?630/7=4,2< +@1831_575_1419 +T33222200303001021230212332001013020 ++ +>//3->&-.->%11/@&/&7:<,-1=,+2<6'%&< +@1831_575_1436 +T13210313021212303321202113301220331 ++ +*2@=;39*3<*4<:>52>>9'7:<='0=>1'136< +@1831_575_1442 +T33132010022331132101132123132020222 ++ +8>58<?7>+1B6-/9<<:5?>A:1@?539.@4/1> +@1831_575_1454 +T11131130011012021120222231313211113 ++ +24=?8=6589=0:A=:?>6<;@/,4+-6+/'.,(, +@1831_575_1500 +T11010000223111301132313011130103021 ++ +2?@@?A@?8<6<:985=99999==B3<5<<,7?>9 +@1831_575_1535 +T21312012030320112110211013300131121 ++ +@B=@<@@B?:A@@=>@?68@=?@5?7;:6<<;>5< +@1831_575_1724 +T33123002323300220213232301000010010 ++ +9<B.+@),2*.%)))4%2@;7#%(%+$8))85%&5 +@1831_575_1829 +T21033321320111321230233302313101021 ++ +22(*'%.3$+7)@&%$'3*+*#/#/*+0.=&#)+0 +@1831_575_1898 +T31330110303103131001110300102101330 ++ +@B>@@&1/))'40)%#8/.%#8$((#;4'$'63,, +@1831_575_1964 +T22010201103202213200201301300232123 ++ +1>39)@2<2/@+9?2=&)>>@*62=5&2<42.'?+ +@1831_576_32 +T13012100120333032211330300332022110 ++ ++<>?>?=7<2)522;><<@40@>704<>5=23@+& +@1831_576_74 +T30103313210232220102021223012112100 ++ +8=@@?@>(??<B5?@@@9<@><+><;@';>6961? +@1831_576_86 +T10320000121033022010011030032211310 ++ +7811)2:*.++5</:3+43924*))/:,6&29)2/ +@1831_576_89 +T02132333203332020020220033002121120 ++ +2)69+,'.4=-,>/>(*$#)3030*'(,%)2##$, +@1831_576_266 +T30322223101312011300311121221333223 ++ +<@@?=;<?7=@>9,>@1$&&89$/:>7'3178%&6 +@1831_576_327 +T22112331301313021321001332120332130 ++ +<@?@6@@;<@?><@>==3@:==<3@@>53<9><6= +@1831_576_331 +T32012133301311223023011232112333030 ++ +;-2)+(*.*1/;5%.-9&#/1'+($*$##()%/$. +@1831_576_387 +T00101211032031120300200222001230022 ++ +/8).$5#1#*%.$##.*#$%##-%,+,1#&%.%)) +@1831_576_406 +T00223133010210122221320212103132011 ++ +<4<>%%14:*4656)&<251&2+3#&19,6&4>5( +@1831_576_449 +T31312001121222231100020132132100220 ++ +(+'&'.,,$/+.)$$8&%#+?&,#)-&###7,+#* +@1831_576_519 +T03011321130130133213131202130321131 ++ +==46<97@>2/6?;2<4A881>9121+<1/4.9+7 +@1831_576_603 +T21003032313302312320131221001330311 ++ +@@46=@C.??<A79@@;-<@@>29B?>55<B7598 +@1831_576_655 +T02001023130302322122200313123123102 ++ +=@AA9@@<6*>@@5/<@>9'=;>7+@?9>/9;+,% +@1831_576_677 +T13330131023320301031013230210103022 ++ +6290&/*0#&'&,.2'#&*$&('#-%($*#%$)#% +@1831_576_718 +T31232113331022231333313223132231213 ++ +$4###$0###%(#########,####%####$### +@1831_576_722 +T31230320322120231333030031100313200 ++ +(*,-,##.)*&(*1%*(%(-2#+)-#.&-#%%$') +@1831_576_754 +T30221231132103120112331303112133020 ++ +.4//#(.$)'',>(&#1$<,##%((,#5?#0*%1* +@1831_576_815 +T23022113203032010120310102321001031 ++ +<3>@?9>@?B=>=;>A???=>:25=4.25?6<57. +@1831_576_882 +T13230020122320223230022031020110122 ++ +?26?8?@:4>@>96??<<=5'1<>9846=<9<1>8 +@1831_576_898 +T10230132312121033222231132231233213 ++ +=@@C2?C>?<>@886B?;?.??87=B<8<15??=. +@1831_576_923 +T21322010320202013210121223010123122 ++ +76.51=;.699<96>;;49<;;11;<@59:9=647 +@1831_576_930 +T21322103230123110323102012021020013 ++ +2#*0.2&.:((#'14'##-)#%$$2%#$/1&#%/# +@1831_576_1019 +T22032121213231032210312001103122312 ++ +2<$>$,1,&++&@,.)'+/+#9'69/6'2(+-'9- +@1831_576_1068 +T00020232013101330112220321203220211 ++ +:>><=4?;@7=??9?;9>5@9?:8@:=5';7;'#4 +@1831_576_1131 +T10233122200222132200313011102302210 ++ +104@#@/@,4>9?2+?1571@',>=;(759;*92< +@1831_576_1168 +T31013300131121323122002113301002010 ++ +>@CC6@@2?9=>7?;76<;467@;9,0%26'',4$ +@1831_576_1207 +T21001132013000122220301213221213010 ++ +%$>2,(&?4?(,@:<&,@>?$&:8A%%=0.%,597 +@1831_576_1289 +T03021210023110200323310302013121203 ++ +@9<>1B@@;7@@663==28,5':8<<,.=2>>.50 +@1831_576_1329 +T01100302102020113003022000120002100 ++ +<>&0,870/A@@/5.;=;:'&@3'&$$%,+#($&2 +@1831_576_1367 +T12231310311233110031222013332011023 ++ +??@@<>@@=@<@<=@>@??9:?<=>=<8;59@787 +@1831_576_1416 +T33021233100123120313103133211203221 ++ ++';?..1.<@'.=+6.5?7<0-?7;(%=>56.98@ +@1831_576_1461 +T32022221221112233100210223002100100 ++ +#1&74#(#(&##$#,'###%#%%#*#&%%##%%%' +@1831_576_1605 +T30232100103132133321330310210101221 ++ +6<@C@@>1;@:;<<@@9@???9<3?5-21=4877, +@1831_576_1664 +T31212101001312110320301201002011120 ++ +@@?>?@=A:@@>@='=<>=).>=9*8)(7#/++;) +@1831_576_1671 +T22313332300211322113223102231322313 ++ +@@?@5>@@8&8?25#&)&5&&)15&&,&4%&,&6% +@1831_576_1729 +T11233312313010012320101302101023030 ++ +@?@?<?<@>A?/==?>?7>?@8<?@>99;><+0=> +@1831_576_1880 +T13032121323320213301001310130212003 ++ +0515/792,:,7/%/05,%$):+#8%2(1754))3 +@1831_576_1982 +T00032312310201201333221212000011030 ++ +,@@?@,A><@9@=?@9B=8<6@@6@2<A?>.7<+@ +@1831_576_1987 +T30022313313231221213220132001011320 ++ +)##()(#&##)%)/-#%$11#%3>'##&$,#$$'+ +@1831_576_2014 +T31123201010100321122111102113021003 ++ +@@@9,B29-5>'?,+?79+/A';'2@'5&/9,6&1 +@1831_576_2028 +T20131211210311112023201213120201100 ++ +5<>9>5'2(&707.8#&&39,0%7/#(#,*%&5*+ +@1831_577_40 +T11111212330120012020200031313303003 ++ +92/4('.')(<*?#$)%&<,/39<(.2,+<=@611 +@1831_577_119 +T33111010021103320103213121313000102 ++ +9>?C11)-1/)#;#/,850*+.+$$5550+%-.40 +@1831_577_133 +T33213323012231300122223032223331322 ++ +/4@>>?=1?:+>@07@@><>@*<+1@15)96'2$) +@1831_577_255 +T00332022110020300332022020202002232 ++ +7<=87@>69%**#&#-+$.#&&#+$-+%&%.,%5# +@1831_577_281 +T03032301231212301013112222111210000 ++ +7-:B;8@=;>7@>4?=?+659?;5<7?;9@8(>:? +@1831_577_288 +T01031120221303100221230021013201130 ++ +5;/79??&=B::298*6.7/+4&21,7,6?.7#'6 +@1831_577_322 +T12003213220230103303201000130312202 ++ +9=;>4506;255464-<#7+194&2<?65968)7/ +@1831_577_362 +T31203302330110131230331210121110220 ++ +62B?:@?@<?958=,3:,90:&'-99,6<5.($+6 +@1831_577_382 +T32312123033111120321303230201332100 ++ +12957/:1))=76(*24;,3+:<.&.&-=1=2/5* +@1831_577_464 +T13020221011130013102221333131203302 ++ +3=<7/<826)>#.'&4204+5#/041.7*91&756 +@1831_577_488 +T13200302330322110200323132101120301 ++ +:48.,*>6566<?8=<=<2>6;94>;=9>@8924@ +@1831_577_511 +T32232133031023313331312220133230333 ++ +#7/+&$:<7%6,$$%'%/+)#$7((&*3>16'0/+ +@1831_577_545 +T00112131333222303222210031322103233 ++ +>><<9?<>?A<481@<@8==@76/61<95.5988- +@1831_577_559 +T32321101303233120102011130022122002 ++ +.<@;??@>@?/2<.@1=>12=61/;=?.&2+92)' +@1831_577_562 +T32331101301233110121000220031120031 ++ +#((&*&0%)1%)#($2-,***%/-,,))&,-.1'* +@1831_577_637 +T22113312122202103031023120301031110 ++ +8-,4#>:-6+:8,&(5;3=0>7=68&1/9&'?;4, +@1831_577_641 +T13031301101121223221212020032131113 ++ +&47;/':A;;5?:72,(=),#*?+.#&7$8#%7/' +@1831_577_692 +T01122320200330103121202301211100220 ++ +@B,@?@B(@A?@+@@>@+?=>@'=<@<=<9=?75< diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_in5.fastqcssanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_in5.fastqcssanger Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,48 @@ +@853_60_741/1 +G31030031122312021111010130200021003210121320000223 ++ +==9:>>=;><9;=<<>;><>>;?<=?:>?><=>?9<>=<9=;<?=>>><9 +@853_111_1583/1 +G21011211200202112131111130201231220231231220200322 ++ +:A<A>>>;=<;=<@A;?<<@<>?@><99A=<7=;=:6;<<:9::<;89=< +@853_111_1628/1 +G10102021032020010121032020232110130223102122302200 ++ +?;<<>;=<=>?8;>9>;<><=9;<;=<5<><;8=>?978<=8;;8<8:;: +@853_276_1541/1 +G03222011023120123332203020012312001121123311001231 ++ +=<><;A<<>@<@<<?:<:<>=:<==;?<<<<:>=A?;==;==;<@;;8:< +@853_394_432/1 +G13312311132110330003300222221112131200021120330332 ++ +@=>@A<?>>==?A?<??=@?>?=?><?=?=:@?=?==A=<;<<@=<<>=5 +@853_460_1442/1 +G02101122101002202021313212112232110310010223211122 ++ +>??:?>@>A=?=:>A>>9?><==A>>>=?>;==:>>>;:;==:<;>;9<= +@865_1106_310/1 +G01222230300213322221202031001001030210000110220102 ++ +;6?;=>=:9>:=<:<>:<;<>;?;>>;<<<>9><>:9===?<6<::5:;; +@869_1532_1255/1 +G21022233110003122233210021301222000112122113330022 ++ +=;8:?@=?;;9:8;=>;5A?;<8><<=:9><;9<=8;96>8<5==:<98; +@889_1337_1562/1 +G32320230101133233031203331023110123123110321101011 ++ +==?@=@??@?=@>==;?=>=;;?>=<;==<=:A;<<<=7=8:;==6<>=; +@891_252_1590/1 +G21001002321200302231203001233020201230020220002300 ++ +<A>9<=9A;A><>>>;>@?A>9=;@>@>?<><@>@@<;=;8:7>:;:5=< +@892_582_183/1 +G01101032230201131100203303123121133333011110033000 ++ +;><:><=>;<<>:=>?>>;<=;:9><<:=:>;:;>;:=9;;=799<7699 +@932_1836_1806/1 +G32331100031222332100213012220001121221133300220331 ++ +;:<;<;<><;>9@=<=<:>A:8<<=<=?<:@?<=?<;>9;<6<><<::5> diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_in6.fastqcssanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_in6.fastqcssanger Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,48 @@ +@853_60_741/2 +T30321031112011000112320211202221320221313213231311 ++ +99?;>=;?>:>=>:<>>?85>=<;:><995@::<7@<=88==>;=?>>9< +@853_111_1583/2 +T10022103103000201030021103111120021021121130210022 ++ +?;<<>;=<=>?8;>9>;<><=9;<;=<5<><;8=>?978<=8;;8<8:;: +@853_111_1628/2 +T33002021100103231100332001320020101002002311222011 ++ +><@A>=>;>?A<A:<;???@==>;?>>?8?<8;:@?=<;6>6<;;9=?<5 +@853_276_1541/2 +T30303002200001133331103221321130031333013232132322 ++ +A?:5A<?:=A>A8@8AA:@:<@97<@@@>A7?@6?@;8?A7@986;5;?= +@853_394_432/2 +T30030000333322020222202211233333002103312202000110 ++ +:<:=>:?><==>=><<=><:;>=;:;9;><9<><@8;:;>=;:7:>7:7= +@853_460_1442/2 +T11130211103112102212221200202022130303003210122101 ++ +>A=:>@@==>@>=<<>?9>>=;9<<==:<<;>8;;;<<<:<:7=95>:;9 +@865_1106_310/2 +T33223200002331021122331020030003301230300213231311 ++ +?@@=?A>A>==:=;=????A<;;>A<<?=>?<@<=@9:>9>:56A<;;9; +@869_1532_1255/2 +T03103330303100300112231121121003120312113022230331 ++ +@A=><>9=<@>;<;<==?;?<A=?<=<<:A>7>9:;:<=7:8@6><>96< +@889_1337_1562/2 +T10031203121130222303312100203132322201123110000101 ++ +=A;A@>AA@>?>A@>A:>@:<>>=5;;=;<;88?=>5=;899:9<<;>98 +@891_252_1590/2 +T03210330303300030311113131021332033110001211222031 ++ +8;8?;><::;9;:>;><:>9=8;68:<?<;=@===<=>9=:>A9=89;== +@892_582_183/2 +T20322002021213100112021203203010031223003101212213 ++ +@?=?@>A?>>>??>A;@>?==>>@<>??><<>>::=?:=?=;6<>=<>=< +@932_1836_1806/2 +T03233010131101303202311220122201011323220123130010 ++ +AA<?A@AAAA>?A>A@=>@>A>??A@?>>@>@=>A9?>:?>8@@=>>=>@ diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_out1.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_out1.sam Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,33 @@ +HWI-EAS91_1_30788AAXX:1:1:1761:343/1 65 PHIX174 5 255 50M = 69 64 TTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGA IIIIIII""IIIIIIIIIII?I0IIIIHIIIGIIIII0II?I""IIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1761:343/1 129 PHIX174 69 255 50M = 5 64 TTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGG IIIIIII""IIIIIII0II?I""IIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1578:331/1 65 PHIX174 209 255 50M = 268 59 TGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1578:331/1 129 PHIX174 268 255 50M = 209 59 AAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGAGATTCTCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1647:512/1 65 PHIX174 401 255 50M = 451 50 TACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1647:512/1 129 PHIX174 451 255 50M = 401 50 TTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1570:620/2 0 PHIX174 559 255 50M * 0 0 CTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCT IIIIIII""IIIIIIIIIIIIIBIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1599:330/1 65 PHIX174 803 255 50M = 868 65 AGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAGTGATGTAATGTC IIIIIII""IIIIIIIIIIIIIIIIIII<III@II"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1599:330/1 129 PHIX174 868 255 50M = 803 65 TTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCA IIIIIII""IIIIIIIIIIIIIIIIIII<III@II?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1652:270/2 0 PHIX174 973 255 50M * 0 0 GCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII6II?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1746:351/1 0 PHIX174 1218 255 50M * 0 0 CTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1582:633/1 0 PHIX174 1517 255 50M * 0 0 CCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCAC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1598:534/1 65 PHIX174 1717 255 50M = 1772 55 GCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1598:534/1 129 PHIX174 1772 255 50M = 1717 55 TTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:324/2 0 PHIX174 1972 255 50M * 0 0 GCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGT IIIIIII""IIIIIIIIIIIIIIIIIIII+7I05I?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1749:466/1 65 PHIX174 2201 255 50M = 2251 50 TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1749:466/1 129 PHIX174 2251 255 50M = 2201 50 GCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1629:446/1 65 PHIX174 2301 255 50M = 2355 54 AGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1629:446/1 129 PHIX174 2355 255 50M = 2301 54 CAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCAGA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1763:587/1 65 PHIX174 2501 255 50M = 2566 65 AAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1763:587/1 129 PHIX174 2566 255 50M = 2501 65 CATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1616:363/1 65 PHIX174 2718 255 50M = 2773 55 TGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1616:363/1 129 PHIX174 2773 255 50M = 2718 55 GTGACTATTGACGTCCTTCCCCGTACGCCGGGCAATAATGTTTATGTTGG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIDIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1768:715/1 65 PHIX174 3118 255 50M = 3173 55 ACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCT IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1768:715/1 129 PHIX174 3173 255 50M = 3118 55 AGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGATA IIIIIII""IIIIIIIIIIIIIDIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:270/1 65 PHIX174 3518 255 50M = 3577 59 TGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTA IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1572:270/1 129 PHIX174 3577 255 50M = 3518 59 ACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIII?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 65 PHIX174 3818 255 50M = 3873 55 TATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCT III""""""IIIIIIIII""FI"IIII""II+ICI"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1785:1272/1 129 PHIX174 3873 255 50M = 3818 55 GACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCGTC III""""""IIIIIIIII""FI"IIII""II+ICI?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1673:514/1 65 PHIX174 4018 255 50M = 4072 54 ATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1673:514/1 129 PHIX174 4072 255 50M = 4018 54 GCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII1?I0IIIIHIIIGIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1634:330/1 65 PHIX174 4418 255 50M = 4473 55 GGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATG IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II"IIIIIII000IIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1634:330/1 129 PHIX174 4473 255 50M = 4418 55 TCAAGATTGCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTAT IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8II?I0IIIIHIIIGIII NM:i:0 diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_out2.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_out2.sam Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,98 @@ +HWI-EAS91_1_30788AAXX:1:1:1513:715/1 16 chrM 9563 255 36M * 0 0 CTGACTACCACAACTAAACATCTATGCCCAAAAAAC I+-II?IDIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1698:516/1 16 chrM 2735 255 36M * 0 0 TTTACACTCAGAGGTTCAACTCCTCTCCCTAACAAC I9IIIII5IIIIIIIIIIIIIIIIIII""IIIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1491:637/1 16 chrM 10864 255 36M * 0 0 TGTAGAAGCCCCAATTGCCGGATCCATCCTGCTAGC DBAIIIIIIIIIIIFIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1711:249/1 16 chrM 10617 255 36M * 0 0 ACCAAACAGAACGCCTGAACGCAGGCCCCTACTTCC IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1634:211/1 0 chrM 9350 255 36M * 0 0 GAAGCAGGGGCTTGATACTGACACTTCGTCGACGTA IIIIIII""IIIIIIIIIIIIIIIIIIIIII9IIDF NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1398:854/1 16 chrM 3921 255 36M * 0 0 CACCCTTCCCGTACTAATAAATCCCCTCCTCTTCAC IIIII=AIIIIIIIIIIIIIIBIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1310:991/1 16 chrM 10002 255 36M * 0 0 CTCCTATGCCTAGAAGGAATAATACTACCACTATTC I:2IEI:IIDIIIIII4IIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1716:413/1 0 chrM 6040 255 36M * 0 0 GATCCAAGGCTTTATCAACACCTATTCTGATTCTTC IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1630:59/1 16 chrM 12387 255 36M * 0 0 TCATACTCGACCCCAACCTTACCAACCCCCCGCTCC FIIHII;IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1601:805/1 0 chrM 12584 255 36M * 0 0 GAAAACAGGAAAACAATCCAGTCACTTACCCTATGC IIIIIII""IIIIIIIIIIIIIIIIIIIIIII@III NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1663:724/1 0 chrM 15012 255 36M * 0 0 GTTTGCCGGCGCCATCCTACGCTCCATTCCCAACAA IIIIIII""IIII8IIIIIIHIIII6IIIII1CI=3 NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1454:975/1 16 chrM 8929 255 36M * 0 0 TGGCTTCTTCTGAGCCTTTTACCACTCCCGCCTAGC IIIIIII;GIEIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1461:255/1 0 chrM 12988 255 36M * 0 0 GTACACCGGCGCCTGAGCCCTACTAATAACTCTCAT IIIIIII""IIIIII9IIIIIIEI(II9.I4III,I NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1775:764/1 0 chrM 16613 255 36M * 0 0 GCATCCCGGTAGATCTAATTTTCTAAATCTGTCAAC IIIIIII""III@IIII+IIIIII8H8IIIIIIICI NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1269:520/1 16 chrM 11036 255 36M * 0 0 CGACAAACCGATCTAAAATCACTTATTCCATACTCC IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1303:1162/1 16 chrM 14866 255 36M * 0 0 AAAGACATCCTAGGACTCCTCCTCCTGCCCTTGCTC I6I3,'94IIAI(IAIGI*4IIFIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1090:409/1 16 chrM 15014 255 36M * 0 0 TTGCCTACGCCATCCTACGCTCCATTCCCAACAAAC I8AII:IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1336:1000/1 16 chrM 11616 255 36M * 0 0 GATCTAGAAACAGAAACTTAATATTTCCCATTTACC II9IIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1199:1376/1 16 chrM 14023 255 36M * 0 0 AAACCCCCATAAATAGGTGAAGGTTTTCCAGAAAAC III/:&GII3III;IIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1598:1148/1 16 chrM 2334 255 36M * 0 0 AAATATATAATCACTTATTGATCCAAACCATTGATC IIIIIHI=IICIII?IIIIIIDIIIII""IIIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1723:1459/1 16 chrM 15787 255 36M * 0 0 ATCCTCGCTCCGGGCCCATCCAAACGTCCGGGTTTC I=II-IIH9IIIIIIIIIDIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1442:1346/1 16 chrM 9331 255 36M * 0 0 CAGCCACCACTTCGGATTCGAAGCAGCCCCTTGATA &,*II-<?<II4I(I1IIIIIDIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:850:117/1 16 chrM 5540 255 36M * 0 0 CCCATGCATTCGTAATAATTTTCTTTACCGTCATAC ?:;I9DDIBEIIIIIIIIEIEIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:795:325/1 16 chrM 4249 255 36M * 0 0 AAACTTGGACTCACACCATTCCACTTCCCAGTACCC IIII56IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:873:453/1 16 chrM 3188 255 36M * 0 0 ATCTCATACGAAGTAACTCTAGCAATCCCCCTACTC I=IIIIIII@IIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1285:1334/1 16 chrM 2389 255 36M * 0 0 GGGATAACAGCGCAATCCTATTCCAGACCCCATATC I8IIIII8IIIIIIIIIIGIIBIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:905:406/1 0 chrM 2844 255 36M * 0 0 GAAAAGTGGTAGGCTATATGCAACTTCGCAAAGGAC IIIIIII""IIIIIIIIBIIIIBIIII=I@96D2*I NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1774:595/1 16 chrM 7398 255 36M * 0 0 CTTTGACTCCTACATGATCCCCACATCCCACCTAAA IEIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1694:931/1 16 chrM 1503 255 36M * 0 0 TTACCTAAAAACTACTCAATTCTAATGCCAATTTAA III,HIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1092:1151/1 16 chrM 7564 255 36M * 0 0 GACGCTATCCCTGGGCGCCTAAATCAGCCAACTCTC 5III@6IIIII>III5IIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:803:557/1 16 chrM 893 255 36M * 0 0 GCTTAATTGAATCAGGCCATGAAGCGCCCACACACC 604III?IIII<IIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1315:1200/1 16 chrM 14035 255 36M * 0 0 ATAGGTGAAGGTTTTGAAGAAAACCCCCCAAAACTA I;IIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:765:358/1 16 chrM 11086 255 36M * 0 0 AGCCCTAGTAATCGTAGCCGTCCTCATCCAAACACC I1'=D0I@4IIAIIDIIIIIIIIIIII""IIIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1425:1167/1 16 chrM 3841 255 36M * 0 0 TGCTACCGAATTACACCATGTCCTACACCTAAGGTC GI+II%(IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1775:635/1 16 chrM 8752 255 36M * 0 0 CTTTAACTCAACCTTACTTCTAGCTATCCGGCTATT IBIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1433:749/1 16 chrM 10784 255 36M * 0 0 TTCCTATGACTAGCATGTATAATAGCACCCATAGTC E9I/BIIIICIIIIIFIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:798:247/1 16 chrM 13560 255 36M * 0 0 TCACCCTTACCCTAAGCATACTACTTTCCAATCTCC IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1249:1238/1 16 chrM 7971 255 36M * 0 0 GAAAATCTATTCGCCTCTTTCGCTACCCCAACAATA @IIII7IIIDCIIIIBIIIIIIIIIII""IIIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1043:1104/1 16 chrM 9689 255 36M * 0 0 ATTCGACTTAGAAATTGCCCTCCTATTCCCCCTTCC ,CIII.II0I<IFI;IIIIIDIIIIII""IIII&II NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1655:1058/1 0 chrM 6591 255 36M * 0 0 AAAAATCGGCTTTACAATTATATTCGTAGGGGTAAA IIIIIII""IIIIIIIIIIIIIIIIFIII6AIIIGI NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1764:1403/1 16 chrM 14239 255 36M * 0 0 TTTATTGACCTACCAGCCCCCTCAAACCCTTCATCA IIIIIBIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1632:34/1 0 chrM 11721 255 36M * 0 0 AGGATAGGGGCTATCCGTTGGTCTTAGGAACCAAAA IIIIIII""IIIIIIIIIIIIIIIIIIIFIIIH:6I NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1367:1208/1 0 chrM 3678 255 36M * 0 0 GACACGTGGCACTTCCAATCATACTATCCAGCATCC IIIIIII""IIIIIIII:IIII8IIEIIII-IAIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1778:108/1 0 chrM 11457 255 36M * 0 0 AATACACGGACCATATCAACAGCATTAAACCTTCAT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIIII@I NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1152:1115/1 16 chrM 10902 255 36M * 0 0 CCATTCTACTAAAACTAGGAGGCTACGCCATACTAC 'AIII7=IIDIII86.IIIIIIIIIII""IIIIII7 NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1165:1121/1 16 chrM 9810 255 36M * 0 0 GAATGAACCCAAAAAGGACTAGAATGACCTGAGTAT AIIIIII?22IIIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1500:55/1 16 chrM 10669 255 36M * 0 0 AGGTTCCCTCCCACTCTTAGTTGCACTCCTCTCTAT IIII<IIICIIIIIIIFIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1142:1196/1 0 chrM 15275 255 36M * 0 0 TCATTTTGGTACCACTCGCAAGCACCATCGAAAACA IIIIIII""IIIIIIIIIIIIIIIII@I=I79I6II NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1693:757/1 0 chrM 7018 255 36M * 0 0 AAATTATGGGTTAAACCCCTATATACCTCTATGGCC IIIIIII""IIIIIIIIIIIIIBIDIIIII0II-IG NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1364:1053/1 16 chrM 4697 255 36M * 0 0 TCCCCCCACTATCAGGATTCATACCCACCTGAATAA 5=4&G13I.?IIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1450:1443/1 0 chrM 9111 255 36M * 0 0 GTAAAAAGGTGCTCCAAGGCCTATTCATCACAATTT IIIIIII""IIIIIIIIIIIIIIIIIIIIEIB8III NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1701:1298/1 16 chrM 14463 255 36M * 0 0 CTGCCTCTTCATTCACGTAGGACGCGGCCTCTACTA IGIII;II8IIIIIIIIIIIIIIIIII""IIIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1729:856/1 0 chrM 10731 255 36M * 0 0 TCCTATTGGTTCAATACTGAAACCAAGCACTACCCG IIIIIII""IIIIIIIIIIIIIIIIFIIIII@IIIH NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1748:933/1 0 chrM 6379 255 36M * 0 0 TGAGCTCGGGGCTTCATCTTCTTATTCACAGTAGGA IIIIIII""IIIIIICIIIIIIIIIIIIII@II5@F NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1662:1296/1 0 chrM 96 255 36M * 0 0 TTAGTTAGGAATAGAATTACACATGCAAGTATCCGC IIIIIII""IIIIIIIIIIIIIHIIIEI5IIIII4I NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1393:345/1 16 chrM 1499 255 36M * 0 0 AAATTTACCTAAAAACTACTCAATTCTCCTGTAAAT IIIIEII+EIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:943:780/1 16 chrM 10597 255 36M * 0 0 TATCATCACCCGCTGAGGCAACCAAACCCAACGCCT HI<II;IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1639:968/1 0 chrM 4742 255 36M * 0 0 AGCTCACGGAAAATAGCAGCATCATCCTCCCCACAC IIIIIII""IIIIIIIIIIIIIIIIIIIIIII8I:I NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:589:1114/1 16 chrM 6809 255 36M * 0 0 CTACAGTAGAATTAACCTCAACTAATCCCGAATGAC )II&IIIIIIIIIII1IIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:763:408/1 0 chrM 10391 255 36M * 0 0 GCCCCACGGCTGGTGTTGACAACATGACTACTGCCA IIIIIII""IIIIIIIIIIIIII=I*5II<II'II( NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:950:352/1 0 chrM 6695 255 36M * 0 0 ACGCATAGGCAACATGAAATACCATCTCATCCATAG IIIIIII""IIIIIIIIIIIIIIIIIIIFIIIIIGI NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1164:103/1 0 chrM 1159 255 36M * 0 0 TTAACTAGGACATTCACCAAACCATTAAAGTATAGG IIIIIII""IIIIIIIIIIIAII=IIB58I=<I;II NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1078:1202/1 16 chrM 492 255 36M * 0 0 AAACTGGGATTAGATACCCCACTATGCCCAGCCCTA IIIEIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1617:490/1 0 chrM 12295 255 36M * 0 0 AATCCTTGGTAACCGCATCGGGGATATCGGCTTCAT IIIIIII""IIIIIIIIIIIIIIIIIIIIIIII:(D NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:843:504/1 0 chrM 6703 255 36M * 0 0 ACAACATGGAATACCATCTCATCCATAGGATCTTTT IIIIIII""IIIIIIIIAIIIIII>IIHI=IIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:942:318/1 0 chrM 3080 255 36M * 0 0 TTCATACGGGCCATGTCCAGCCTAGCTGTCTACTCA IIIIIII""IIIIIIIIIIHIIIIIIIIIII<IIIF NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1719:283/1 16 chrM 2261 255 36M * 0 0 CAGCAATTTCGGTTGGGGTGACCTCGGCCAACAAAA IIIIGI2=3IIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1517:961/1 0 chrM 9916 255 36M * 0 0 TGTCACTGGTCCATATTAATATCTTCCTAGCATTCA IIIIIII""IIIII=III9I@IIIIIIIBIIEIII> NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1482:345/1 16 chrM 8764 255 36M * 0 0 CTTACTTCTAGCTATAGGGCTATTAACCCACATCCT IAAIIHAI?IIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1697:533/1 16 chrM 8450 255 36M * 0 0 TAACATTACCGCCGGACACCTCCTAATCCACCTCAT IIIII>1IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1159:1225/1 0 chrM 8346 255 36M * 0 0 TTTCTACGGCAAGGGACGCCCATTTTCCTCATCCCC IIIIIII""IIIII=I7IIII3IIIIIIII/ID@II NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:982:332/1 16 chrM 6016 255 36M * 0 0 TTCTTCGACCCCGCAGGAGGAGGGGATCCAATCCTT @7I<?IIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:0 +HWI-EAS91_1_30788AAXX:1:1:1073:668/1 0 chrM 3502 255 36M * 0 0 AGCATTTGGCAACCCCTACCTGCCAGAACTCTACTC IIIIIII""IIIIIIIIIIIIIII>I4@IIIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1386:1163/1 0 chrM 1616 255 36M * 0 0 AGTTGGCGGAAAAGCAGCCATCAATTAAGAAAGCGT IIIIIII""IIIIIIIIIICII=GIIIII@IGIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1196:344/1 16 chrM 5155 255 36M * 0 0 GTTAACAGCTAAATACCCTAATCAACTCCCTTCAAT 7IIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1551:1269/1 0 chrM 11375 255 36M * 0 0 ATTACCAGGATCCTAATAGGAGCCAATATCACCATC IIIIIII""IIIIIIIIGIIIIIIIIIIII@II4II NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:928:468/1 0 chrM 1192 255 36M * 0 0 AGGAGATGGAAATTTTAACTTGGCGCTATAGAGAAA IIIIIII""IIIIIIIIIIIIIIIIIIIIC<IHIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:763:835/1 16 chrM 8908 255 36M * 0 0 CTCAGAAGTCTTCTTCTTCTCTGGCTTCCTCTGAGC I:IIDIIIIII<IFIIFEIHIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1363:330/1 16 chrM 10891 255 36M * 0 0 AGTGCTAGCAGCCATTCTACTAAAACTCCGAGGCTA 57-C5,I5IIIIIIIIII@IIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1001:837/1 0 chrM 10991 255 36M * 0 0 ATACTATGGCTGTGAGGAATAATCATAACTAGTTCC IIIIIII""IIIII2IIIIIIIIIIIFIII:IIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1189:616/1 0 chrM 3753 255 36M * 0 0 TTTGATAGGGTAAAACATAGAGGCTCAAACCCTCTT IIIIIII""IIIIIIIIIIIIIIIIICIIIIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1212:634/1 0 chrM 6053 255 36M * 0 0 ATCAACAGGTATTCTGATTCTTCGGACACCCCGAAG IIIIIII""IIIIIIIIIIIIIIIIIIAIIIIF(.I NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1271:421/1 0 chrM 8630 255 36M * 0 0 ACACGACGGCACCTAATGACCCACCAAACCCACGCT IIIIIII""IIIIIIIIIIIIIIII>C:IIIDI<II NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1582:328/1 0 chrM 7752 255 36M * 0 0 AGCATTAGGCTTTTAAGTTAAAGATTGAGGGTTCAA IIIIIII""IIIIII,IIIB;BI<IIIIII+IIIBI NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1133:687/1 16 chrM 7122 255 36M * 0 0 CCACACACTAATAATCGTATTCCTAATCCGCTCTCT III4IIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1231:662/1 0 chrM 13783 255 36M * 0 0 TCACTCTGGAGAACATATAAAACCAACATAACCTCC IIIIIII""IIIIIIIIIIIIIIIIII?ICCIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1693:1140/1 16 chrM 4932 255 36M * 0 0 CTCCCTACTCCTCCCCCTAACCCCCATCCTATCAAT I-AII7II5II:IIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:867:279/1 16 chrM 5309 255 36M * 0 0 TCCAACCCCTGTCTTTAGATTTACAGTCCAATGCTT IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1095:605/1 0 chrM 23 255 36M * 0 0 AAGCAAGGGACTGAAAATGCCTAGATGAGTATTCTT IIIIIII""IIIIIIIIIIIIIIIEIIIIIIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1650:1185/1 0 chrM 14956 255 36M * 0 0 ACCCCAGGGAACCCTCTCAGCACTCCCCCTCATATT IIIIIII""IIIIIIIIIIII6IIIIIIIII5I-II NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:799:192/1 16 chrM 8421 255 36M * 0 0 CCTGTAGCCCTAGCCGTGCGGCTAACCCCTAACATT II%::I<IIIIIEIII8IIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1082:719/1 16 chrM 7191 255 36M * 0 0 TAAATTAACCCATACCAGCACCATAGACCCTCAAGA <III0EII3+3I29I>III8AIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1746:1180/1 16 chrM 12013 255 36M * 0 0 CCTAAGCTTCAAACTAGATTACTTCTCCCTAATTTT IIIIIIIIFIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:606:460/1 0 chrM 4552 255 36M * 0 0 TTAATTTGGATTATAATAACACTCACAATATTCATA IIIIIII""IIIIIIIIIIIIIIIIII?I6IIIII6 NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1059:362/1 16 chrM 7348 255 36M * 0 0 GGCCACCAATGATACTGAAGCTACGAGCCTACCGAT II/<)2IIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1483:1161/1 16 chrM 15080 255 36M * 0 0 TCCTGATCCTAGCACTCATCCCCACCCCCCACATAT HIIIIIFIIAIHIIIIIIIIIIIIIII""IIIIIII NM:i:1 +HWI-EAS91_1_30788AAXX:1:1:1273:600/1 16 chrM 13855 255 36M * 0 0 GTATTAGACACCCATACCTCAGGATACCCCTCAGTA IIIIIIIIIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:2 +HWI-EAS91_1_30788AAXX:1:1:1190:1283/1 16 chrM 15338 255 36M * 0 0 TATATCGCACATTACCCTGGTCTTGTACCCCAGAAA EIII?-IIIIIAIIIIIIIIIIIIIII""IIIIIII NM:i:2 diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_out3.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_out3.fastqsanger Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,4 @@ +@HWI-EAS91_1_30788AAXX:1:1:1218:141/1 +GTTAAATATTGGGAGTGGGGGGGGGGGGGAGTTTTG ++ +IIIIIII""IIIIIIIIIIIIIIIIIIII1IIII+I diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_out4.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_out4.sam Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,53 @@ +1831_573_1219 16 phiX 2201 255 35M * 0 0 TTGCAGTGGAATAGTCAGGTTAAATTTAATGTGAC -A@EE>NVA7FQZSC8GRJK<EVGC<==39BP\__ NM:i:0 CS:Z:G1211130300300301021212330201121310 CQ:Z:@@@=4/+)5)408?'665>*/5?<61';<3,:,5- +1831_573_1242 0 phiX 647 255 35M * 0 0 TCATCCCGTCAACATTCAAACGGCCTGTCTCATCA [[WSWNGS]US^_\WQW]WL?CEMUIMSTSJ*1U; NM:i:1 CS:Z:T2132003121011302100130302112221121 CQ:Z:>>>::>17=A5?@@=;7A=;2.60>82<8=74+;; +1831_573_1647 16 phiX 1117 255 35M * 0 0 CGACTCCTTCGAGATGGACGCCGTTGGCGCTCTCC 4NIKVOPIBACPWOQ^^WSZ_\Y][Y]]^_[[_^[ NM:i:0 CS:Z:G0222233301013033120132223202022123 CQ:Z:=?@@<@@???;A==@@;9?@?3=;6.4/;6:=/;4 +1831_573_1684 16 phiX 3695 255 35M * 0 0 TAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGC ?\VWTLTTUZVV[_^\Y[_ZWUW]^_XKR[SQJNT NM:i:0 CS:Z:G3310013212312012302121010221231123 CQ:Z:7>1:8<@39@@??9=;@@<>?@@<;<?7>76?9>? +1831_574_109 0 phiX 3728 255 35M * 0 0 GCAGAATCAGCGGTATGGCTCTTCTCATATTGGCG 07651#4817>@65<2:84716=788<1995.7?6 NM:i:1 CS:Z:G3122332123301331032220222133301033 CQ:Z:07651#4817>@65<2:84716=788<1995.7?6 +1831_574_148 16 phiX 2368 255 35M * 0 0 GTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCA ;NEGQTTTJAMH9B@@PHHSQUJML=LPMUMPJGV NM:i:0 CS:Z:T1200113123030012202302312200010231 CQ:Z:<;->3;;3>//>0;;7=,=4-4/+>029<9<624; +1831_574_575 16 phiX 4005 255 35M * 0 0 GAATGTCACGCTGATTATTTTGACTTTGAGCGTAT <JC>=PXK;2BW[T;CXA"&?U\\__WU]^[Z]^U NM:i:1 CS:Z:A3313322100212102033032123311211302 CQ:Z:7?@>=?@>8@@@=@6*%&<='5@<<',0<=4*5/< +1831_574_592 16 phiX 2949 255 35M * 0 0 GGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCAT 2BBLI?LTSPIFFIMD:?MRLECQ][G7DI9=A?I NM:i:0 CS:Z:A3103330110123102223122023103310330 CQ:Z:73-5)19,,<@>4067<2.-864346;9<1/;212 +1831_574_824 16 phiX 3996 255 35M * 0 0 TACCCTTCTGAATGTCACGCTGATTATTTTGACTT ?VRCD\ZK5?ZWJ7D]WP=AVQRHH[J64CUZ__Z NM:i:0 CS:Z:A0212100033032123311211302122020013 CQ:Z:;@@@;;),+@<-<7;<&89??&29?<$2:A<);8? +1831_574_1194 0 phiX 1135 255 35M * 0 0 CGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTC NRXFJ]WXXX^^PP_\\RO\]]SR^_XLRUKC:A6 NM:i:0 CS:Z:C3303101033322220312200222013013312 CQ:Z::5>;,??9@9@?@1@@=@3=@>@4?@@94?75/,6 +1831_574_1591 16 phiX 5117 255 35M * 0 0 GAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCG 9CB??UTRA!7YIJXQUSUEEZWX[WNV^ZY^\XY NM:i:1 CS:Z:C3202101330322130221230222201123202 CQ:Z:==<A><?@78@<=;@&@6>8:?,><&&<7>8(8+9 +1831_574_1624 16 phiX 4057 255 35M * 0 0 CTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAA )5?C6:LSC5DHJA6@FNI54;D?137CB3-3CQ: NM:i:1 CS:Z:C0122200222132200313011102302210332 CQ:Z:#<6.&(,7-+))7..'/;43.)927.(<85&13-) +1831_574_1903 0 phiX 5208 255 35M * 0 0 AAGCTGGGTTACGACGCGACGCCGTTCAACCAGAC TMJT^]XQV__WQY]UUYXUVVV]QNSGOOJOPI/ NM:i:1 CS:Z:A0232100103132133321330310210101221 CQ:Z:<956?@>;7@@@8:@>8><=9>9>@2=71?1:6;/ +1831_575_54 16 phiX 3586 255 35M * 0 0 TTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGC 8ST4/MPK:7HONA7BTVCHY[^YRSVLMSMU_\Z NM:i:1 CS:Z:G3331330322230200102132110132013200 CQ:Z:>=@@68<2;<8;?@<>+9>7,,6972&57:4&9<8 +1831_575_197 16 phiX 4860 255 35M * 0 0 AGCTTGCAAAATACGTGGCCTTATGGTTACAGTAT ,=.<SADLUZH>67?JXRIFRTTVOQZ`RHIRXF8 NM:i:1 CS:Z:A3312113010133020301131330001310032 CQ:Z:,-:?463@A:88?6?437<=.2&1.;@67.4@%2, +1831_575_444 16 phiX 5097 255 35M * 0 0 AAGCTGTCGCTACTTCCCAAGAAGCTGTTCAGAAT >XO0/QUSCCY]]LJWZ^[W\ZVGF[^[JIVZ_QM NM:i:1 CS:Z:A3022120112320220100202132332113320 CQ:Z:<2@@;<.=?@<+=:A<<@?<</>@><(<8>4&5;> +1831_575_622 0 phiX 2484 255 35M * 0 0 TGTTTTACAGACACCTAAAGCTACATCGTCAACGT `XY^\_^Z[^ZY[Z[WNQOLO?DOBJB@M>EQ$!+ NM:i:1 CS:Z:T1100031122111023002323113231210111 CQ:Z:@A8B=@@?<@?<>>=?96<497)<4/<':4+;74+ +1831_575_938 16 phiX 1132 255 35M * 0 0 GGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGC 7N@<NSTMKOQVHAONKTXVTUWZXRTWZ^XY_YT NM:i:0 CS:Z:G3103102220022130222233301013033120 CQ:Z:;:@@:?@;=8;>=;;:=<93<4.;<6:2<9;4)87 +1831_575_970 16 phiX 231 255 35M * 0 0 TGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCG 5PXYYNKY^\[VW[\]XY[VUTRY_[Y]_ZW\\\\ NM:i:0 CS:Z:C3201311301023133303023011202220221 CQ:Z:=@=@=;@@><@@:9<:=?;>@=?9>>?@:2===<5 +1831_575_1138 0 phiX 1912 255 35M * 0 0 CGCTAAAGGTGCTTTGACTTATACCGATATTGCTG XLJ7-IKH@IWNTJJSPUKO]UU[UTNQKDQDCJ1 NM:i:1 CS:Z:C3320002011320012120333103233301321 CQ:Z:<=0;%1936+?96?,?5<:2>@6@<:;4>.7;*:1 +1831_575_1180 0 phiX 4168 255 35M * 0 0 AGGGCGTTGAGTTCGATAATGGTGATATGTATGTT J]_RSE@HENVYKKOINRQOV_]VLPSRLHMBJT7 NM:i:0 CS:Z:A2003310122102323303101123331133110 CQ:Z:/<B>5?':/78?;1;55:997@@>94=7<186->7 +1831_575_1302 16 phiX 5201 255 35M * 0 0 ACTTACCAAGCTGGGTTACGACGCGACGCCGTTCA *57==/2(a)B6+-8?,!,.(.A=+*7>2,841LOB6 NM:i:1 CS:Z:T1201303312333123130200123201013021 CQ:Z:&12>/#2'&-2&%'7+$%*#$/1(&&12/$,2,,* +1831_575_1310 16 phiX 1611 255 35M * 0 0 ATACTGACCAAGAACGTGATTACTTCATGCAGCGT ;QC!!DXV[[Z]UEN_YYPAMSVGGXQWQHKSYWQ NM:i:1 CS:Z:A1332131312021303211310220101211133 CQ:Z:6<<>663?99@(@7=11@:@@/7??<@<;>'3-7; +1831_575_1321 0 phiX 2663 255 35M * 0 0 GTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACT 0;B@?@>=A@<A?>@>?6>@5>'4@9?)7@7?/89 NM:i:1 CS:Z:G1001010233200122122022023000203212 CQ:Z:0;B@?@>=A@<A?>@>?6>@5>'4@9?)7@7?/89 +1831_575_1373 16 phiX 4220 255 35M * 0 0 TTCTGACGTTCGTGATGAGTTTGTATCTGTTACTG <M=?PSE>BHTUGKZZZYY]]VU]^[TUWZ]]__` NM:i:0 CS:Z:C1213011223311001221321132013121220 CQ:Z:A@@@>@;=9<@??7@>@:@;@;17?630/7=4,2< +1831_575_1436 0 phiX 3459 255 35M * 0 0 GCTGGCATTCAGTCGGCGACTTCACGCCAGAATAC ;Q\WMKB<NE=OUWRFO[V?=PUXC6LZN77CHQ< NM:i:0 CS:Z:G3210313021212303321202113301220331 CQ:Z:*2@=;39*3<*4<:>52>>9'7:<='0=>1'136< +1831_575_1442 0 phiX 3316 255 35M * 0 0 ATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCT URLSZUTH;RWB;GTWUNS\^ZJP^SGKFMSB?N> NM:i:0 CS:Z:A3132010022331132101132123132020222 CQ:Z:8>58<?7>+1B6-/9<<:5?>A:1@?539.@4/1> +1831_575_1500 16 phiX 4268 255 35M * 0 0 TGAATTGGCACAATGCTACAATGTGCTCCCCCAAC 9V\UBGWPPNT^YUQQQQUQLPRUQQSV^`_^_^P NM:i:0 CS:Z:G1010000223111301132313011130103021 CQ:Z:2?@@?A@?8<6<:985=99999==B3<5<<,7?>9 +1831_575_1535 16 phiX 1224 255 35M * 0 0 GTCACGTTTATGGTGAACAGTGGATTAAGTTCATG <PRXVWQOTQUST^[\WMT^]Z\_`ZX`a_[[\^a NM:i:0 CS:Z:C1312012030320112110211013300131121 CQ:Z:@B=@<@@B?:A@@=>@?68@=?@5?7;:6<<;>5< +1831_576_86 16 phiX 2980 255 35M * 0 0 CCATGTCTAAATTGTTTGGAGGCGGTCAAAAAGCC /@:AJ7;AEH712=EJKF>=LHJP?587CK:9AHN NM:i:0 CS:Z:G0320000121033022010011030032211310 CQ:Z:7811)2:*.++5</:3+43924*))/:,6&29)2/ +1831_576_266 16 phiX 279 255 35M * 0 0 TAGATATGAGTCACATTTTGTTCATGGTAGAGATT 6;*<NGC9=TWH2<P=+#.P]IDV]\SUZVW[^_[ NM:i:1 CS:Z:A0322223101312011300311121221333223 CQ:Z:<@@?=;<?7=@>9,>@1$&&89$/:>7'3178%&6 +1831_576_603 16 phiX 1575 255 35M * 0 0 ACATTATGGGTCTGCAAGCTGCTTATGCTAATTTG 8PMKX]PIR\`ZJO]_[HGZ_XOW\Z]LPb\RIS_ NM:i:0 CS:Z:C1003032313302312320131221001330311 CQ:Z:@@46=@C.??<A79@@;-<@@>29B?>55<B7598 +1831_576_655 16 phiX 3291 255 35M * 0 0 CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGA %06ESGLVW^JATXW73V][JCT_]G?Q[_XYa`\ NM:i:1 CS:Z:T2001023130302322122200313123123102 CQ:Z:=@AA9@@<6*>@@5/<@>9'=;>7+@?9>/9;+,% +1831_576_815 0 phiX 5185 255 35M * 0 0 CGGAGTGCTTAATCCAACTTACCAAGCTGGGTTAC NP]^WV]^`^ZZWX^_]][ZWKFQPA?FSTQPKD. NM:i:0 CS:Z:C3022113203032010120310102321001031 CQ:Z:<3>@?9>@?B=>=;>A???=>:25=4.25?6<57. +1831_576_882 0 phiX 5052 255 35M * 0 0 GCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTC PGTVV^YMQ]]VNT]ZWXQ;7LYVPKIRXTTLNU8 NM:i:0 CS:Z:G3230020122320223230022031020110122 CQ:Z:?26?8?@:4>@>96??<<=5'1<>9846=<9<1>8 +1831_576_898 0 phiX 517 255 35M * 0 0 GGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGC \_bTPa`\ZY]WOMW`YYLL]VNS^]SSLES][J. NM:i:0 CS:Z:G0230132312121033222231132231233213 CQ:Z:=@@C2?C>?<>@886B?;?.??87=B<8<15??=. +1831_576_923 0 phiX 1049 255 35M * 0 0 CATCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCT LCBEMWHCNQTTNSXUNLTVUKAKV[TMRRURIJ7 NM:i:0 CS:Z:C1322010320202013210121223010123122 CQ:Z:76.51=;.699<96>;;49<;;11;<@59:9=647 +1831_576_1131 16 phiX 4060 255 35M * 0 0 TTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCC <MJBDSMK>BWZI2FPGKEOI<PWVQ?KNN>>SC@ NM:i:1 CS:Z:G0233122200222132200313011102302210 CQ:Z:104@#@/@,4>9?2+?1571@',>=;(759;*92< +1831_576_1289 16 phiX 1898 255 35M * 0 0 ATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTA 0DBK[ONJ9GWSQ@;@CINYOHKU_VQZ_aRNYTX NM:i:0 CS:Z:T3021210023110200323310302013121203 CQ:Z:@9<>1B@@;7@@663==28,5':8<<,.=2>>.50 +1831_576_1367 0 phiX 1838 255 35M * 0 0 GAGCATGGCACTATGTTTACTCTTGCGCTTGTTCG ]^_[Y]_\\[[[X\]]^]WRXZXZZXSROMXVNN7 NM:i:0 CS:Z:G2231310311233110031222013332011023 CQ:Z:??@@<>@@=@<@<=@>@??9:?<=>=<8;59@787 +1831_576_1416 0 phiX 4521 255 35M * 0 0 ATTCAGCGTTTGATGAATGCAATGCGACAGGCTCA 1AYL;>>I[F4JG@CBSURK<KUQB,AZRJCFPW@ NM:i:0 CS:Z:A3021233100123120313103133211203221 CQ:Z:+';?..1.<@'.=+6.5?7<0-?7;(%=>56.98@ +1831_576_1605 0 phiX 5208 255 35M * 0 0 AAGCTGGGTTACGACGCGACGCCGTTCAACCAGAC Q[bb_]NKZYTVW[_XX^]]WTNQSA>BMPKNMB, NM:i:1 CS:Z:A0232100103132133321330310210101221 CQ:Z:6<@C@@>1;@:;<<@@9@???9<3?5-21=4877, +1831_576_1729 16 phiX 5193 255 35M * 0 0 TTAATCCAACTTACCAAGCTGGGTTACGACGCGAC >ZL:FYXSQV]^ZSW^\TU\\[YKM_^][ZZZ^^^ NM:i:0 CS:Z:G1233312313010012320101302101023030 CQ:Z:@?@?<?<@>A?/==?>?7>?@8<?@>99;><+0=> +1831_576_1982 16 phiX 5023 255 35M * 0 0 TTAACAAAAAGTCAGATATGGACCTTGCTGCTAAA @JFRDK\_\MQUU_UQST^ZX^[\XX[Y^LK^^_K NM:i:0 CS:Z:T0032312310201201333221212000011030 CQ:Z:,@@?@,A><@9@=?@9B=8<6@@6@2<A?>.7<+@ +1831_577_133 16 phiX 1713 255 35M * 0 0 TCATGCGCTCTAATCTCTGGGCATCTGGCTATGAT )&/8<NA=EPP;FEI]YY]_VFO]HDXOM[\[]SB NM:i:1 CS:Z:A3213323012231300122223032223331322 CQ:Z:/4@>>?=1?:+>@07@@><>@*<+1@15)96'2$) +1831_577_281 16 phiX 4576 255 35M * 0 0 TTTTTGACACTCTCACGTTGGCTGACGACCGATTA ?XWE?WXSYURPOYWMJ@I[[RQ]VTXW\WR\[FC NM:i:0 CS:Z:T3032301231212301013112222111210000 CQ:Z:7-:B;8@=;>7@>4?=?+659?;5<7?;9@8(>:? +1831_577_322 16 phiX 457 255 35M * 0 0 CTTCTGCCGTTTTGGATTTAACCGAAGATGATTTC /E?@MNMJTZM79LI;A5:H@IIHIFLPEDHQXWU NM:i:1 CS:Z:G2003213220230103303201000130312202 CQ:Z:9=;>4506;255464-<#7+194&2<?65968)7/ +1831_577_362 0 phiX 2152 255 35M * 0 0 ACTTATTCGCCACCATGATTATGACCAGTGTTTCC GS`XY^^[ZWMLTH>LEDHI?,3EQDAQPB5%(@6 NM:i:1 CS:Z:A1203302330110131230331210121110220 CQ:Z:62B?:@?@<?958=,3:,90:&'-99,6<5.($+6 +1831_577_382 16 phiX 4685 255 35M * 0 0 GGGTCGCAAGGCTAATGATTCACACGCCGACTGCT *>C@NMMI2333IUD=>FNE;1=LSE19JHEKMJB NM:i:0 CS:Z:A2312123033111120321303230201332100 CQ:Z:12957/:1))=76(*24;,3+:<.&.&-=1=2/5* +1831_577_488 16 phiX 4947 255 35M * 0 0 TGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAGC @SEJPW]VUWXQLSPSOMXXXTVZQKJJSG59EKM NM:i:0 CS:Z:G3200302330322110200323132101120301 CQ:Z::48.,*>6566<?8=<=<2>6;94>;=9>@8924@ +1831_577_545 0 phiX 1710 255 35M * 0 0 TTGTCATGCGCTCTAATCTCTGGGCATCTGGCTAT [YWTWZY\_\OKHP[[WTY\VLDDFLTMBBMPOD- NM:i:0 CS:Z:T0112131333222303222210031322103233 CQ:Z:>><<9?<>?A<481@<@8==@76/61<95.5988- +1831_577_637 0 phiX 4246 255 35M * 0 0 CTGTTACTGAGAAGTTAATGGATGAATTGGCACAA D8?2<WFB@DQC1-<OMOLMTSRM=6?G>,EYN?, NM:i:1 CS:Z:C2113312122202103031023120301031110 CQ:Z:8-,4#>:-6+:8,&(5;3=0>7=68&1/9&'?;4, +1831_577_692 0 phiX 3904 255 35M * 0 0 TGTCTAGGAAATAACCGTCAGGATTGACACCCTCC aMK^^aIG`_^JJ_]]JI[Z]FCX[[XXTU[UKP< NM:i:0 CS:Z:T1122320200330103121202301211100220 CQ:Z:@B,@?@B(@A?@+@@>@+?=>@'=<@<=<9=?75< diff -r 137d93848139 -r 032aae80bbb0 test-data/perm_out5.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/perm_out5.sam Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,9 @@ +865_1106_310/2 16 chrM 16577 255 50M * 0 0 ACATGCTACTTTAATCAATAAAATTTCCATAGACAGGTATCCCCCTAGAT ;SSUV\VJNWVVWRX\X[[Z\Z[ZW\^XUV\_]]][WWVVYZ^^^_[\_^ NM:i:2 CS:Z:A3223200002331021122331020030003301230300213231311 CQ:Z:?@@=?A>A>==:=;=????A<;;>A<<?=>?<@<=@9:>9>:56A<;;9; +869_1532_1255/1 113 chrM 3727 255 50M = 1979 1748 AGAAATATGTCTGACAAAAGAGTTACTTTGATAGAGTAAAACATAGAGGT ;RPTUVYQPSUSNSRTXTSVYVRVXWYUSVY_UOXZWRQRSUY[\^XQRW NM:i:3 CS:Z:A1022233110003122233210021301222000112122113330022 CQ:Z:=;8:?@=?;;9:8;=>;5A?;<8><<=:9><;9<=8;96>8<5==:<98; +869_1532_1255/1 177 chrM 1979 255 50M = 3727 1748 GTATTAGAGGCACTGCCTGCCCAGTGACATCTGTTTAAACGGCCGCGGTA <QNVYYSUWQPSXUTTRVTT^ZUWXXZ[]\ZYY[YXVVVX][XUVYYZ]` NM:i:0 CS:Z:T3103330303100300112231121121003120312113022230331 CQ:Z:@A=><>9=<@>;<;<==?;?<A=?<=<<:A>7>9:;:<=7:8@6><>96< +889_1337_1562/2 16 chrM 1951 255 50M * 0 0 ACCAAAAACATCACCTCTAGCATTCCCAGTATTAGAGGCACTGCCTGCCC 8PVXVWTRRQPRWQRZ[VORVVWWUOQZ[YUY]WZ^]`^\\]`a^]`[[] NM:i:2 CS:Z:G0031203121130222303312100203132322201123110000101 CQ:Z:=A;A@>AA@>?>A@>A:>@:<>>=5;;=;<;88?=>5=;899:9<<;>98 +891_252_1590/1 65 chrM 15434 255 50M = 97 15337 ACCCAAAGCTGAAATTCTACTTAAACTATTCCTTGATTTCCTCCCCTAAA \^VTXUY[[^YY[[XX]^_^VUWZ]]]\ZYY[]]_[VWWRQPTWTTNQX< NM:i:2 CS:Z:A1001002321200302231203001233020201230020220002300 CQ:Z:<A>9<=9A;A><>>>;>@?A>9=;@>@>?<><@>@@<;=;8:7>:;:5=< +891_252_1590/1 129 chrM 97 255 50M = 15434 15337 TAGTTATTAATAAAATTACACATGCAAGTATCCGCACCCCAGTGAGAATG RRVYXYUSTSSTWXXYUWVUTRPMQUZZVW\\YYXXZVUVW^YUTPSWY= NM:i:2 CS:Z:T3210330303300030311113131021332033110001211222031 CQ:Z:8;8?;><::;9;:>;><:>9=8;68:<?<;=@===<=>9=:>A9=89;== +892_582_183/1 16 chrM 14089 255 50M * 0 0 AAAATAAACACAATATATGTCATCATTATTCCCACGTGGAATCTAACCAC 9QNLRTQOSWUSUVTXXTTXWVVUWYVRTWXVX[\\ZVWYWVXZXYWUYX NM:i:0 CS:Z:G1101032230201131100203303123121133333011110033000 CQ:Z:;><:><=>;<<>:=>?>>;<=;:9><<:=:>;:;>;:=9;;=799<7699 +932_1836_1806/1 113 chrM 3723 255 50M = 2434 1289 CATAAGAAATATGTCTGACAAAAGAGTTACTTTGATAGAGTAAAACATAG >RNSUWYYQQVSVXVZ[XZ^YUZ[XXXWSQZ^WUXXX\XVXVYYVVVVUT NM:i:2 CS:Z:C2331100031222332100213012220001121221133300220331 CQ:Z:;:<;<;<><;>9@=<=<:>A:8<<=<=?<:@?<=?<;>9;<6<><<::5> +932_1836_1806/1 177 chrM 2434 255 50M = 3723 1289 GGTTTACGACCTCGATGTTGGATCAAGACATCCTAATGGTGCAACCGCTA @]ZZ[Z\_WU\XW\WY^Z\]]#!\^`_]\^^]]Z\`^^_\^aaa``_Z\a NM:i:1 CS:Z:T3233010131101303202311220122201011323220123130010 CQ:Z:AA<?A@AAAA>?A>A@=>@>A>??A@?>>@>@=>A9?>:?>8@@=>>=>@ diff -r 137d93848139 -r 032aae80bbb0 tool-data/perm_base_index.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/perm_base_index.loc.sample Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,27 @@ +#This is a sample file distributed with Galaxy that enables tools to +#use a directory of PerM indexed sequences data files. You will need +#to create these data files and then create a perm_base_index.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The perm_base_index.loc +#file has this format (white space characters are TAB characters): +# +#<build_seed_readlength> <file_base> +# +#Because each PerM index is built with a specific seed and a specific read +#length, this needs to be specified so the user can choose the appropriate +#one. So, for example, if you had phiX indexed with seed F3 and read length +#50, and stored in /depot/data/galaxy/phiX/perm_index/, +#then the perm_base_index.loc entry would look something like this: +# +#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index +# +#and your /depot/data/galaxy/phiX/perm_index/ directory +#would contain the file phiX_base_F3_50.index: +# +#Your perm_base_index.loc file should include an entry per line for each +#index set you have stored. For example: +# +#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index +#phiX_F4_50 /depot/data/galaxy/phiX/perm_index/phiX_base_F3_50.index +#hg19_F3_50 /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index +#hg19_F4_50 /depot/data/galaxy/hg19/perm_index/hg19_base_F3_50.index diff -r 137d93848139 -r 032aae80bbb0 tool-data/perm_color_index.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/perm_color_index.loc.sample Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,27 @@ +#This is a sample file distributed with Galaxy that enables tools to +#use a directory of PerM indexed sequences data files. You will need +#to create these data files and then create a perm_color_index.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The perm_color_index.loc +#file has this format (white space characters are TAB characters): +# +#<build_seed_readlength> <file_base> +# +#Because each PerM index is built with a specific seed and a specific read +#length, this needs to be specified so the user can choose the appropriate +#one. So, for example, if you had phiX indexed with seed F3 and read length +#50, and stored in /depot/data/galaxy/phiX/perm_index/, +#then the perm_color_index.loc entry would look something like this: +# +#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index +# +#and your /depot/data/galaxy/phiX/perm_index/ directory +#would contain the file phiX_color_F3_50.index: +# +#Your perm_color_index.loc file should include an entry per line for each +#index set you have stored. For example: +# +#phiX_F3_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index +#phiX_F4_50 /depot/data/galaxy/phiX/perm_index/phiX_color_F3_50.index +#hg19_F3_50 /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index +#hg19_F4_50 /depot/data/galaxy/hg19/perm_index/hg19_color_F3_50.index diff -r 137d93848139 -r 032aae80bbb0 tool_conf.xml.sample --- a/tool_conf.xml.sample Tue Mar 16 18:54:23 2010 -0400 +++ b/tool_conf.xml.sample Wed Mar 17 16:40:36 2010 -0400 @@ -60,7 +60,7 @@ <tool file="filters/joiner.xml" /> <tool file="filters/compare.xml"/> <tool file="new_operations/subtract_query.xml"/> - <tool file="stats/grouping.xml" /> + <tool file="stats/grouping.xml" /> </section> <section name="Convert Formats" id="convert"> <tool file="filters/axt_to_concat_fasta.xml" /> @@ -215,6 +215,7 @@ <tool file="sr_mapping/bwa_wrapper.xml" /> <tool file="metag_tools/megablast_wrapper.xml" /> <tool file="metag_tools/megablast_xml_parser.xml" /> + <tool file="sr_mapping/PerM.xml" /> </section> <section name="NGS: SAM Tools" id="samtools"> <tool file="samtools/sam_bitwise_flag_filter.xml" /> diff -r 137d93848139 -r 032aae80bbb0 tools/sr_mapping/PerM.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/sr_mapping/PerM.xml Wed Mar 17 16:40:36 2010 -0400 @@ -0,0 +1,368 @@ +<tool id="PerM" name="Map with PerM" version="1.0.0"> + <description>for SOLiD and Illumina</description> +  + <command> +PerM +#if $s.sourceOfRef.refSource == "history": + $s.sourceOfRef.ref +#else: + $s.sourceOfRef.index.value +#end if +#if $s.mate.singleOrPairs == "single": + $s.mate.reads +#else: + -1 $s.mate.reads1 -2 $s.mate.reads2 + -U $s.mate.upperbound + -L $s.mate.lowerbound + $s.mate.excludeAmbiguousPairs +#end if +#if $s.space == "color": + --readFormat "csfastq" +#else: + --readFormat "fastq" +#end if +#if $int($str($valAlign)) >= 0: + -v $valAlign +#end if +#if $align.options == "full": + --seed $align.seed + -$align.alignments + #if $str($align.delimiter) != "None": + --delimiter $align.delimiter + #end if + -T $align.sTrimL + $align.includeReadsWN + $align.statsOnly + $align.ignoreQS +#end if +#if $str($bUnmappedRead) == "true" and $s.space == "color": + -u $unmappedReadOutCS +#elif $str($bUnmappedRead) == "true" and $s.space == "base": + -u $unmappedReadOut +#end if +-o $output --outputFormat sam --noSamHeader | tr '\r' '\n' | tr -cd "[:print:]\t\n " | grep "Reads\|Sub0\|Pairs\|single" | sed 's/.*Reads:,//' | sed 's/\/.*dat,_ Sub0/Sub0/' + </command> + <inputs> + <conditional name="s"> + <param name="space" label="Is your data color space (SOLiD) or base space (Illumina)?" type="select"> + <option value="color">Color space</option> + <option value="base">Base space</option> + </param> + <when value="color"> + <conditional name="sourceOfRef"> + <param name="refSource" label="Will you provide your own reference file from the history or use a built-in index?" type="select"> + <option value="indexed">Built-in index</option> + <option value="history">Fasta file from history</option> + </param> + <when value="indexed"> + <param name="index" type="select" label="Select a reference genome (with seed and read length)" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="perm_color_index.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + </options> + </param> + </when> + <when value="history"> + <param name="ref" format="fasta" type="data" label="Reference" /> + </when> + </conditional> + <conditional name="mate"> + <param name="singleOrPairs" label="Mate-paired?" type="select"> + <option value="single">Single-end</option> + <option value="paired">Mate pairs</option> + </param> + <when value="single"> + <param format="fastqcssanger" name="reads" type="data" label="Reads" /> + </when> + <when value="paired"> + <param name="reads1" format="fastqcssanger" label="Forward FASTQ file" type="data" /> + <param name="reads2" format="fastqcssanger" label="Reverse FASTQ file" type="data" /> + <param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" size="8" value="100000" /> + <param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" size="8" value="0" /> + <param label="Exclude ambiguous pairs (-e)" name="excludeAmbiguousPairs" type="boolean" checked="false" truevalue="-e" falsevalue="" /> + </when> + </conditional> + </when> + <when value="base"> + <conditional name="sourceOfRef"> + <param name="refSource" label="Will you provide your own reference file from the history or use a built-in index?" type="select"> + <option value="indexed">Built-in index</option> + <option value="history">Fasta file from history</option> + </param> + <when value="indexed"> + <param name="index" type="select" label="Select a reference genome with seed and read length" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="perm_base_index.loc"> + <column name="value" index="1" /> + <column name="name" index="0" /> + </options> + </param> + </when> + <when value="history"> + <param name="ref" format="fasta" type="data" label="Reference" /> + </when> + </conditional> + <conditional name="mate"> + <param name="singleOrPairs" label="Mate-paired?" type="select"> + <option value="single">Single-end</option> + <option value="paired">Mate pairs</option> + </param> + <when value="single"> + <param format="fastqsanger" name="reads" type="data" label="Reads" /> + </when> + <when value="paired"> + <param name="reads1" format="fastqsanger" label="Forward FASTQ file" type="data" /> + <param name="reads2" format="fastqsanger" label="Reverse FASTQ file" type="data" /> + <param label="Upperbound of pairs separation (-U)" name="upperbound" type="integer" size="8" value="100000" /> + <param label="Lowerbound of pairs separation (-L)" name="lowerbound" type="integer" size="8" value="0" /> + <param label="Exclude ambiguous pairs (-e)" name="excludeAmbiguousPairs" type="boolean" checked="false" truevalue="-e" falsevalue="" /> + </when> + </conditional> + </when> + </conditional> + <param label="Maximum number of mismatches permitted in one end of full read (-v)" name="valAlign" type="integer" size="5" value="2" /> + <conditional name="align"> + <param help="Use default setting or specify full parameters list" label="PerM settings to use" name="options" type="select"> + <option value="preSet">Commonly used</option> + <option value="full">Full parameter list</option> + </param> + <when value="preSet"/> + <when value="full"> + <param label="Whether or not to report all valid alignments per read (-A/-B/-E)" name="alignments" type="select"> + <option value="A">Report all valid alignments</option> + <option value="B">Report the best alignments in terms of number of mismatches</option> + <option value="E">Report only uniquely mapped reads</option> + </param> + <param label="Choose the seed full sensitive to different number of mismatches (--seed)" name="seed" type="select" > + <option value="F2">2 mismatches</option> + <option value="S11">1 SNP + 1 color error</option> + <option value="F3">3 mismatches</option> + <option value="F4">4 mismatches</option> + </param> + <param label="Choose the delimiter to identify read name (--delimiter)" name="delimiter" type="select"> + <option value="None">Tab/Space/Comma</option> + <option value=":">Colon</option> + <option value="_">Underscore</option> + </param> + <param label="Use the first n bases of each read for alignment (-T)" name="sTrimL" type="integer" size="5" value="50" /> + <param name="includeReadsWN" type="boolean" checked="true" truevalue="--includeReadsWN" falsevalue="" label="Include reads with 'N' or '.' by encoding '.' as 3, 'N' as 'A' (--includeReadsWN)" /> + <param name="statsOnly" type="boolean" checked="false" truevalue="--statsOnly" falsevalue="" label="output mapping stats only. Don't output alignments (--statsOnly)" /> + <param name="ignoreQS" type="boolean" checked="false" truevalue="--ignoreQS" falsevalue="" label="Ignore quality scores (--ignoreQS)" /> + </when> + </conditional>  + <param name="bUnmappedRead" type="select" label="Output the unmapped reads (-u)"> + <option value="true">Yes</option> + <option value="false">No</option> + </param> + </inputs> + <outputs> + <data name="output" format="sam"/> + <data name="unmappedReadOut" format="fastqsanger"> + <filter>bUnmappedRead == "true" and s["space"] == "base"</filter> + </data> + <data name="unmappedReadOutCS" format="fastqcssanger"> + <filter>bUnmappedRead == "true" and s["space"] == "color"</filter> + </data> + </outputs> + <tests> + <test> +  + <param name="space" value="base" /> + <param name="refSource" value="indexed" /> + <param name="index" value="phiX_F3_50" /> + <param name="singleOrPairs" value="paired" /> + <param name="reads1" value="perm_in1.fastqsanger" ftype="fastqsanger" /> + <param name="reads2" value="perm_in2.fastqsanger" ftype="fastqsanger" /> + <param name="upperbound" value="100000" /> + <param name="lowerbound" value="0" /> + <param name="excludeAmbiguousPairs" value="true" /> + <param name="valAlign" value="0" /> + <param name="options" value="full" /> + <param name="alignments" value="A" /> + <param name="seed" value="F2" /> + <param name="delimiter" value="None" /> + <param name="sTrimL" value="50" /> + <param name="includeReadsWN" value="true" /> + <param name="statsOnly" value="false" /> + <param name="ignoreQS" value="false" /> + <param name="bUnmappedRead" value="false" /> + <output name="output" file="perm_out1.sam" ftype="sam" /> + </test> + <test> +  + <param name="space" value="base" /> + <param name="refSource" value="history" /> + <param name="ref" value="chr_m.fasta" ftype="fasta" /> + <param name="singleOrPairs" value="single" /> + <param name="reads" value="perm_in3.fastqsanger" ftype="fastqsanger" /> + <param name="valAlign" value="2" /> + <param name="options" value="preSet" /> + <param name="bUnmappedRead" value="true" /> + <output name="output" file="perm_out2.sam" ftype="sam" /> + <output name="unmappedReadOut" file="perm_out3.fastqsanger" ftype="fastqsanger" /> + </test> + <test> +  + <param name="space" value="color" /> + <param name="refSource" value="history" /> + <param name="ref" value="phiX.fasta" ftype="fasta" /> + <param name="singleOrPairs" value="single" /> + <param name="reads" value="perm_in4.fastqcssanger" ftype="fastqcssanger" /> + <param name="valAlign" value="1" /> + <param name="options" value="preSet" /> + <param name="bUnmappedRead" value="false" /> + <output name="output" file="perm_out4.sam" ftype="sam" /> + </test> + <test> +  + <param name="space" value="color" /> + <param name="refSource" value="indexed" /> + <param name="index" value="equCab2_chrM_F3_50" /> + <param name="singleOrPairs" value="paired" /> + <param name="reads1" value="perm_in5.fastqcssanger" ftype="fastqcssanger" /> + <param name="reads2" value="perm_in6.fastqcssanger" ftype="fastqcssanger" /> + <param name="upperbound" value="90000" /> + <param name="lowerbound" value="10000" /> + <param name="excludeAmbiguousPairs" value="false" /> + <param name="valAlign" value="3" /> + <param name="options" value="preSet" /> + <param name="bUnmappedRead" value="false" /> + <output name="output" file="perm_out5.sam" ftype="sam" /> + </test> + </tests> + <help> +**What it does** + +PerM is a short read aligner designed to be ultrafast with long SOLiD reads to the whole genome or transcriptions. PerM can be fully sensitive to alignments with up to four mismatches and highly sensitive to a higher number of mismatches. + +**Development team** + +PerM is developed by Ting Chen's group, Center of Excellence in Genomic Sciences at the University of Southern California. If you have any questions, please email yanghoch at usc.edu or check the `project page`__. + + .. __: http://code.google.com/p/perm/ + +**Citation** + +PerM: Efficient mapping of short sequencing reads with periodic full sensitive spaced seeds. Bioinformatics, 2009, 25 (19): 2514-2521. + +**Input** + +The input files are read files and a reference. Users can use the pre-indexed reference in Galaxy or upload their own reference. + +The uploaded reference file should be in the fasta format. Multiple sequences like transcriptions should be concatenated together separated by a header line that starts with the ">" character. + +Reads files must be in either fastqsanger or fastqcssanger format to use in PerM. However, there are several possible starting formats that can be converted to one of those two: fastq (any type), color-space fastq, fasta, csfasta, or csfasta+qualsolid. + +An uploaded base-space fastq file MUST be checked/transformed with FASTQGroomer tools in Galaxy to be converted to the fastqsanger format (this is true even if the original file is in Sanger format). + +Uploaded fasta and csfasta without quality score files can be transformed to fastqsanger by the FASTQGroomer, with pseudo quality scores added. + +An uploaded csfasta + qual pair can also be transformed into fastqcssanger by solid2fastq. + +**Outputs** + +The output mapping result is in SAM format, and has the following columns:: + + Column Description + -------- -------------------------------------------------------- + 1 QNAME Query (pair) NAME + 2 FLAG bitwise FLAG + 3 RNAME Reference sequence NAME + 4 POS 1-based leftmost POSition/coordinate of clipped sequence + 5 MAPQ MAPping Quality (Phred-scaled) + 6 CIGAR extended CIGAR string + 7 MRNM Mate Reference sequence NaMe ('=' if same as RNAME) + 8 MPOS 1-based Mate POSition + 9 ISIZE Inferred insert SIZE + 10 SEQ query SEQuence on the same strand as the reference + 11 QUAL query QUALity (ASCII-33 gives the Phred base quality) + 12 OPT variable OPTional fields in the format TAG:VTYPE:VALUE + 12.1 NM Number of mismatches (SOLiD-specific) + 12.2 CS Reads in color space (SOLiD-specific) + 12.3 CQ Bases quality in color spacehidden="true" (SOLiD-specific) + +The flags are as follows:: + + Flag Description + ------ ------------------------------------- + 0x0001 the read is paired in sequencing + 0x0002 the read is mapped in a proper pair + 0x0004 the query sequence itself is unmapped + 0x0008 the mate is unmapped + 0x0010 strand of the query (1 for reverse) + 0x0020 strand of the mate + 0x0040 the read is the first read in a pair + 0x0080 the read is the second read in a pair + 0x0100 the alignment is not primary + +Here is some sample output:: + + Qname FLAG Rname POS MAPQ CIAGR MRNM MPOS ISIZE SEQ QUAL NM CS CQ + 491_28_332_F3 16 ref-1 282734 255 35M * 0 0 AGTCAAACTCCGAATGCCAATGACTTATCCTTAGG #%%%%%%%!!%%%!!%%%%%%%%!!%%%%%%%%%% NM:i:3 CS:Z:C0230202330012130103100230121001212 CQ:Z:################################### + 491_28_332_F3 16 ref-1 269436 255 35M * 0 0 AGTCAAACTCCGAATGCCAATGACTTATCCTTAGG #%%%%%%%!!%%%!!%%%%%%%%!!%%%%%%%%%% NM:i:3 CS:Z:C0230202330012130103100230121001212 CQ:Z:################################### + +The user can check a checkbox for optional output containing the unmmaped reads in fastqsanger or fastqcssanger. The default is to produce it. + +**PerM parameter list** + +Below is a list of PerM command line options for PerM. Not all of these are relevant to Galaxy's implementation, but are included for completeness. + +The command for single-end:: + + PerM [ref_or_index] [read] [options] + +The command for paired-end:: + + PerM [ref_or_index] -1 [read1] -2 [read1] [options] + +The command-line options:: + + -A Output all alignments within the given mismatch threshold, end-to-end. + -B Output best alignments in terms of mismatches in the given mismatch threshold. [Default] + -E Output only the uniquely mapped reads in the given mismatch threshold. + -m Create the reference index, without reusing the saved index. + -s PATH Save the reference index to accelerate the mapping in the future. If PATH is not specified, the default path will be used. + -v INT Where INT is the number of mismatches allowed in one end. [Default=2] + -T INT Where INT is the length to truncate read length to, so 30 means use only first 30 bases (signals). Leave blank if the full read is meant to be used. + -o PATH Where PATH is for output the mapping of one read set. PerM's output are in .mapping or .sam format, determined by the ext name of PATH. Ex: -o out.sam will output in SAM format; -o out.mapping will output in .mapping format. + -d PATH Where PATH is the directory for multiple read sets. + -u PATH Print the fastq file of those unmapped reads to the file in PATH. + --noSamHeader Print no SAM header so it is convenient to concatenate multiple SAM output files. + --includeReadsWN Encodes N or "." with A or 3, respectively. + --statsOnly Output the mapping statistics in stdout only, without saving alignments to files. + --ignoreQS Ignore the quality scores in fastq or QUAL files. + --seed {F2 | S11 | F3 | F4} Specify the seed pattern, which has a specific full sensitivity. Check the algorithm page (link below) for seed patterns to balance the sensitivity and running time. + --readFormat {fasta | fastq | csfasta | csfastq} Read in reads in the specified format, instead of guessing according to the extension name. + --delimiter CHAR Which is a character used as the delimiter to separate the the read id, and the additional info in the line with ">" in fasta or csfasta. + +Paired reads options:: + + -e Exclude ambiguous paired. + -L INT Mate-paired separate lower bound. + -U INT Mate-paired separate upper bound. + -1 PATH The forward reads file path. + -2 PATH The reversed reads file path. + +See the PerM `algorithm page`__ for information on algorithms and seeds. + + .. __: http://code.google.com/p/perm/wiki/Algorithms + </help> +</tool> diff -r 137d93848139 -r 032aae80bbb0 tools/sr_mapping/bwa_wrapper.xml --- a/tools/sr_mapping/bwa_wrapper.xml Tue Mar 16 18:54:23 2010 -0400 +++ b/tools/sr_mapping/bwa_wrapper.xml Wed Mar 17 16:40:36 2010 -0400 @@ -110,8 +110,8 @@ BWA commands: cp test-data/phiX.fasta phiX.fasta bwa index -a is phiX.fasta - bwa aln -n 0.04 -o 1 -e -1 -d 16 -i 5 -k 2 -t 4 -M 3 -O 11 -E 4 -R -N phiX.fasta test-data/bwa_wrapper_in1.fastq > bwa_wrapper_out1.sai - bwa samse phiX.fasta bwa_wrapper_out1.sai test-data/bwa_wrapper_in1.fastq >> bwa_wrapper_out2.sam + bwa aln -n 0.04 -o 1 -e -1 -d 16 -i 5 -k 2 -t 4 -M 3 -O 11 -E 4 -R -N phiX.fasta test-data/bwa_wrapper_in1.fastq > bwa_wrapper_out2.sai + bwa samse phiX.fasta bwa_wrapper_out2.sai test-data/bwa_wrapper_in1.fastq >> bwa_wrapper_out2.sam phiX.fasta is the prefix for the reference remove the comment lines (beginning with '@') from the resulting sam file --> @@ -222,7 +222,6 @@ Flag Description ------ ------------------------------------- - Flag Description 0x0001 the read is paired in sequencing 0x0002 the read is mapped in a proper pair 0x0004 the query sequence itself is unmapped

1 0

[hg] galaxy 3541: trackster:
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/137d93848139 changeset: 3541:137d93848139 user: Kanwei Li <kanwei(a)gmail.com> date: Tue Mar 16 18:54:23 2010 -0400 description: trackster: - Use new array_tree summary structure. Feature tracks now display as intensity graphs at higher levels, and switch to detail levels when they fit the screen well - Create array_tree indices for bed format to support the above (bam still in progress) - Other fixes and improvements, including new icons diffstat: datatypes_conf.xml.sample | 2 + lib/galaxy/datatypes/binary.py | 2 +- lib/galaxy/datatypes/converters/bam_to_array_tree_converter.py | 45 + lib/galaxy/datatypes/converters/bam_to_array_tree_converter.xml | 15 + lib/galaxy/datatypes/converters/bed_to_array_tree_converter.py | 29 + lib/galaxy/datatypes/converters/bed_to_array_tree_converter.xml | 14 + lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.py | 12 +- lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.xml | 2 +- lib/galaxy/datatypes/interval.py | 4 +- lib/galaxy/visualization/tracks/data/array_tree.py | 85 ++- lib/galaxy/web/controllers/tracks.py | 73 +- static/scripts/trackster.js | 242 ++++++--- static/trackster.css | 8 +- templates/tracks/browser.mako | 27 +- 14 files changed, 401 insertions(+), 159 deletions(-) diffs (1036 lines): diff -r 861756e85b16 -r 137d93848139 datatypes_conf.xml.sample --- a/datatypes_conf.xml.sample Tue Mar 16 16:03:28 2010 -0400 +++ b/datatypes_conf.xml.sample Tue Mar 16 18:54:23 2010 -0400 @@ -5,12 +5,14 @@ <datatype extension="axt" type="galaxy.datatypes.sequence:Axt" display_in_upload="true"/> <datatype extension="bam" type="galaxy.datatypes.binary:Bam" mimetype="application/octet-stream" display_in_upload="true"> <converter file="bam_to_bai.xml" target_datatype="bai"/> + <converter file="bam_to_array_tree_converter.xml" target_datatype="array_tree"/> <display file="ucsc/bam.xml" /> </datatype> <datatype extension="bed" type="galaxy.datatypes.interval:Bed" display_in_upload="true"> <converter file="bed_to_gff_converter.xml" target_datatype="gff"/> <converter file="interval_to_coverage.xml" target_datatype="coverage"/> <converter file="bed_to_interval_index_converter.xml" target_datatype="interval_index"/> + <converter file="bed_to_array_tree_converter.xml" target_datatype="array_tree"/> <converter file="bed_to_genetrack_converter.xml" target_datatype="genetrack"/>  <display file="genetrack.xml" /> diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/binary.py --- a/lib/galaxy/datatypes/binary.py Tue Mar 16 16:03:28 2010 -0400 +++ b/lib/galaxy/datatypes/binary.py Tue Mar 16 18:54:23 2010 -0400 @@ -139,7 +139,7 @@ except: return "Binary bam alignments file (%s)" % ( data.nice_size( dataset.get_size() ) ) def get_track_type( self ): - return "ReadTrack", "bai" + return "ReadTrack", ["bai", "array_tree"] class Binseq( Binary ): """Class describing a zip archive of binary sequence files""" diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/converters/bam_to_array_tree_converter.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/bam_to_array_tree_converter.py Tue Mar 16 18:54:23 2010 -0400 @@ -0,0 +1,45 @@ +#!/usr/bin/env python + +from __future__ import division + +import sys +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ); pkg_resources.require( "pysam" ) + +from pysam import csamtools +from bx.arrays.array_tree import * + +BLOCK_SIZE = 1000 + +class BamReader: + def __init__( self, input_fname, index_fname ): + self.bamfile = csamtools.Samfile( filename=input_fname, mode='rb', index_filename=index_fname ) + self.iterator = self.bamfile.fetch() + + def __iter__( self ): + return self + + def __next__( self ): + while True: + read = self.iterator.next() + return read.rname, read.mpos, read.pos + read.rlen, None, mapq + + +def main(): + + input_fname = sys.argv[1] + index_fname = sys.argv[2] + out_fname = sys.argv[3] + + reader = BamReader( input_fname, index_fname ) + + # Fill array from reader + d = array_tree_dict_from_reader( reader, {}, block_size = BLOCK_SIZE ) + + for array_tree in d.itervalues(): + array_tree.root.build_summary() + + FileArrayTreeDict.dict_to_file( d, open( out_fname, "w" ), no_leaves=True ) + +if __name__ == "__main__": + main() \ No newline at end of file diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/converters/bam_to_array_tree_converter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/bam_to_array_tree_converter.xml Tue Mar 16 18:54:23 2010 -0400 @@ -0,0 +1,15 @@ +<tool id="CONVERTER_bam_to_array_tree_0" name="Convert BAM to Array Tree" version="1.0.0"> + + <command interpreter="python">bam_to_array_tree_converter.py $input1 $output1</command> + <inputs> + <page> + <param format="bam" name="input1" type="data" label="Choose BAM file"/> + <param format="bai" name="index" type="data" label="BAM index file"/> + </page> + </inputs> + <outputs> + <data format="array_tree" name="output1"/> + </outputs> + <help> + </help> +</tool> diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/converters/bed_to_array_tree_converter.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/bed_to_array_tree_converter.py Tue Mar 16 18:54:23 2010 -0400 @@ -0,0 +1,29 @@ +#!/usr/bin/env python + +from __future__ import division + +import sys +from galaxy import eggs +import pkg_resources; pkg_resources.require( "bx-python" ) +from bx.arrays.array_tree import * +from bx.arrays.bed import BedReader + +BLOCK_SIZE = 1000 + +def main(): + + input_fname = sys.argv[1] + out_fname = sys.argv[2] + + reader = BedReader( open( input_fname ) ) + + # Fill array from reader + d = array_tree_dict_from_reader( reader, {}, block_size = BLOCK_SIZE ) + + for array_tree in d.itervalues(): + array_tree.root.build_summary() + + FileArrayTreeDict.dict_to_file( d, open( out_fname, "w" ), no_leaves=True ) + +if __name__ == "__main__": + main() \ No newline at end of file diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/converters/bed_to_array_tree_converter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lib/galaxy/datatypes/converters/bed_to_array_tree_converter.xml Tue Mar 16 18:54:23 2010 -0400 @@ -0,0 +1,14 @@ +<tool id="CONVERTER_bed_to_array_tree_0" name="Convert BED to Array Tree" version="1.0.0"> + + <command interpreter="python">bed_to_array_tree_converter.py $input1 $output1</command> + <inputs> + <page> + <param format="bed" name="input1" type="data" label="Choose BED file"/> + </page> + </inputs> + <outputs> + <data format="array_tree" name="output1"/> + </outputs> + <help> + </help> +</tool> diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.py --- a/lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.py Tue Mar 16 16:03:28 2010 -0400 +++ b/lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.py Tue Mar 16 18:54:23 2010 -0400 @@ -6,7 +6,7 @@ from galaxy import eggs import pkg_resources; pkg_resources.require( "bx-python" ) from bx.arrays.array_tree import * -from bx.arrays.wiggle import IntervalReader +from bx.arrays.wiggle import WiggleReader BLOCK_SIZE = 100 @@ -15,17 +15,15 @@ input_fname = sys.argv[1] out_fname = sys.argv[2] - reader = IntervalReader( open( input_fname ) ) + reader = WiggleReader( open( input_fname ) ) - # Fill array from wiggle - d = array_tree_dict_from_wiggle_reader( reader, {}, block_size = BLOCK_SIZE ) + # Fill array from reader + d = array_tree_dict_from_reader( reader, {}, block_size = BLOCK_SIZE ) for array_tree in d.itervalues(): array_tree.root.build_summary() - f = open( out_fname, "w" ) - FileArrayTreeDict.dict_to_file( d, f ) - f.close() + FileArrayTreeDict.dict_to_file( d, open( out_fname, "w" ) ) if __name__ == "__main__": main() \ No newline at end of file diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.xml --- a/lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.xml Tue Mar 16 16:03:28 2010 -0400 +++ b/lib/galaxy/datatypes/converters/wiggle_to_array_tree_converter.xml Tue Mar 16 18:54:23 2010 -0400 @@ -1,4 +1,4 @@ -<tool id="INDEXER_Wiggle_0" name="Index Wiggle for Track Viewer"> +<tool id="CONVERTER_Wiggle_0" name="Index Wiggle for Track Viewer">  <command interpreter="python">wiggle_to_array_tree_converter.py $input $output</command> <inputs> diff -r 861756e85b16 -r 137d93848139 lib/galaxy/datatypes/interval.py --- a/lib/galaxy/datatypes/interval.py Tue Mar 16 16:03:28 2010 -0400 +++ b/lib/galaxy/datatypes/interval.py Tue Mar 16 18:54:23 2010 -0400 @@ -508,7 +508,7 @@ except: return False def get_track_type( self ): - return "FeatureTrack", "interval_index" + return "FeatureTrack", ["interval_index", "array_tree"] class BedStrict( Bed ): """Tab delimited data in strict BED format - no non-standard columns allowed""" @@ -959,7 +959,7 @@ resolution = max( resolution, 1 ) return resolution def get_track_type( self ): - return "LineTrack", "array_tree" + return "LineTrack", ["array_tree"] class CustomTrack ( Tabular ): """UCSC CustomTrack""" diff -r 861756e85b16 -r 137d93848139 lib/galaxy/visualization/tracks/data/array_tree.py --- a/lib/galaxy/visualization/tracks/data/array_tree.py Tue Mar 16 16:03:28 2010 -0400 +++ b/lib/galaxy/visualization/tracks/data/array_tree.py Tue Mar 16 18:54:23 2010 -0400 @@ -7,14 +7,21 @@ from bx.arrays.array_tree import FileArrayTreeDict except: pass -from math import floor, ceil, log +from math import floor, ceil, log, pow +import logging +logger = logging.getLogger(__name__) # Maybe this should be included in the datatype itself, so users can add their # own types to the browser as long as they return the right format of data? +SUMMARIZE_N = 200 + class ArrayTreeDataProvider( object ): def __init__( self, dataset, original_dataset ): self.dataset = dataset + + # def calc_resolution(self, start, end, density): + # return pow( 10, ceil( log( (end - start) / density , 10 ) ) ) def get_stats( self, chrom ): f = open( self.dataset.file_name ) @@ -26,8 +33,26 @@ return "no data" root_summary = chrom_array_tree.get_summary( 0, chrom_array_tree.levels ) + + level = chrom_array_tree.levels - 1 + desired_summary = chrom_array_tree.get_summary( 0, level ) + bs = chrom_array_tree.block_size ** level + + frequencies = map(int, desired_summary.frequencies) + out = [ (i * bs, freq) for i, freq in enumerate(frequencies) ] + f.close() - return { 'max': float( max(root_summary.maxs) ), 'min': float( min(root_summary.mins) ) } + return { 'max': float( max(root_summary.maxs) ), \ + 'min': float( min(root_summary.mins) ), \ + 'frequencies': out, \ + 'total_frequency': sum(root_summary.frequencies) } + + # Return None instead of NaN to pass jQuery 1.4's strict JSON + def float_nan(self, n): + if n != n: # NaN != NaN + return None + else: + return float(n) def get_data( self, chrom, start, end, **kwargs ): f = open( self.dataset.file_name ) @@ -44,28 +69,54 @@ start = int( start ) end = int( end ) resolution = max(1, ceil(float(kwargs['resolution']))) - - level = int( floor( log( resolution, block_size ) ) ) + + level = int( ceil( log( resolution, block_size ) ) ) level = max( level, 0 ) stepsize = block_size ** level - step1 = stepsize * block_size # Is the requested level valid? assert 0 <= level <= chrom_array_tree.levels - results = [] - for block_start in range( start, end, stepsize * block_size ): - # print block_start - # Return either data point or a summary depending on the level - indexes = range( block_start, block_start + stepsize * block_size, stepsize ) - if level > 0: - s = chrom_array_tree.get_summary( block_start, level ) - if s is not None: - results.extend( zip( indexes, map( float, s.sums / s.counts ) ) ) + if "frequencies" in kwargs: + if level <= 0: + # Low level enough to always display features + f.close() + return None else: - v = chrom_array_tree.get_leaf( block_start ) - if v is not None: - results.extend( zip( indexes, map( float, v ) ) ) + # Round to nearest bin + bin_start = start // (stepsize * block_size) * (stepsize * block_size) + + indexes = range( bin_start, (bin_start + stepsize * block_size), stepsize ) + summary = chrom_array_tree.get_summary( bin_start, level ) + if summary: + results = zip( indexes, map( int, summary.frequencies ) ) + filtered = filter(lambda tup: tup[0] >= start and tup[0] <= end, results) + sums = 0 + max_f = 0 + for tup in filtered: + sums += tup[1] + max_f = max(max_f, tup[1]) + + if max_f > 10000: + f.close() + return filtered, int(sums), float(sums)/len(filtered) + f.close() + return None + + else: + results = [] + for block_start in range( start, end, stepsize * block_size ): + # print block_start + # Return either data point or a summary depending on the level + indexes = range( block_start, block_start + stepsize * block_size, stepsize ) + if level > 0: + s = chrom_array_tree.get_summary( block_start, level ) + if s: + results.extend( zip( indexes, map( self.float_nan, s.sums / s.counts ) ) ) + else: + l = chrom_array_tree.get_leaf( block_start ) + if l: + results.extend( zip( indexes, map( self.float_nan, l ) ) ) f.close() return results diff -r 861756e85b16 -r 137d93848139 lib/galaxy/web/controllers/tracks.py --- a/lib/galaxy/web/controllers/tracks.py Tue Mar 16 16:03:28 2010 -0400 +++ b/lib/galaxy/web/controllers/tracks.py Tue Mar 16 18:54:23 2010 -0400 @@ -98,11 +98,10 @@ hda_query = trans.sa_session.query( model.HistoryDatasetAssociation ) dataset = hda_query.get( dataset_id ) - track_type, indexer = dataset.datatype.get_track_type() + track_type, _ = dataset.datatype.get_track_type() track = { "track_type": track_type, - "indexer": indexer, "name": dataset.name, "dataset_id": dataset.id, "prefs": {}, @@ -134,10 +133,9 @@ except KeyError: prefs = {} dataset = hda_query.get( dataset_id ) - track_type, indexer = dataset.datatype.get_track_type() + track_type, _ = dataset.datatype.get_track_type() tracks.append( { "track_type": track_type, - "indexer": indexer, "name": dataset.name, "dataset_id": dataset.id, "prefs": simplejson.dumps(prefs), @@ -187,41 +185,50 @@ return manifest @web.json - def data( self, trans, dataset_id, indexer, chrom, low, high, **kwargs ): + def data( self, trans, dataset_id, chrom, low, high, **kwargs ): """ Called by the browser to request a block of data """ - # Load the requested dataset dataset = trans.sa_session.query( trans.app.model.HistoryDatasetAssociation ).get( dataset_id ) - # No dataset for that id if not dataset or not chrom: return messages.NO_DATA - # Dataset is in error state, can't display if dataset.state == trans.app.model.Job.states.ERROR: return messages.ERROR - # Dataset is still being generated if dataset.state != trans.app.model.Job.states.OK: return messages.PENDING - # Determine what to return based on the type of track being drawn. - converted_dataset_type = indexer - converted_dataset = self.__dataset_as_type( trans, dataset, converted_dataset_type ) - if not converted_dataset: - # No converter - return messages.NO_CONVERTER - # Need to check states again for the converted version - if converted_dataset.state == model.Dataset.states.ERROR: - return messages.ERROR - if converted_dataset.state != model.Dataset.states.OK: - return messages.PENDING - # We have a dataset in the right format that is ready to use, wrap in - # a data provider that knows how to access it - data_provider = dataset_type_to_data_provider[ converted_dataset_type ]( converted_dataset, dataset ) + + track_type, indexes = dataset.datatype.get_track_type() + converted = dict([ (index, self.__dataset_as_type( trans, dataset, index )) for index in indexes ]) - # Return stats if we need them - if 'stats' in kwargs: return data_provider.get_stats( chrom ) + for index, converted_dataset in converted.iteritems(): + if not converted_dataset: + return messages.NO_CONVERTER - # Get the requested chunk of data - return data_provider.get_data( chrom, low, high, **kwargs ) + # Need to check states again for the converted version + if converted_dataset.state == model.Dataset.states.ERROR: + return messages.ERROR + if converted_dataset.state != model.Dataset.states.OK: + return messages.PENDING + + if len(converted) > 1: + # Have to choose between array_tree and other provider + array_tree = ArrayTreeDataProvider( converted['array_tree'], dataset ) + freqs = array_tree.get_data( chrom, low, high, frequencies=True, **kwargs ) + if freqs is not None: + frequencies, sums, avg_f = freqs + return { "dataset_type": "array_tree", "data": frequencies, "sums": sums, "avg_f": avg_f } + dataset_type = "interval_index" + else: + dataset_type = converted.keys()[0] + + data_provider = dataset_type_to_data_provider[ dataset_type ]( converted[dataset_type], dataset ) + + if 'stats' in kwargs: + data = data_provider.get_stats( chrom ) + else: + data = data_provider.get_data( chrom, low, high, **kwargs ) + + return { "dataset_type": dataset_type, "data": data } def __dataset_as_type( self, trans, dataset, type ): """ @@ -240,12 +247,11 @@ # See if converted dataset already exists converted_datasets = [c for c in dataset.get_converted_files_by_type( type ) if c != None] if converted_datasets: - for d in converted_datasets: - if d.state != 'error': - return d - else: - return None - + if converted_datasets[0].state != 'error': + return converted_datasets[0] + else: + return None + # Conversion is possible but hasn't been done yet, run converter here # FIXME: this is largely duplicated from DefaultToolAction assoc = model.ImplicitlyConvertedDatasetAssociation( parent = dataset, file_type = type, metadata_safe = False ) @@ -285,7 +291,6 @@ for track in decoded_payload: tracks.append( { "dataset_id": str(track['dataset_id']), "name": track['name'], - "indexer": track['indexer'], "track_type": track['track_type'], "prefs": track['prefs'] } ) diff -r 861756e85b16 -r 137d93848139 static/scripts/trackster.js --- a/static/scripts/trackster.js Tue Mar 16 16:03:28 2010 -0400 +++ b/static/scripts/trackster.js Tue Mar 16 18:54:23 2010 -0400 @@ -6,6 +6,7 @@ var DENSITY = 1000, FEATURE_LEVELS = 10, DATA_ERROR = "There was an error in indexing this dataset.", + DATA_NOCONVERTER = "A converter for this dataset is not installed. Please check your datatypes_conf.xml file.", DATA_NONE = "No data for this chrom/contig.", DATA_PENDING = "Currently indexing... please wait", DATA_LOADING = "Loading data...", @@ -77,6 +78,18 @@ } }); +var Drawer = function() {}; +$.extend( Drawer.prototype, { + intensity: function(ctx, max, data) { + + + }, + +}); + +drawer = new Drawer(); + + var View = function( chrom, title, vis_id, dbkey ) { this.vis_id = vis_id; this.dbkey = dbkey; @@ -124,6 +137,13 @@ } } }, + reset: function() { + this.low = this.max_low; + this.high = this.max_high; + this.center = this.center = (this.max_high - this.max_low) / 2; + this.zoom_level = 0; + $(".yaxislabel").remove(); + }, redraw: function(nodraw) { this.span = this.max_high - this.max_low; var span = this.span / Math.pow(this.zoom_factor, this.zoom_level), @@ -156,20 +176,22 @@ $("#high").val( commatize(this.high) ); if (!nodraw) { for ( var i = 0, len = this.tracks.length; i < len; i++ ) { - this.tracks[i].draw(); + if (this.tracks[i].enabled) { + this.tracks[i].draw(); + } } for ( var i = 0, len = this.label_tracks.length; i < len; i++ ) { this.label_tracks[i].draw(); } } }, - zoom_in: function ( point ) { + zoom_in: function ( point, container ) { if (this.max_high === 0 || this.high - this.low < 30) { return; } if ( point ) { - this.center = point / $(document).width() * (this.high - this.low) + this.low; + this.center = point / container.width() * (this.high - this.low) + this.low; } this.zoom_level += 1; this.redraw(); @@ -201,6 +223,7 @@ }, init_each: function(params, success_fn) { var track = this; + track.enabled = false; track.data_queue = {}; track.tile_cache.clear(); track.data_cache.clear(); @@ -209,21 +232,25 @@ track.container_div.removeClass("nodata error pending"); if (track.view.chrom) { - $.getJSON( data_url, params, function ( data ) { - if (!data || data == "error") { + $.getJSON( data_url, params, function (result) { + if (!result || result === "error") { track.container_div.addClass("error"); track.content_div.text(DATA_ERROR); - } else if (data.length === 0 || data == "no data") { + } else if (result === "no converter") { + track.container_div.addClass("error"); + track.content_div.text(DATA_NOCONVERTER); + } else if ( (result.data && result.data.length === 0) || result === "no data") { track.container_div.addClass("nodata"); track.content_div.text(DATA_NONE); - } else if (data == "pending") { + } else if (result === "pending") { track.container_div.addClass("pending"); track.content_div.text(DATA_PENDING); setTimeout(function() { track.init(); }, 5000); } else { track.content_div.text(""); track.content_div.css( "height", track.height_px + "px" ); - success_fn(data); + track.enabled = true; + success_fn(result); track.draw(); } }); @@ -318,12 +345,11 @@ } }); -var LineTrack = function ( name, dataset_id, indexer, prefs ) { +var LineTrack = function ( name, dataset_id, prefs ) { this.track_type = "LineTrack"; Track.call( this, name, $("#viewport") ); TiledTrack.call( this ); - this.indexer = indexer; this.height_px = 100; this.container_div.addClass( "line-track" ); this.dataset_id = dataset_id; @@ -339,9 +365,9 @@ track_id = track.view.tracks.indexOf(track); track.vertical_range = undefined; - this.init_each({ stats: true, indexer: track.indexer, - chrom: track.view.chrom, low: null, high: null, - dataset_id: track.dataset_id }, function(data) { + this.init_each({ stats: true, chrom: track.view.chrom, low: null, high: null, + dataset_id: track.dataset_id }, function(result) { + data = result.data; if ( isNaN(parseFloat(track.prefs.min_value)) || isNaN(parseFloat(track.prefs.max_value)) ) { track.prefs.min_value = data.min; track.prefs.max_value = data.max; @@ -350,6 +376,7 @@ $('#track_' + track_id + '_maxval').val(track.prefs.max_value); } track.vertical_range = track.prefs.max_value - track.prefs.min_value; + track.total_frequency = data.total_frequency; // Draw y-axis labels if necessary $('#linetrack_' + track_id + '_minval').remove(); @@ -373,17 +400,29 @@ if (!track.data_queue[key]) { track.data_queue[key] = true; - $.getJSON( data_url, { "indexer": this.indexer, "chrom": this.view.chrom, + /*$.getJSON( data_url, { "chrom": this.view.chrom, "low": low, "high": high, "dataset_id": this.dataset_id, - "resolution": this.view.resolution, }, function (data) { + "resolution": this.view.resolution }, function (data) { track.data_cache.set(key, data); delete track.data_queue[key]; track.draw(); + });*/ + $.ajax({ 'url': data_url, 'dataType': 'json', 'data': { "chrom": this.view.chrom, + "low": low, "high": high, "dataset_id": this.dataset_id, + "resolution": this.view.resolution }, + success: function (result) { + data = result.data; + track.data_cache.set(key, data); + delete track.data_queue[key]; + track.draw(); + }, error: function(r, t, e) { + console.log(r, t, e); + } }); } }, draw_tile: function( resolution, tile_index, parent_element, w_scale ) { - if (this.vertical_range === undefined) { // We don't have the necessary information yet + if (this.vertical_range === undefined) { return; } @@ -398,6 +437,7 @@ } var data = this.data_cache.get(key); + canvas.css( { position: "absolute", top: 0, @@ -411,31 +451,56 @@ min_value = this.prefs.min_value, max_value = this.prefs.max_value, vertical_range = this.vertical_range, + total_frequency = this.total_frequency, height_px = this.height_px; ctx.beginPath(); - for ( var i = 0; i < data.length - 1; i++ ) { + + // for intensity, calculate delta x in pixels to for width of box + var delta_x_px = Math.ceil((data[1][0] - data[0][0]) * w_scale); + var mode = "line"; + + for ( var i = 0; i < data.length; i++ ) { var x = data[i][0] - tile_low; var y = data[i][1]; - // Missing data causes us to stop drawing - if ( isNaN( y ) ) { - in_path = false; - } else { - // Translate + + if ( mode == "intensity" ) { + // DRAW INTENSITY + if (y === null) { + continue; + } x = x * w_scale; - // console.log(y, this.min_value, this.vertical_range, (y - this.min_value) / this.vertical_range * this.height_px); if (y <= min_value) { y = min_value; } else if (y >= max_value) { y = max_value; } - y = Math.round( height_px - (y - min_value) / vertical_range * height_px ); - // console.log(canvas.get(0).height, canvas.get(0).width); - if ( in_path ) { - ctx.lineTo( x, y ); + y = Math.floor( (y - min_value) / vertical_range * 255 ); + ctx.fillStyle = "rgb(" +y+ "," +y+ "," +y+ ")"; + ctx.fillRect(x, 0, delta_x_px, 30); + } + else { + // Missing data causes us to stop drawing + if (y === null) { + in_path = false; + continue; } else { - ctx.moveTo( x, y ); - in_path = true; + // Translate + x = x * w_scale; + // console.log(y, this.min_value, this.vertical_range, (y - this.min_value) / this.vertical_range * this.height_px); + if (y <= min_value) { + y = min_value; + } else if (y >= max_value) { + y = max_value; + } + y = Math.round( height_px - (y - min_value) / vertical_range * height_px ); + // console.log(canvas.get(0).height, canvas.get(0).width); + if ( in_path ) { + ctx.lineTo( x, y ); + } else { + ctx.moveTo( x, y ); + in_path = true; + } } } } @@ -471,12 +536,11 @@ } }); -var FeatureTrack = function ( name, dataset_id, indexer, prefs ) { +var FeatureTrack = function ( name, dataset_id, prefs ) { this.track_type = "FeatureTrack"; Track.call( this, name, $("#viewport") ); TiledTrack.call( this ); - this.indexer = indexer; this.height_px = 100; this.container_div.addClass( "feature-track" ); this.dataset_id = dataset_id; @@ -500,13 +564,16 @@ }; $.extend( FeatureTrack.prototype, TiledTrack.prototype, { init: function() { - var track = this; - this.init_each({ indexer: track.indexer, low: track.view.max_low, + var track = this, + key = track.view.max_low + '_' + track.view.max_high; + this.init_each({ low: track.view.max_low, high: track.view.max_high, dataset_id: track.dataset_id, - chrom: track.view.chrom }, function (data) { - track.values = data; - track.calc_slots(); - track.slots = track.zo_slots; + chrom: track.view.chrom, resolution: this.view.resolution }, function (result) { + track.data_cache.set(key, result); + // track.values = result; + // track.calc_slots(); + // track.slots = track.zo_slots; + track.draw(); }); }, get_data: function( low, high ) { @@ -515,10 +582,10 @@ if (!track.data_queue[key]) { track.data_queue[key] = true; - $.getJSON( data_url, { indexer: track.indexer, chrom: track.view.chrom, + $.getJSON( data_url, { chrom: track.view.chrom, low: low, high: high, dataset_id: track.dataset_id, - include_blocks: true }, function (data) { - track.data_cache.set(key, data); + include_blocks: true, resolution: this.view.resolution }, function (result) { + track.data_cache.set(key, result); // console.log("datacache", track.data_cache.get(key)); delete track.data_queue[key]; track.draw(); @@ -612,52 +679,48 @@ }, draw_tile: function( resolution, tile_index, parent_element, w_scale ) { - if (!this.values) { - return; - } var tile_low = tile_index * DENSITY * resolution, tile_high = ( tile_index + 1 ) * DENSITY * resolution, tile_span = DENSITY * resolution; // console.log("drawing " + tile_index); - // Once we zoom in enough, show name labels var data, slots, required_height; - if (w_scale > this.show_labels_scale) { - if (!this.showing_details) { - this.showing_details = true; + + /*for (var k in this.data_cache.obj_cache) { + var k_split = k.split("_"), k_low = k_split[0], k_high = k_split[1]; + if (k_low <= tile_low && k_high >= tile_high) { + data = this.data_cache.get(k); + break; } - for (var k in this.data_cache.obj_cache) { - var k_split = k.split("_"), k_low = k_split[0], k_high = k_split[1]; - if (k_low <= tile_low && k_high >= tile_high) { - data = this.data_cache.get(k); - break; - } - } - if (!data) { - this.data_queue[ [tile_low, tile_high] ] = true; - this.get_data(tile_low, tile_high); - return; - } - // Calculate new slots incrementally for this new chunk of data and update height if necessary - required_height = this.incremental_slots( this.view.zoom_res, data ) * this.vertical_detail_px + 15; + }*/ + + // var k = this.view.low + '_' + this.view.high; + var k = tile_low + '_' + tile_high; + var data = this.data_cache.get(k); + + if (!data) { + this.data_queue[ [tile_low, tile_high] ] = true; + this.get_data(tile_low, tile_high); + return; + } + + if (data.dataset_type == "array_tree") { + required_height = 30; + // Blah + } else { + // Calculate new slots incrementally for this new chunk of data and update height if necessary + required_height = this.incremental_slots( this.view.zoom_res, data.data ) * this.vertical_detail_px + 15; // console.log(required_height); slots = this.inc_slots[this.view.zoom_res]; - } else { - if (this.showing_details) { - this.showing_details = false; - } - required_height = this.height_px; - slots = this.zo_slots; - data = this.values; } - + // console.log(tile_low, tile_high, tile_length, w_scale); var width = Math.ceil( tile_span * w_scale ), new_canvas = $("<canvas class='tile'></canvas>"), label_color = this.prefs.label_color, block_color = this.prefs.block_color, left_offset = this.left_offset, - showing_details = this.showing_details, - y_scale = (this.showing_details ? this.vertical_detail_px : this.vertical_nodetail_px); + // showing_details = this.showing_details, + y_scale = this.vertical_detail_px; new_canvas.css({ position: "absolute", @@ -671,7 +734,30 @@ ctx.fillStyle = this.prefs.block_color; ctx.font = this.default_font; ctx.textAlign = "right"; - + var min_color = 150; + + if (data.dataset_type == "array_tree") { + var points = data.data; + var sums = data.sums; + var avg_f = data.avg_f; + var delta_x_px = Math.ceil((points[1][0] - points[0][0]) * w_scale); + + for ( var i = 0, len = points.length; i < len; i++ ) { + var x = Math.ceil( (points[i][0] - tile_low) * w_scale ); + var y = points[i][1]; + + if (!y) { + continue; + } + y = Math.floor( min_color + (y - avg_f)/sums * min_color ); + ctx.fillStyle = "rgb(" +y+ "," +y+ "," +y+ ")"; + ctx.fillRect(x + left_offset, 0, delta_x_px, 20); + } + parent_element.append( new_canvas ); + return new_canvas; + } + + var data = data.data; var j = 0; for (var i = 0, len = data.length; i < len; i++) { var feature = data[i]; @@ -685,10 +771,10 @@ thick_start = Math.floor( Math.max(0, (feature.thick_start - tile_low) * w_scale) ); thick_end = Math.ceil( Math.min(width, (feature.thick_end - tile_low) * w_scale) ); } - if (!showing_details) { + // if (!showing_details) { // Non-detail levels - ctx.fillRect(f_start + left_offset, y_center + 5, f_end - f_start, 1); - } else { + // ctx.fillRect(f_start + left_offset, y_center + 5, f_end - f_start, 1); + // } else { // Showing labels, blocks, details if (feature.start > tile_low) { ctx.fillStyle = label_color; @@ -743,7 +829,7 @@ ctx.fillStyle = prefs.block_color; } } - } + // } j++; } } @@ -772,12 +858,12 @@ } }); -var ReadTrack = function ( name, dataset_id, indexer, prefs ) { +var ReadTrack = function ( name, dataset_id, prefs ) { this.track_type = "ReadTrack"; this.tile_cache = new Cache(CACHED_TILES_FEATURE); Track.call( this, name, $("#viewport") ); TiledTrack.call( this ); - FeatureTrack.call( this, name, dataset_id, indexer, prefs ); + FeatureTrack.call( this, name, dataset_id, prefs ); }; $.extend( ReadTrack.prototype, TiledTrack.prototype, FeatureTrack.prototype, { diff -r 861756e85b16 -r 137d93848139 static/trackster.css --- a/static/trackster.css Tue Mar 16 16:03:28 2010 -0400 +++ b/static/trackster.css Tue Mar 16 18:54:23 2010 -0400 @@ -30,13 +30,7 @@ } #nav-controls a { - color: white; - padding: 0.1em 0.4em; - margin: 0 0; - text-decoration: none; - background: black; - -webkit-border-radius: 1em; - -moz-border-radius: 1em; + padding: 5px 0.4em; } #overview { diff -r 861756e85b16 -r 137d93848139 templates/tracks/browser.mako --- a/templates/tracks/browser.mako Tue Mar 16 16:03:28 2010 -0400 +++ b/templates/tracks/browser.mako Tue Mar 16 18:54:23 2010 -0400 @@ -51,8 +51,12 @@ </select> <input id="low" size="12" />:<input id="high" size="12" /> <input type="hidden" name="id" value="${config.get('vis_id', '')}" /> - <a href="#" onclick="javascript:view.zoom_in();view.redraw();">+</a> - <a href="#" onclick="javascript:view.zoom_out();view.redraw();">-</a> + <a href="#" onclick="javascript:view.zoom_in();view.redraw();"> + <img src="${h.url_for('/static/images/fugue/magnifier-zoom.png')}" /> + </a> + <a href="#" onclick="javascript:view.zoom_out();view.redraw();"> + <img src="${h.url_for('/static/images/fugue/magnifier-zoom-out.png')}" /> + </a> </form> <div id="debug" style="float: right"></div> </div> @@ -91,7 +95,7 @@ view = new View( "${config.get('chrom')}", "${config.get('title') | h}", "${config.get('vis_id')}", "${config.get('dbkey')}" ); %for track in config.get('tracks'): view.add_track( - new ${track["track_type"]}( "${track['name'] | h}", ${track['dataset_id']}, "${track['indexer']}", ${track['prefs']} ) + new ${track["track_type"]}( "${track['name'] | h}", ${track['dataset_id']}, ${track['prefs']} ) ); %endfor init(); @@ -131,7 +135,7 @@ $("#content").bind("mousewheel", function( e, delta ) { if (delta > 0) { - view.zoom_in(e.pageX); + view.zoom_in(e.pageX, $("#viewport-container")); } else { view.zoom_out(); } @@ -139,7 +143,7 @@ }); $("#content").bind("dblclick", function( e ) { - view.zoom_in(e.pageX); + view.zoom_in(e.pageX, $("#viewport-container")); }); // To let the overview box be draggable @@ -210,13 +214,13 @@ var td = track_data; switch(track_data.track_type) { case "LineTrack": - new_track = new LineTrack( track_data.name, track_data.dataset_id, track_data.indexer, track_data.prefs ); + new_track = new LineTrack( track_data.name, track_data.dataset_id, track_data.prefs ); break; case "FeatureTrack": - new_track = new FeatureTrack( track_data.name, track_data.dataset_id, track_data.indexer, track_data.prefs ); + new_track = new FeatureTrack( track_data.name, track_data.dataset_id, track_data.prefs ); break; case "ReadTrack": - new_track = new ReadTrack( track_data.name, track_data.dataset_id, track_data.indexer, track_data.prefs ); + new_track = new ReadTrack( track_data.name, track_data.dataset_id, track_data.prefs ); break; } view.add_track(new_track); @@ -245,7 +249,6 @@ payload.push( { "track_type": track.track_type, - "indexer": track.indexer, "name": track.name, "dataset_id": track.dataset_id, "prefs": track.prefs @@ -286,6 +289,7 @@ return v.chrom === view.chrom; })[0]; view.max_high = found.len; + view.reset(); view.redraw(true); for (var track_id in view.tracks) { @@ -307,13 +311,12 @@ del_icon = $('<a href="#" class="icon-button delete" />'), edit_icon = $('<a href="#" class="icon-button edit" />'), body = $('<div class="historyItemBody"></div>'), - checkbox = $('<input type="checkbox" checked="checked"></input>').attr("id", "track_" + track_id + "title"), li = $('<li class="sortable"></li>').attr("id", "track_" + track_id), div = $('<div class="historyItemContainer historyItem"></div>'), - editable = $('<div style="display:none"></div>'); + editable = $('<div style="display:none"></div>').attr("id", "track_" + track_id + "_editable"); edit_icon.bind("click", function() { - editable.toggle(); + $("#track_" + track_id + "_editable").toggle(); }); del_icon.bind("click", function() {

1 0

[hg] galaxy 3540: Fix for editing library templates, add a new f...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/861756e85b16 changeset: 3540:861756e85b16 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Tue Mar 16 16:03:28 2010 -0400 description: Fix for editing library templates, add a new functional test to cover the scenario, and some code cleanup. diffstat: lib/galaxy/web/controllers/library_admin.py | 2 +- lib/galaxy/web/controllers/library_common.py | 1 - templates/library/common/browse_library.mako | 10 +- test/base/test_db_util.py | 9 --- test/base/twilltestcase.py | 20 +++++- test/functional/test_library_features.py | 84 +++++++++++++++++++-------- 6 files changed, 82 insertions(+), 44 deletions(-) diffs (366 lines): diff -r 4a670e8f4248 -r 861756e85b16 lib/galaxy/web/controllers/library_admin.py --- a/lib/galaxy/web/controllers/library_admin.py Tue Mar 16 15:32:05 2010 -0400 +++ b/lib/galaxy/web/controllers/library_admin.py Tue Mar 16 16:03:28 2010 -0400 @@ -34,7 +34,7 @@ template='/admin/library/grid.mako' default_sort_key = "name" columns = [ - NameColumn( "Library Name", + NameColumn( "Name", key="name", model_class=model.Library, link=( lambda library: dict( operation="browse", id=library.id ) ), diff -r 4a670e8f4248 -r 861756e85b16 lib/galaxy/web/controllers/library_common.py --- a/lib/galaxy/web/controllers/library_common.py Tue Mar 16 15:32:05 2010 -0400 +++ b/lib/galaxy/web/controllers/library_common.py Tue Mar 16 16:03:28 2010 -0400 @@ -1616,7 +1616,6 @@ response_redirect=web.url_for( controller='library_common', action='edit_template', cntrller=cntrller, - use_panels=use_panels, item_type=item_type, library_id=library_id, folder_id=folder_id, diff -r 4a670e8f4248 -r 861756e85b16 templates/library/common/browse_library.mako --- a/templates/library/common/browse_library.mako Tue Mar 16 15:32:05 2010 -0400 +++ b/templates/library/common/browse_library.mako Tue Mar 16 16:03:28 2010 -0400 @@ -445,11 +445,11 @@ %endif %if cntrller == 'library_admin': <a class="action-button" confirm="Click OK to delete the library named '${library.name}'." href="${h.url_for( controller='library_admin', action='delete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( library.id ), item_type='library' )}">Delete this data library</a> - %endif - %if show_deleted: - <a class="action-button" href="${h.url_for( controller='library_common', action='browse_library', cntrller=cntrller, id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=False )}">Hide deleted items</a> - %else: - <a class="action-button" href="${h.url_for( controller='library_common', action='browse_library', cntrller=cntrller, id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=True )}">Show deleted items</a> + %if show_deleted: + <a class="action-button" href="${h.url_for( controller='library_common', action='browse_library', cntrller=cntrller, id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=False )}">Hide deleted items</a> + %else: + <a class="action-button" href="${h.url_for( controller='library_common', action='browse_library', cntrller=cntrller, id=trans.security.encode_id( library.id ), use_panels=use_panels, show_deleted=True )}">Show deleted items</a> + %endif %endif %elif cntrller == 'library_admin' and not library.purged: <a class="action-button" href="${h.url_for( controller='library_admin', action='undelete_library_item', library_id=trans.security.encode_id( library.id ), item_id=trans.security.encode_id( library.id ), item_type='library', use_panels=use_panels )}">Undelete this data library</a> diff -r 4a670e8f4248 -r 861756e85b16 test/base/test_db_util.py --- a/test/base/test_db_util.py Tue Mar 16 15:32:05 2010 -0400 +++ b/test/base/test_db_util.py Tue Mar 16 16:03:28 2010 -0400 @@ -112,12 +112,3 @@ .all() def refresh( obj ): sa_session.refresh( obj ) -def set_library_permissions( in_list ): - permissions_in = [] - permissions_out = [] - for k, v in galaxy.model.Library.permitted_actions.items(): - if k in in_list: - permissions_in.append( k ) - else: - permissions_out.append( k ) - return permissions_in, permissions_out diff -r 4a670e8f4248 -r 861756e85b16 test/base/twilltestcase.py --- a/test/base/twilltestcase.py Tue Mar 16 15:32:05 2010 -0400 +++ b/test/base/twilltestcase.py Tue Mar 16 16:03:28 2010 -0400 @@ -1630,7 +1630,6 @@ pass def create_library( self, name='Library One', description='This is Library One', synopsis='Synopsis for Library One' ): """Create a new library""" - self.home() self.visit_url( "%s/library_admin/create_library" % self.url ) self.check_page_for_string( 'Create a new data library' ) tc.fv( "1", "name", name ) @@ -1640,10 +1639,25 @@ check_str = "The new library named '%s' has been created" % name self.check_page_for_string( check_str ) self.home() + def edit_template( self, cntrller, item_type, library_id, folder_id='', ldda_id='', action='add_field', + field_name='', field_name_value='', field_help='', field_help_value='', + field_type='', field_type_value='' ): + """Edit the form fields defining a library template""" + self.visit_url( "%s/library_common/edit_template?cntrller=%s&item_type=%s&library_id=%s" % \ + ( self.url, cntrller, item_type, library_id ) ) + self.check_page_for_string( "Edit form definition" ) + if action == 'add_field': + tc.submit( 'add_field_button' ) + tc.fv( '1', field_name, field_name_value ) + tc.fv( '1', field_help, field_help_value ) + tc.fv( '1', field_type, field_type_value ) + tc.submit( 'save_changes_button' ) + self.check_page_for_string( "The template for this data library has been updated with your changes." ) + if action == 'add_field': + self.check_page_for_string( field_name_value ) def library_info( self, cntrller, library_id, library_name, new_name='', new_description='', new_synopsis='', ele_1_field_name='', ele_1_contents='', ele_2_field_name='', ele_2_contents='', check_str1='' ): """Edit information about a library, optionally using an existing template with up to 2 elements""" - self.home() self.visit_url( "%s/library_common/library_info?cntrller=%s&id=%s" % ( self.url, cntrller, library_id ) ) if check_str1: self.check_page_for_string( check_str1 ) @@ -1866,7 +1880,7 @@ self.visit_url( url ) self.check_page_for_string( 'Upload a directory of files' ) if check_str1: - self.check_page_for_strin( check_str1 ) + self.check_page_for_string( check_str1 ) tc.fv( "1", "folder_id", folder_id ) tc.fv( "1", "file_type", file_type ) tc.fv( "1", "dbkey", dbkey ) diff -r 4a670e8f4248 -r 861756e85b16 test/functional/test_library_features.py --- a/test/functional/test_library_features.py Tue Mar 16 15:32:05 2010 -0400 +++ b/test/functional/test_library_features.py Tue Mar 16 16:03:28 2010 -0400 @@ -9,21 +9,29 @@ global regular_user1 regular_user1 = get_user( 'test1(a)bx.psu.edu' ) assert regular_user1 is not None, 'Problem retrieving user with email "test1(a)bx.psu.edu" from the database' + global regular_user1_private_role + regular_user1_private_role = get_private_role( regular_user1 ) self.logout() self.login( email='test2(a)bx.psu.edu' ) global regular_user2 regular_user2 = get_user( 'test2(a)bx.psu.edu' ) assert regular_user2 is not None, 'Problem retrieving user with email "test2(a)bx.psu.edu" from the database' + global regular_user2_private_role + regular_user2_private_role = get_private_role( regular_user2 ) self.logout() self.login( email='test3(a)bx.psu.edu' ) global regular_user3 regular_user3 = get_user( 'test3(a)bx.psu.edu' ) assert regular_user3 is not None, 'Problem retrieving user with email "test3(a)bx.psu.edu" from the database' + global regular_user3_private_role + regular_user3_private_role = get_private_role( regular_user3 ) self.logout() self.login( email='test(a)bx.psu.edu' ) global admin_user admin_user = get_user( 'test(a)bx.psu.edu' ) assert admin_user is not None, 'Problem retrieving user with email "test(a)bx.psu.edu" from the database' + global admin_user_private_role + admin_user_private_role = get_private_role( admin_user ) def test_005_create_library( self ): """Testing creating a new library, then renaming it""" # Logged in as admin_user @@ -100,7 +108,6 @@ self.security.encode_id( library_one.id ), library_one.name, check_str1=contents ) - contents = '%s library contents' % form_one_field_label contents_edited = contents + ' edited' # Edit the contents and then save them self.library_info( 'library_admin', @@ -113,7 +120,25 @@ self.security.encode_id( library_one.id ), library_one.name, check_str1=contents_edited ) - def test_020_add_public_dataset_to_root_folder( self ): + def test_020_edit_template_admin_view( self ): + """Test editing the layout of a template from the Admin view""" + # Since there is only 1 field currently in the form definition, we'll add another + field_name = 'field_name_1' + field_name_value = 'Field 1' + field_help = 'field_helptext_1' + field_help_value = 'Field 1 help' + field_type = 'field_type_1' + field_type_value = 'TextArea' + self.edit_template( 'library_admin', + 'library', + self.security.encode_id( library_one.id ), + field_name=field_name, + field_name_value=field_name_value, + field_help=field_help, + field_help_value=field_help_value, + field_type=field_type, + field_type_value=field_type_value ) + def test_025_add_public_dataset_to_root_folder( self ): """Testing adding a public dataset to the root folder, making sure library template is inherited""" # Logged in as admin_user message = 'Testing adding a public dataset to the root folder' @@ -145,7 +170,7 @@ self.security.encode_id( ldda_one.id ), ldda_one.name, check_str1=template_contents ) - def test_025_add_new_folder_to_root_folder( self ): + def test_030_add_new_folder_to_root_folder( self ): """Testing adding a folder to a library root folder""" # logged in as admin_user root_folder = library_one.root_folder @@ -177,7 +202,7 @@ self.security.encode_id( library_one.id ), field_name=form_one_field_name, contents=template_contents ) - def test_030_add_subfolder_to_folder( self ): + def test_035_add_subfolder_to_folder( self ): """Testing adding a folder to a library folder""" # logged in as admin_user name = "Folder One's Subfolder" @@ -208,7 +233,7 @@ self.security.encode_id( library_one.id ), field_name=form_one_field_name, contents=template_contents ) - def test_035_add_2nd_new_folder_to_root_folder( self ): + def test_040_add_2nd_new_folder_to_root_folder( self ): """Testing adding a 2nd folder to a library root folder""" # logged in as admin_user root_folder = library_one.root_folder @@ -226,7 +251,7 @@ self.security.encode_id( library_one.id ), check_str1=name, check_str2=description ) - def test_040_add_public_dataset_to_root_folders_2nd_subfolder( self ): + def test_045_add_public_dataset_to_root_folders_2nd_subfolder( self ): """Testing adding a public dataset to the root folder's 2nd sub-folder""" # Logged in as admin_user message = "Testing adding a public dataset to the folder named %s" % folder_two.name @@ -258,7 +283,7 @@ self.security.encode_id( ldda_two.id ), ldda_two.name, check_str1=template_contents ) - def test_045_add_2nd_public_dataset_to_root_folders_2nd_subfolder( self ): + def test_050_add_2nd_public_dataset_to_root_folders_2nd_subfolder( self ): """Testing adding a 2nd public dataset to the root folder's 2nd sub-folder""" # Logged in as admin_user message = "Testing adding a 2nd public dataset to the folder named %s" % folder_two.name @@ -290,7 +315,7 @@ self.security.encode_id( ldda_three.id ), ldda_three.name, check_str1=template_contents ) - def test_050_copy_dataset_from_history_to_subfolder( self ): + def test_055_copy_dataset_from_history_to_subfolder( self ): """Testing copying a dataset from the current history to a subfolder""" # logged in as admin_user self.new_history() @@ -314,7 +339,7 @@ ldda_four.name, check_str1=form_one_field_name, not_displayed=contents ) - def test_055_editing_dataset_attribute_info( self ): + def test_060_editing_dataset_attribute_info( self ): """Testing editing a library dataset's attribute information""" # logged in as admin_user new_ldda_name = '4.bed ( version 1 )' @@ -335,7 +360,7 @@ ldda_four.name, check_str1=form_one_field_name, not_displayed=contents ) - def test_060_uploading_new_dataset_version( self ): + def test_065_uploading_new_dataset_version( self ): """Testing uploading a new version of a library dataset""" # logged in as admin_user message = 'Testing uploading a new version of a dataset' @@ -384,22 +409,32 @@ self.browse_library( 'library_admin', self.security.encode_id( library_one.id ), not_displayed=ldda_four.name ) - def test_065_upload_directory_of_files_from_libraries_view( self ): + def test_070_upload_directory_of_files_from_libraries_view( self ): """Testing uploading a directory of files to a root folder from the Data Libraries view""" # logged in as admin_user # admin_user will not have the option to upload a directory of files from the # Libraries view since a sub-directory named the same as their email is not contained - # in the configured user_library_import_dir. However, since members of role_one have - # the LIBRARY_ADD permission, we can test this feature as regular_user1 or regular_user3 + # in the configured user_library_import_dir ( in the test_data directory, only regular_user1 + # and regular_user3 have directories ). We'll need to give these 2 user LIBRARY_ADD permission + # on library_one to test this feature. + permissions_in = [ 'LIBRARY_ADD' ] + permissions_out = [ 'LIBRARY_ACCESS', 'LIBRARY_MODIFY', 'LIBRARY_MANAGE' ] + role_ids = '%s,%s' % ( str( regular_user1_private_role.id ), str( regular_user3_private_role.id ) ) + # Role one members are: admin_user, regular_user1, regular_user3. Each of these users will be permitted for + # LIBRARY_ACCESS, LIBRARY_ADD, LIBRARY_MODIFY, LIBRARY_MANAGE on this library and it's contents. + self.library_permissions( self.security.encode_id( library_one.id ), + library_one.name, + role_ids, + permissions_in, + permissions_out ) self.logout() + # Now that we have permissions set on the library, we can proceed to test uploading files self.login( email=regular_user1.email ) message = 'Uploaded all files in test-data/users/test1...' # Since regular_user1 does not have any sub-directories contained within her configured # user_library_import_dir, the only option in her server_dir select list will be the # directory named the same as her email check_str_after_submit = "Added 1 datasets to the library '%s' (each is selected)." % library_one.root_folder.name - # TODO: gvk( 3/12/10 )this is broken, so commenting until I have time to discover why... - """ self.upload_directory_of_files( 'library', self.security.encode_id( library_one.id ), self.security.encode_id( library_one.root_folder.id ), @@ -426,8 +461,7 @@ self.security.encode_id( library_one.id ), check_str1=regular_user3.email, check_str2=message ) - """ - def test_070_download_archive_of_library_files( self ): + def test_075_download_archive_of_library_files( self ): """Testing downloading an archive of files from the library""" # logged in as regular_user3 self.logout() @@ -439,7 +473,7 @@ format=format ) self.check_archive_contents( archive, ( ldda_one, ldda_two ) ) os.remove( archive ) - def test_075_mark_dataset_deleted( self ): + def test_080_mark_dataset_deleted( self ): """Testing marking a library dataset as deleted""" # Logged in as admin_user self.delete_library_item( self.security.encode_id( library_one.id ), @@ -449,7 +483,7 @@ self.browse_library( 'library_admin', self.security.encode_id( library_one.id ), not_displayed=ldda_two.name ) - def test_080_display_and_hide_deleted_dataset( self ): + def test_085_display_and_hide_deleted_dataset( self ): """Testing displaying and hiding a deleted library dataset""" # Logged in as admin_user self.browse_library( 'library_admin', @@ -459,7 +493,7 @@ self.browse_library( 'library_admin', self.security.encode_id( library_one.id ), not_displayed=ldda_two.name ) - def test_085_mark_folder_deleted( self ): + def test_090_mark_folder_deleted( self ): """Testing marking a library folder as deleted""" # Logged in as admin_user self.delete_library_item( self.security.encode_id( library_one.id ), @@ -469,7 +503,7 @@ self.browse_library( 'library_admin', self.security.encode_id( library_one.id ), not_displayed=folder_two.name ) - def test_090_mark_folder_undeleted( self ): + def test_095_mark_folder_undeleted( self ): """Testing marking a library folder as undeleted""" # Logged in as admin_user self.undelete_library_item( self.security.encode_id( library_one.id ), @@ -482,7 +516,7 @@ self.security.encode_id( library_one.id ), check_str1=folder_two.name, not_displayed=ldda_two.name ) - def test_095_mark_library_deleted( self ): + def test_100_mark_library_deleted( self ): """Testing marking a library as deleted""" # Logged in as admin_user # First mark folder_two as deleted to further test state saving when we undelete the library @@ -496,7 +530,7 @@ item_type='library' ) self.browse_libraries_admin( not_displayed1=library_one.name ) self.browse_libraries_admin( deleted=True, check_str1=library_one.name ) - def test_100_mark_library_undeleted( self ): + def test_105_mark_library_undeleted( self ): """Testing marking a library as undeleted""" # Logged in as admin_user self.undelete_library_item( self.security.encode_id( library_one.id ), @@ -508,7 +542,7 @@ self.security.encode_id( library_one.id ), check_str1=library_one.name, not_displayed=folder_two.name ) - def test_105_purge_library( self ): + def test_110_purge_library( self ): """Testing purging a library""" # Logged in as admin_user self.delete_library_item( self.security.encode_id( library_one.id ), @@ -547,7 +581,7 @@ raise AssertionError( 'The library_dataset id %s named "%s" has not been marked as deleted.' % \ ( str( library_dataset.id ), library_dataset.name ) ) check_folder( library_one.root_folder ) - def test_110_no_library_template( self ): + def test_115_no_library_template( self ): """Test library features when library has no template""" # Logged in as admin_user name = "library features Library Two"

1 0

[hg] galaxy 3539: Fix for 'add' action in act_on_multiple_datase...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/4a670e8f4248 changeset: 3539:4a670e8f4248 user: fubar: ross Lazarus at gmail period com date: Tue Mar 16 15:32:05 2010 -0400 description: Fix for 'add' action in act_on_multiple_datasets - and a warning message if any bogus action supplied - fixes issue #297 diffstat: lib/galaxy/web/controllers/library_common.py | 7 +++++-- 1 files changed, 5 insertions(+), 2 deletions(-) diffs (31 lines): diff -r aad7b294ffca -r 4a670e8f4248 lib/galaxy/web/controllers/library_common.py --- a/lib/galaxy/web/controllers/library_common.py Tue Mar 16 15:09:22 2010 -0400 +++ b/lib/galaxy/web/controllers/library_common.py Tue Mar 16 15:32:05 2010 -0400 @@ -1257,7 +1257,7 @@ messagetype = 'error' else: ldda_ids = util.listify( ldda_ids ) - if action == 'import_to_history': + if action == 'import_to_history' or action == 'add': history = trans.get_history() if history is None: # Must be a bot sending a request without having a history. @@ -1308,7 +1308,7 @@ trans.sa_session.add( ld ) trans.sa_session.flush() msg = "The selected datasets have been removed from this data library" - else: + elif action in ['zip','tgz','tbz']: error = False killme = string.punctuation + string.whitespace trantab = string.maketrans(killme,'_'*len(killme)) @@ -1416,6 +1416,9 @@ archive.wsgi_status = trans.response.wsgi_status() archive.wsgi_headeritems = trans.response.wsgi_headeritems() return archive.stream + else: # unknown action + msg = '### unknown action = %s in act_on_multiple_datasets' % action + return trans.response.send_redirect( web.url_for( controller='library_common', action='browse_library', cntrller=cntrller,

1 0

[hg] galaxy 3538: Add magnifier icons for trackster
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/aad7b294ffca changeset: 3538:aad7b294ffca user: Kanwei Li <kanwei(a)gmail.com> date: Tue Mar 16 15:09:22 2010 -0400 description: Add magnifier icons for trackster diffstat: static/images/fugue/magnifier-zoom-out.png | 0 static/images/fugue/magnifier-zoom.png | 0 2 files changed, 0 insertions(+), 0 deletions(-) diffs (4 lines): diff -r 2fa5488a9b3e -r aad7b294ffca static/images/fugue/magnifier-zoom-out.png Binary file static/images/fugue/magnifier-zoom-out.png has changed diff -r 2fa5488a9b3e -r aad7b294ffca static/images/fugue/magnifier-zoom.png Binary file static/images/fugue/magnifier-zoom.png has changed

1 0

[hg] galaxy 3537: Monkeypatch pkg_resources to put eggs at the b...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/2fa5488a9b3e changeset: 3537:2fa5488a9b3e user: Nate Coraor <nate(a)bx.psu.edu> date: Tue Mar 16 14:07:42 2010 -0400 description: Monkeypatch pkg_resources to put eggs at the beginning of the path instead of the end diffstat: lib/galaxy/__init__.py | 31 +++++++++++++++++++++++++++++++ 1 files changed, 31 insertions(+), 0 deletions(-) diffs (38 lines): diff -r d776beca95f8 -r 2fa5488a9b3e lib/galaxy/__init__.py --- a/lib/galaxy/__init__.py Tue Mar 16 12:00:10 2010 -0400 +++ b/lib/galaxy/__init__.py Tue Mar 16 14:07:42 2010 -0400 @@ -61,3 +61,34 @@ except: pkg_resources._compatible_platforms = pkg_resources.compatible_platforms pkg_resources.compatible_platforms = _compatible_platforms + +# patch to insert eggs at the beginning of sys.path instead of at the end +def _insert_on(self, path, loc = None): + """Insert self.location in path before its nearest parent directory""" + + loc = loc or self.location + if not loc: + return + + nloc = pkg_resources._normalize_cached(loc) + npath= [(p and pkg_resources._normalize_cached(p) or p) for p in path] + + if path is sys.path: + self.check_version_conflict() + path.insert(0, loc) + + # remove dups + while 1: + try: + np = npath.index(nloc, 1) + except ValueError: + break + else: + del npath[np], path[np] + + return +try: + assert pkg_resources.Distribution._insert_on +except: + pkg_resources.Distribution._insert_on = pkg_resources.Distribution.insert_on + pkg_resources.Distribution.insert_on = _insert_on

1 0

[hg] galaxy 3535: Fixes user info functional tests broken in cha...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/15fd40238cef changeset: 3535:15fd40238cef user: rc date: Tue Mar 16 09:50:13 2010 -0400 description: Fixes user info functional tests broken in changeset 3529:96ec861b4b6e diffstat: test/base/twilltestcase.py | 23 ++++++++++++----------- 1 files changed, 12 insertions(+), 11 deletions(-) diffs (48 lines): diff -r 447c059a096a -r 15fd40238cef test/base/twilltestcase.py --- a/test/base/twilltestcase.py Mon Mar 15 15:06:14 2010 -0400 +++ b/test/base/twilltestcase.py Tue Mar 16 09:50:13 2010 -0400 @@ -806,17 +806,18 @@ self.visit_page( "user/create?user_info_select=%i&admin_view=False" % user_info_form_id ) else: self.visit_page( "user/create?admin_view=False" ) + print self.write_temp_file( self.last_page() ) self.check_page_for_string( "Create account" ) - tc.fv( "1", "email", email ) - tc.fv( "1", "password", password ) - tc.fv( "1", "confirm", password ) - tc.fv( "1", "username", username ) + tc.fv( "2", "email", email ) + tc.fv( "2", "password", password ) + tc.fv( "2", "confirm", password ) + tc.fv( "2", "username", username ) if user_info_forms == 'multiple': self.check_page_for_string( "User type" ) for index, info_value in enumerate(user_info_values): - tc.fv( "1", "field_%i" % index, info_value ) + tc.fv( "2", "field_%i" % index, info_value ) tc.submit( "create_user_button" ) - self.check_page_for_string( "now logged in as %s" % email ) + self.check_page_for_string( "ogged in as %s" % email ) def create_user_with_info_as_admin( self, email, password, username, user_info_forms, user_info_form_id, user_info_values ): ''' This method registers a new user and also provides use info as an admin @@ -827,14 +828,14 @@ else: self.visit_page( "admin/users?operation=create" ) self.check_page_for_string( "Create account" ) - tc.fv( "1", "email", email ) - tc.fv( "1", "password", password ) - tc.fv( "1", "confirm", password ) - tc.fv( "1", "username", username ) + tc.fv( "2", "email", email ) + tc.fv( "2", "password", password ) + tc.fv( "2", "confirm", password ) + tc.fv( "2", "username", username ) if user_info_forms == 'multiple': self.check_page_for_string( "User type" ) for index, info_value in enumerate(user_info_values): - tc.fv( "1", "field_%i" % index, info_value ) + tc.fv( "2", "field_%i" % index, info_value ) tc.submit( "create_user_button" ) self.check_page_for_string( "Created new user account (%s)" % email ) def edit_login_info( self, new_email, new_username ):

1 0

[hg] galaxy 3536: Fixes to item embedding in pages. In particula...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/d776beca95f8 changeset: 3536:d776beca95f8 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Tue Mar 16 12:00:10 2010 -0400 description: Fixes to item embedding in pages. In particular, fixed the editor color changes that were occurring when moving the cursor through embedded items. diffstat: static/june_2007_style/blue/embed_item.css | 16 ++++++++++------ static/june_2007_style/embed_item.css.tmpl | 25 ++++++++++++++++++++++++- static/wymeditor/iframe/galaxy/wymiframe.css | 12 +++++++++--- templates/embed_base.mako | 2 +- templates/page/editor.mako | 11 ++++++----- templates/workflow/embed.mako | 1 + 6 files changed, 51 insertions(+), 16 deletions(-) diffs (177 lines): diff -r 15fd40238cef -r d776beca95f8 static/june_2007_style/blue/embed_item.css --- a/static/june_2007_style/blue/embed_item.css Tue Mar 16 09:50:13 2010 -0400 +++ b/static/june_2007_style/blue/embed_item.css Tue Mar 16 12:00:10 2010 -0400 @@ -1,10 +1,14 @@ -.embedded-item{margin-left:auto;margin-right:auto;width:90%;padding: 0.5em;-moz-border-radius:0.5em;-webkit-border-radius:0.5em;border-radius:0.5em;} -.embedded-item.history{background-color:#C1C9E5} -.embedded-item.dataset{background-color:#CFC} -.embedded-item.workflow{background-color:#EBD9B2} +.embedded-item{margin-left:auto;margin-right:auto;width:90%;-moz-border-radius:0.5em;-webkit-border-radius:0.5em;border-radius:0.5em;} +.embedded-item.display {padding: 0.5em;} +.embedded-item.history{background-color:#C1C9E5} +.embedded-item.history p{background:#C1C9E5 no-repeat 2px 2px;margin-top:0;margin-bottom:0;} +.embedded-item.dataset{background-color:#CFC} +.embedded-item.dataset p{background:#CFC no-repeat 2px 2px;margin-top:0;margin-bottom:0;} +.embedded-item.workflow{background-color:#EBD9B2} +.embedded-item.workflow p{background:#EBD9B2 no-repeat 2px 2px;margin-top:0;margin-bottom:0;} .embedded-item.placeholder{} -.embedded-item .item-content{max-height:25em;overflow:auto;} -.embedded-item .title{vertical-align:top;text-align:center;} +.embedded-item .item-content{max-height:25em;overflow:auto;display:none;} +.embedded-item .title{vertical-align:top;text-align:center;font-weight:bold;} .embedded-item.placeholder .content{padding: 1em 1em;font-style:italic;text-align:center;} table.annotated-item{width:100%;border-collapse:collapse;} table.annotated-item td,th{padding:0;} diff -r 15fd40238cef -r d776beca95f8 static/june_2007_style/embed_item.css.tmpl --- a/static/june_2007_style/embed_item.css.tmpl Tue Mar 16 09:50:13 2010 -0400 +++ b/static/june_2007_style/embed_item.css.tmpl Tue Mar 16 12:00:10 2010 -0400 @@ -1,35 +1,58 @@ + .embedded-item { margin-left:auto; margin-right:auto; width:90%; - padding: 0.5em; -moz-border-radius:0.5em; -webkit-border-radius:0.5em; border-radius:0.5em; } +.embedded-item.display { + padding: 0.5em; +} + .embedded-item.history { background-color:#C1C9E5 } +.embedded-item.history p { + background:#C1C9E5 no-repeat 2px 2px; + margin-top:0; + margin-bottom:0; +} + .embedded-item.dataset { background-color:#CFC } +.embedded-item.dataset p { + background:#CFC no-repeat 2px 2px; + margin-top:0;margin-bottom:0; +} + .embedded-item.workflow { background-color:#EBD9B2 } +.embedded-item.workflow p { + background:#EBD9B2 no-repeat 2px 2px; + margin-top:0; + margin-bottom:0; +} + .embedded-item.placeholder{} .embedded-item .item-content { max-height: 25em; overflow: auto; + display: none; } .embedded-item .title { vertical-align:top; text-align:center; + font-weight: bold; } .embedded-item.placeholder .content { diff -r 15fd40238cef -r d776beca95f8 static/wymeditor/iframe/galaxy/wymiframe.css --- a/static/wymeditor/iframe/galaxy/wymiframe.css Tue Mar 16 09:50:13 2010 -0400 +++ b/static/wymeditor/iframe/galaxy/wymiframe.css Tue Mar 16 12:00:10 2010 -0400 @@ -1,3 +1,7 @@ +/* + * JG: edited to remove '!important' from rules so that embedded Galaxy items can have unique background colors. + */ + /* * WYMeditor : what you see is What You Mean web-based editor * Copyright (c) 2005 - 2009 Jean-Francois Hovinne, http://www.wymeditor.org/ @@ -33,9 +37,9 @@ ol, table, blockquote, - pre { background: #FFFFFF no-repeat 2px 2px !important; - padding:8px 5px 5px !important; - margin:10px !important; } + pre { background: #FFFFFF no-repeat 2px 2px; /* JG removed: !important */ + padding:8px 5px 5px; /* JG removed: !important */ + margin:10px} /* JG removed: !important */ td { background: #F0F4F8; } th { background: #ffffcc; } ul, @@ -52,6 +56,7 @@ td { height: 1.6em; } /* labels */ +/* JG commented out: p { background-image: url(lbl-p.png); } h1 { background-image: url(lbl-h1.png); } h2 { background-image: url(lbl-h2.png); } @@ -61,6 +66,7 @@ h6 { background-image: url(lbl-h6.png); } blockquote{ background-image: url(lbl-blockquote.png); } pre { background-image: url(lbl-pre.png); } +*/ /* specific HTML elements */ caption { text-align: left; } diff -r 15fd40238cef -r d776beca95f8 templates/embed_base.mako --- a/templates/embed_base.mako Tue Mar 16 09:50:13 2010 -0400 +++ b/templates/embed_base.mako Tue Mar 16 12:00:10 2010 -0400 @@ -6,7 +6,7 @@ <%namespace file="/display_common.mako" import="*" /> ## HTML structure. -<div class='embedded-item ${get_class_display_name( item.__class__ ).lower()}'> +<div class='embedded-item display ${get_class_display_name( item.__class__ ).lower()}'> <div class='title'> ${self.render_title( item )} <hr/> diff -r 15fd40238cef -r d776beca95f8 templates/page/editor.mako --- a/templates/page/editor.mako Tue Mar 16 09:50:13 2010 -0400 +++ b/templates/page/editor.mako Tue Mar 16 12:00:10 2010 -0400 @@ -459,17 +459,18 @@ // all non-standard attributes when it returns its content (e.g. it will not return an element attribute of the form // item_class='History'). var item_embed_html = - "<p> \ + "\ <div id='" + item_info.iclass + "-" + item_id + "' class='embedded-item " + item_info.singular.toLowerCase() + " placeholder'> \ - <div class='title'> Embedded Galaxy " + item_info.singular + " '" + item_name + "'</div> \ - <div class='content'> \ + <p class='title'>Embedded Galaxy " + item_info.singular + " '" + item_name + "'</p> \ + <p class='content'> \ [Do not edit this block; Galaxy will fill it in with the annotated " + item_info.singular.toLowerCase() + " when it is displayed.]</div> \ - </div> \ - </div></p>"; + </p> \ + </div><p></p>"; // Insert embedded representation into document. + // TODO: maybe try replace() instead to handle indenting? wym.insert(item_embed_html); }); hide_modal(); diff -r 15fd40238cef -r d776beca95f8 templates/workflow/embed.mako --- a/templates/workflow/embed.mako Tue Mar 16 09:50:13 2010 -0400 +++ b/templates/workflow/embed.mako Tue Mar 16 12:00:10 2010 -0400 @@ -4,6 +4,7 @@ %> <%def name="render_summary_content( workflow, steps )"> + ## <ul> ## <% num_steps = len ( steps ) %> ## <li>${num_steps} step${iff( num_steps != 1, "s", "" )}

1 0

[hg] galaxy 3533: Add numpy egg, update bx_python egg (now with ...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/ac60740712de changeset: 3533:ac60740712de user: Nate Coraor <nate(a)bx.psu.edu> date: Mon Mar 15 14:35:35 2010 -0400 description: Add numpy egg, update bx_python egg (now with 100% more numpy) and include code that allows scrambling to depend on other eggs existing and being importable. diffstat: eggs.ini | 6 +- lib/galaxy/eggs/dist.py | 5 + lib/galaxy/eggs/scramble.py | 12 ++- lib/pkg_resources.py | 148 ++++++++++++++++++++++------------ scripts/dist-scramble.py | 13 +++ scripts/scramble.py | 12 ++- scripts/scramble/lib/scramble_lib.py | 36 +++----- scripts/scramble/scripts/generic.py | 1 + scripts/test_dist_egg.py | 53 ++++++++++++ 9 files changed, 207 insertions(+), 79 deletions(-) diffs (592 lines): diff -r cfb0776875c0 -r ac60740712de eggs.ini --- a/eggs.ini Mon Mar 15 14:05:25 2010 -0400 +++ b/eggs.ini Mon Mar 15 14:35:35 2010 -0400 @@ -16,6 +16,7 @@ Cheetah = 2.2.2 DRMAA_python = 0.2 MySQL_python = 1.2.3c1 +numpy = 1.3.0 pbs_python = 2.9.4 psycopg2 = 2.0.13 pycrypto = 2.0.1 @@ -59,7 +60,7 @@ psycopg2 = _8.4.2_static pysqlite = _3.6.17_static MySQL_python = _5.1.41_static -bx_python = _dev_3b9d30e47619 +bx_python = _dev_f74aec067563 GeneTrack = _dev_48da9e998f0caf01c5be731e926f4b0481f658f0 SQLAlchemy = _dev_r6498 pysam = _kanwei_90e03180969d @@ -70,3 +71,6 @@ MySQL_python = mysql-5.1.41 psycopg2 = postgresql-8.4.2 pysqlite = sqlite-amalgamation-3_6_17 + +[dependencies] +bx_python = numpy diff -r cfb0776875c0 -r ac60740712de lib/galaxy/eggs/dist.py --- a/lib/galaxy/eggs/dist.py Mon Mar 15 14:05:25 2010 -0400 +++ b/lib/galaxy/eggs/dist.py Mon Mar 15 14:35:35 2010 -0400 @@ -72,6 +72,10 @@ sources = self.config.get( 'source', name ).split() except: sources = [] + try: + dependencies = self.config.get( 'dependencies', name ).split() + except: + dependencies = [] if full_platform: platforms = self.platforms else: @@ -83,4 +87,5 @@ host_info = self.hosts[platform].split() egg.build_host, egg.python = host_info[:2] egg.sources = sources + egg.dependencies = dependencies self.eggs[name].append( egg ) diff -r cfb0776875c0 -r ac60740712de lib/galaxy/eggs/scramble.py --- a/lib/galaxy/eggs/scramble.py Mon Mar 15 14:05:25 2010 -0400 +++ b/lib/galaxy/eggs/scramble.py Mon Mar 15 14:35:35 2010 -0400 @@ -3,7 +3,7 @@ """ import os, sys, shutil, tempfile, subprocess, urlparse, urllib -from __init__ import Egg, Crate, URLRetriever, galaxy_dir, py, unpack_zipfile +from __init__ import Egg, Crate, URLRetriever, galaxy_dir, py, unpack_zipfile, EggNotFetchable from distutils.sysconfig import get_config_var import tarfile, zipfile, zlib @@ -37,6 +37,7 @@ def __init__( self, *args, **kwargs ): Egg.__init__( self, *args, **kwargs ) self.sources = [] + self.dependencies = [] self.buildpath = None self.source_path = None self.py = py @@ -184,6 +185,11 @@ tagfile = open( os.path.join( self.buildpath, ".galaxy_tag" ), "w" ) tagfile.write( self.tag + '\n' ) tagfile.close() + if self.dependencies: + depfile = open( os.path.join( self.buildpath, ".galaxy_deps" ), "w" ) + for dependency in self.dependencies: + depfile.write( dependency + '\n' ) + depfile.close() def run_scramble_script( self ): log.warning( "%s(): Beginning build" % sys._getframe().f_code.co_name ) # subprocessed to sterilize the env @@ -211,6 +217,10 @@ egg.sources = self.config.get( "source", egg.name ).split() except: egg.sources = [] + try: + egg.dependencies = self.config.get( "dependencies", egg.name ).split() + except: + egg.dependencies = [] def parse_egg_section( self, *args, **kwargs ): kwargs['egg_class'] = ScrambleEgg Crate.parse_egg_section( self, *args, **kwargs ) diff -r cfb0776875c0 -r ac60740712de lib/pkg_resources.py --- a/lib/pkg_resources.py Mon Mar 15 14:05:25 2010 -0400 +++ b/lib/pkg_resources.py Mon Mar 15 14:35:35 2010 -0400 @@ -13,26 +13,67 @@ method. """ -import sys, os, zipimport, time, re, imp, new +import sys, os, zipimport, time, re, imp try: frozenset except NameError: from sets import ImmutableSet as frozenset -from os import utime, rename, unlink # capture these to bypass sandboxing +# capture these to bypass sandboxing +from os import utime, rename, unlink, mkdir from os import open as os_open - - - - - - - - - - - +from os.path import isdir, split + + +def _bypass_ensure_directory(name, mode=0777): + # Sandbox-bypassing version of ensure_directory() + dirname, filename = split(name) + if dirname and filename and not isdir(dirname): + _bypass_ensure_directory(dirname) + mkdir(dirname, mode) + + + + + + + +_state_vars = {} + +def _declare_state(vartype, **kw): + g = globals() + for name, val in kw.iteritems(): + g[name] = val + _state_vars[name] = vartype + +def __getstate__(): + state = {} + g = globals() + for k, v in _state_vars.iteritems(): + state[k] = g['_sget_'+v](g[k]) + return state + +def __setstate__(state): + g = globals() + for k, v in state.iteritems(): + g['_sset_'+_state_vars[k]](k, g[k], v) + return state + +def _sget_dict(val): + return val.copy() + +def _sset_dict(key, ob, state): + ob.clear() + ob.update(state) + +def _sget_object(val): + return val.__getstate__() + +def _sset_object(key, ob, state): + ob.__setstate__(state) + +_sget_none = _sset_none = lambda *args: None @@ -164,14 +205,8 @@ def _macosx_vers(_cache=[]): if not _cache: - info = os.popen('/usr/bin/sw_vers').read().splitlines() - for line in info: - key, value = line.split(None, 1) - if key == 'ProductVersion:': - _cache.append(value.strip().split(".")) - break - else: - raise ValueError, "What?!" + from platform import mac_ver + _cache.append(mac_ver()[0].split('.')) return _cache[0] def _macosx_arch(machine): @@ -203,6 +238,12 @@ + + + + + + def compatible_platforms(provided,required): """Can code for the `provided` platform run on the `required` platform? @@ -387,7 +428,7 @@ def add_entry(self, entry): """Add a path item to ``.entries``, finding any distributions on it - ``find_distributions(entry,False)`` is used to find distributions + ``find_distributions(entry, True)`` is used to find distributions corresponding to the path entry, and they are added. `entry` is always appended to ``.entries``, even if it is already present. (This is because ``sys.path`` can contain the same value more than @@ -622,7 +663,6 @@ activated to fulfill the requirements; all relevant distributions are included, even if they were already activated in this working set. """ - needed = self.resolve(parse_requirements(requirements)) for dist in needed: @@ -630,7 +670,6 @@ return needed - def subscribe(self, callback): """Invoke `callback` for all distributions (including existing ones)""" if callback in self.callbacks: @@ -639,19 +678,21 @@ for dist in self: callback(dist) - def _added_new(self, dist): for callback in self.callbacks: callback(dist) - - - - - - - - + def __getstate__(self): + return ( + self.entries[:], self.entry_keys.copy(), self.by_key.copy(), + self.callbacks[:] + ) + + def __setstate__(self, (entries, keys, by_key, callbacks)): + self.entries = entries[:] + self.entry_keys = keys.copy() + self.by_key = by_key.copy() + self.callbacks = callbacks[:] class Environment(object): @@ -916,7 +957,7 @@ extract_path = self.extraction_path or get_default_cache() target_path = os.path.join(extract_path, archive_name+'-tmp', *names) try: - ensure_directory(target_path) + _bypass_ensure_directory(target_path) except: self.extraction_error() @@ -1188,7 +1229,9 @@ ) def _fn(self, base, resource_name): - return os.path.join(base, *resource_name.split('/')) + if resource_name: + return os.path.join(base, *resource_name.split('/')) + return base def _get(self, path): if hasattr(self.loader, 'get_data'): @@ -1226,8 +1269,6 @@ - - class DefaultProvider(EggProvider): """Provides access to package resources in the filesystem""" @@ -1597,7 +1638,7 @@ -_distribution_finders = {} +_declare_state('dict', _distribution_finders = {}) def register_finder(importer_type, distribution_finder): """Register `distribution_finder` to find distributions in sys.path items @@ -1646,7 +1687,7 @@ """Yield distributions accessible on a sys.path directory""" path_item = _normalize_cached(path_item) - if os.path.isdir(path_item): + if os.path.isdir(path_item) and os.access(path_item, os.R_OK): if path_item.lower().endswith('.egg'): # unpacked egg yield Distribution.from_filename( @@ -1679,8 +1720,8 @@ break register_finder(ImpWrapper,find_on_path) -_namespace_handlers = {} -_namespace_packages = {} +_declare_state('dict', _namespace_handlers = {}) +_declare_state('dict', _namespace_packages = {}) def register_namespace_handler(importer_type, namespace_handler): """Register `namespace_handler` to declare namespace packages @@ -1709,7 +1750,7 @@ return None module = sys.modules.get(packageName) if module is None: - module = sys.modules[packageName] = new.module(packageName) + module = sys.modules[packageName] = imp.new_module(packageName) module.__path__ = []; _set_parent_ns(packageName) elif not hasattr(module,'__path__'): raise TypeError("Not a package:", packageName) @@ -1862,7 +1903,7 @@ The algorithm assumes that strings like "-" and any alpha string that alphabetically follows "final" represents a "patch level". So, "2.4-1" is assumed to be a branch or patch of "2.4", and therefore "2.4.1" is - considered newer than "2.4-1", whic in turn is newer than "2.4". + considered newer than "2.4-1", which in turn is newer than "2.4". Strings like "a", "b", "c", "alpha", "beta", "candidate" and so on (that come before "final" alphabetically) are assumed to be pre-release versions, @@ -1871,7 +1912,8 @@ Finally, to handle miscellaneous cases, the strings "pre", "preview", and "rc" are treated as if they were "c", i.e. as though they were release candidates, and therefore are not as new as a version string that does not - contain them. + contain them, and "dev" is replaced with an '@' so that it sorts lower than + than any other pre-release tag. """ parts = [] for part in _parse_version_parts(s.lower()): @@ -2219,12 +2261,9 @@ if not loc: return - if path is sys.path: - self.check_version_conflict() - nloc = _normalize_cached(loc) bdir = os.path.dirname(nloc) - npath= map(_normalize_cached, path) + npath= [(p and _normalize_cached(p) or p) for p in path] bp = None for p, item in enumerate(npath): @@ -2232,10 +2271,14 @@ break elif item==bdir and self.precedence==EGG_DIST: # if it's an .egg, give it precedence over its directory + if path is sys.path: + self.check_version_conflict() path.insert(p, loc) npath.insert(p, nloc) break else: + if path is sys.path: + self.check_version_conflict() path.append(loc) return @@ -2252,7 +2295,6 @@ return - def check_version_conflict(self): if self.key=='setuptools': return # ignore the inevitable setuptools self-conflicts :( @@ -2266,7 +2308,7 @@ continue fn = getattr(sys.modules[modname], '__file__', None) - if fn and normalize_path(fn).startswith(loc): + if fn and (normalize_path(fn).startswith(loc) or fn.startswith(loc)): continue issue_warning( "Module %s was already imported from %s, but %s is being added" @@ -2443,7 +2485,7 @@ def __contains__(self,item): if isinstance(item,Distribution): - if item.key <> self.key: return False + if item.key != self.key: return False if self.index: item = item.parsed_version # only get if we need it elif isinstance(item,basestring): item = parse_version(item) @@ -2540,7 +2582,7 @@ os.open = old_open # and then put it back -# Set up global resource manager +# Set up global resource manager (deliberately not state-saved) _manager = ResourceManager() def _initialize(g): for name in dir(_manager): @@ -2549,7 +2591,7 @@ _initialize(globals()) # Prepare the master working set and make the ``require()`` API available -working_set = WorkingSet() +_declare_state('object', working_set = WorkingSet()) try: # Does the main program list any requirements? from __main__ import __requires__ diff -r cfb0776875c0 -r ac60740712de scripts/dist-scramble.py --- a/scripts/dist-scramble.py Mon Mar 15 14:05:25 2010 -0400 +++ b/scripts/dist-scramble.py Mon Mar 15 14:35:35 2010 -0400 @@ -32,6 +32,19 @@ failed = [] for egg in eggs: try: + for dependency in egg.dependencies: + print "Checking %s dependency: %s" % ( egg.name, dependency ) + # this could be in a better data structure... + dep = filter( lambda x: x.platform == egg.platform, c[dependency] )[0] + dep.resolve() + except EggNotFetchable, e: + degg = e.eggs[0] + print "%s build dependency %s %s %s couldn't be" % ( egg.name, degg.name, degg.version, degg.platform ) + print "downloaded automatically. There isn't really a graceful" + print "way to handle this when dist-scrambling." + failed.append( egg.platform ) + continue + try: egg.scramble() except ScrambleFailure: failed.append( egg.platform ) diff -r cfb0776875c0 -r ac60740712de scripts/scramble.py --- a/scripts/scramble.py Mon Mar 15 14:05:25 2010 -0400 +++ b/scripts/scramble.py Mon Mar 15 14:35:35 2010 -0400 @@ -14,7 +14,7 @@ lib = os.path.abspath( os.path.join( os.path.dirname( __file__ ), "..", "lib" ) ) sys.path.append( lib ) -from galaxy.eggs.scramble import ScrambleCrate, ScrambleFailure +from galaxy.eggs.scramble import ScrambleCrate, ScrambleFailure, EggNotFetchable c = ScrambleCrate() @@ -31,6 +31,16 @@ except: print "error: %s not in eggs.ini" % name sys.exit( 1 ) + for dependency in egg.dependencies: + print "Checking %s dependency: %s" % ( egg.name, dependency ) + try: + c[dependency].require() + except EggNotFetchable, e: + degg = e.eggs[0] + print "%s build dependency %s %s couldn't be downloaded" % ( egg.name, degg.name, degg.version ) + print "automatically. You can try building it by hand with:" + print " python scripts/scramble.py %s" % degg.name + sys.exit( 1 ) egg.scramble() sys.exit( 0 ) except ScrambleFailure, e: diff -r cfb0776875c0 -r ac60740712de scripts/scramble/lib/scramble_lib.py --- a/scripts/scramble/lib/scramble_lib.py Mon Mar 15 14:05:25 2010 -0400 +++ b/scripts/scramble/lib/scramble_lib.py Mon Mar 15 14:35:35 2010 -0400 @@ -21,6 +21,15 @@ except: return None +def get_deps(): + try: + depf = open( '.galaxy_deps', 'r' ) + except: + return [] + c = eggs.Crate() + for dep in depf: + c[dep.strip()].require() + def clean( extra_dirs=[] ): for dir in [ 'build', 'dist' ] + extra_dirs: try: @@ -127,29 +136,10 @@ else: return 'gcc' -# Monkeypatch pkg_resources for better ABI recognition -def _get_platform(): - plat = distutils.util._get_platform() - if sys.version_info[:2] == ( 2, 5 ) and \ - ( ( os.uname()[-1] in ( 'i386', 'ppc' ) and sys.platform == 'darwin' and os.path.abspath( sys.prefix ).startswith( '/System' ) ) or \ - ( sys.platform == 'darwin' and get_config_vars().get('UNIVERSALSDK', '').strip() ) ): - plat = 'macosx-10.3-fat' - if sys.platform == "sunos5" and not (plat.endswith('_32') or plat.endswith('_64')): - if sys.maxint > 2**31: - plat += '_64' - else: - plat += '_32' - if not (plat.endswith('-ucs2') or plat.endswith('-ucs4')): - if sys.maxunicode > 2**16: - plat += '-ucs4' - else: - plat += '-ucs2' - return plat -try: - assert distutil.util._get_platform -except: - distutils.util._get_platform = distutils.util.get_platform - distutils.util.get_platform = _get_platform +# get galaxy eggs lib +galaxy_lib = os.path.abspath( os.path.join( os.path.dirname( __file__ ), '..', '..', '..', 'lib' ) ) +sys.path.insert( 0, galaxy_lib ) +from galaxy import eggs # get setuptools from ez_setup import use_setuptools diff -r cfb0776875c0 -r ac60740712de scripts/scramble/scripts/generic.py --- a/scripts/scramble/scripts/generic.py Mon Mar 15 14:05:25 2010 -0400 +++ b/scripts/scramble/scripts/generic.py Mon Mar 15 14:35:35 2010 -0400 @@ -9,6 +9,7 @@ from scramble_lib import * tag = get_tag() # get the tag +get_deps() # require any dependent eggs clean() # clean up any existing stuff (could happen if you run scramble.py by hand) # reset args for distutils diff -r cfb0776875c0 -r ac60740712de scripts/test_dist_egg.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/scripts/test_dist_egg.py Mon Mar 15 14:35:35 2010 -0400 @@ -0,0 +1,53 @@ +#!/usr/bin/env python +""" +A crude script for minimal "testing" of dist eggs (require and import). It may +not work on all zipped eggs. It may be easiest to just customize this script +for whatever egg you want to test. + +usage: test_dist_egg.py <egg_name> +""" +import os, sys, logging, subprocess + +try: + assert sys.argv[1] +except: + print __doc__ + sys.exit( 1 ) + +lib = os.path.abspath( os.path.join( os.path.dirname( __file__ ), '..', 'lib' ) ) +sys.path.insert( 0, lib ) + +if sys.argv[1].endswith( '.egg' ): + + egg = sys.argv[1] + egg_name = os.path.basename( egg ).split( '-' )[0] + sys.path.insert( 0, egg ) + + import pkg_resources + pkg_resources.require( egg_name ) + provider = pkg_resources.get_provider( egg_name ) + importables = provider.get_metadata('top_level.txt').splitlines() + + for importable in importables: + mod = __import__( importable ) + assert os.path.dirname( mod.__path__[0] ) == os.path.dirname( provider.module_path ) + print "OK" + + sys.exit( 0 ) + +else: + + build_dir = os.path.join( os.path.dirname( os.path.abspath( __file__ ) ), 'scramble', 'build' ) + if os.path.exists( build_dir ): + raise Exception( 'Build dir must be removed before testing: %s' % build_dir ) + + name = sys.argv[1] + + from galaxy.eggs.dist import DistScrambleCrate + + c = DistScrambleCrate() + + for egg in c[name]: + print 'Checking %s %s for %s on %s' % ( name, egg.version, egg.platform, egg.build_host ) + p = subprocess.Popen( 'ssh %s %s %s %s %s' % ( egg.build_host, egg.python, os.path.abspath( __file__ ), egg.distribution.location, egg.platform ), shell=True ) + p.wait()

1 0

[hg] galaxy 3534: Fix a bug in removing conflicts from the eggs ...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/447c059a096a changeset: 3534:447c059a096a user: Nate Coraor <nate(a)bx.psu.edu> date: Mon Mar 15 15:06:14 2010 -0400 description: Fix a bug in removing conflicts from the eggs directory diffstat: lib/galaxy/eggs/__init__.py | 4 ++-- 1 files changed, 2 insertions(+), 2 deletions(-) diffs (21 lines): diff -r ac60740712de -r 447c059a096a lib/galaxy/eggs/__init__.py --- a/lib/galaxy/eggs/__init__.py Mon Mar 15 14:35:35 2010 -0400 +++ b/lib/galaxy/eggs/__init__.py Mon Mar 15 15:06:14 2010 -0400 @@ -2,7 +2,7 @@ Manage Galaxy eggs """ -import os, sys, glob, urllib, urllib2, ConfigParser, HTMLParser, zipimport, zipfile +import os, sys, shutil, glob, urllib, urllib2, ConfigParser, HTMLParser, zipimport, zipfile import logging log = logging.getLogger( __name__ ) @@ -281,7 +281,7 @@ for egg in eggs: try: egg.resolve() - except: + except EggNotFetchable: missing.append( egg ) if missing: raise EggNotFetchable( missing )

1 0

[hg] galaxy 3532: Fix migration script's default value for 'dele...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/cfb0776875c0 changeset: 3532:cfb0776875c0 user: jeremy goecks <jeremy.goecks(a)emory.edu> date: Mon Mar 15 14:05:25 2010 -0400 description: Fix migration script's default value for 'deleted' column in visualization table. Because visualizations are not in use yet, effects are small, and manual fix is easy, it's not necessary to use another migration script to fix this problem. Fix, then, is largely for reference purposes. diffstat: lib/galaxy/model/migrate/versions/0043_visualization_sharing_tagging_annotating.py | 4 +--- 1 files changed, 1 insertions(+), 3 deletions(-) diffs (15 lines): diff -r 3c124a19ae94 -r cfb0776875c0 lib/galaxy/model/migrate/versions/0043_visualization_sharing_tagging_annotating.py --- a/lib/galaxy/model/migrate/versions/0043_visualization_sharing_tagging_annotating.py Mon Mar 15 12:40:30 2010 -0400 +++ b/lib/galaxy/model/migrate/versions/0043_visualization_sharing_tagging_annotating.py Mon Mar 15 14:05:25 2010 -0400 @@ -54,10 +54,8 @@ log.debug( "Creating visualization_user_share_association table failed: %s" % str( e ) ) # Get default boolean value 'false' so that columns can be initialized. - if migrate_engine.name == 'mysql': + if migrate_engine.name == 'mysql' or migrate_engine.name == 'sqlite': default_false = "0" - elif migrate_engine.name == 'sqlite': - default_false = "'false'" elif migrate_engine.name == 'postgres': default_false = "false"

1 0

[hg] galaxy 3531: lims: automatic update of sample state when th...
by Greg Von Kuster 18 Mar '10

18 Mar '10

details: http://www.bx.psu.edu/hg/galaxy/rev/3c124a19ae94 changeset: 3531:3c124a19ae94 user: rc date: Mon Mar 15 12:40:30 2010 -0400 description: lims: automatic update of sample state when the state is changed in th db (using scanner etc) diffstat: lib/galaxy/web/controllers/requests_admin.py | 21 ++++++ templates/admin/requests/show_request.mako | 87 ++++++++++++++++++++++++--- templates/requests/sample_datasets.mako | 7 ++ templates/requests/sample_state.mako | 5 + 4 files changed, 109 insertions(+), 11 deletions(-) diffs (175 lines): diff -r 6d079d53f9db -r 3c124a19ae94 lib/galaxy/web/controllers/requests_admin.py --- a/lib/galaxy/web/controllers/requests_admin.py Mon Mar 15 11:31:14 2010 -0400 +++ b/lib/galaxy/web/controllers/requests_admin.py Mon Mar 15 12:40:30 2010 -0400 @@ -231,6 +231,27 @@ def index( self, trans ): return trans.fill_template( "/admin/requests/index.mako" ) + @web.json + def sample_state_updates( self, trans, ids=None, states=None ): + # Avoid caching + trans.response.headers['Pragma'] = 'no-cache' + trans.response.headers['Expires'] = '0' + # Create new HTML for any that have changed + rval = {} + if ids is not None and states is not None: + ids = map( int, ids.split( "," ) ) + states = states.split( "," ) + for id, state in zip( ids, states ): + sample = trans.sa_session.query( self.app.model.Sample ).get( id ) + if sample.current_state().name != state: + rval[id] = { + "state": sample.current_state().name, + "datasets": len(sample.dataset_files), + "html_state": unicode( trans.fill_template( "requests/sample_state.mako", sample=sample ), 'utf-8' ), + "html_datasets": unicode( trans.fill_template( "requests/sample_datasets.mako", trans=trans, sample=sample ), 'utf-8' ) + } + return rval + @web.expose @web.require_admin def list( self, trans, **kwd ): diff -r 6d079d53f9db -r 3c124a19ae94 templates/admin/requests/show_request.mako --- a/templates/admin/requests/show_request.mako Mon Mar 15 11:31:14 2010 -0400 +++ b/templates/admin/requests/show_request.mako Mon Mar 15 12:40:30 2010 -0400 @@ -1,5 +1,7 @@ <%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> +<%namespace file="/requests/sample_state.mako" import="render_sample_state" /> +<%namespace file="/requests/sample_datasets.mako" import="render_sample_datasets" /> %if msg: ${render_msg( msg, messagetype )} @@ -42,6 +44,54 @@ }); </script> +<script type="text/javascript"> + // Looks for changes in sample states using an async request. Keeps + // calling itself (via setTimeout) until all samples are in a terminal + // state. + var updater = function ( sample_states ) { + // Check if there are any items left to track + var empty = true; + for ( i in sample_states ) { + empty = false; + break; + } + if ( ! empty ) { + setTimeout( function() { updater_callback( sample_states ) }, 1000 ); + } + }; + var updater_callback = function ( sample_states ) { + // Build request data + var ids = [] + var states = [] + $.each( sample_states, function ( id, state ) { + ids.push( id ); + states.push( state ); + }); + // Make ajax call + $.ajax( { + type: "POST", + url: "${h.url_for( controller='requests_admin', action='sample_state_updates' )}", + dataType: "json", + data: { ids: ids.join( "," ), states: states.join( "," ) }, + success : function ( data ) { + $.each( data, function( id, val ) { + // Replace HTML + var cell1 = $("#sampleState-" + id); + cell1.html( val.html_state ); + var cell2 = $("#sampleDatasets-" + id); + cell2.html( val.html_datasets ); + sample_states[ parseInt(id) ] = val.state; + }); + updater( sample_states ); + }, + error: function() { + // Just retry, like the old method, should try to be smarter + updater( sample_states ); + } + }); + }; +</script> + <style type="text/css"> .msg_head { padding: 0px 0px; @@ -162,15 +212,21 @@ %if sample_index in range(len(request.samples)): <td>${info['name']}</td> <td>${info['barcode']}</td> - <td> - %if sample: - %if sample.request.unsubmitted(): - Unsubmitted - %else: - <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> - %endif - %endif - </td> + %if sample.request.unsubmitted(): + <td>Unsubmitted</td> + %else: + <td id="sampleState-${sample.id}">${render_sample_state( sample )}</td> + %endif + +## <td> +## %if sample: +## %if sample.request.unsubmitted(): +## Unsubmitted +## %else: +## <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> +## %endif +## %endif +## </td> %if info['library']: <td><a href="${h.url_for( controller='library_common', action='browse_library', cntrller='library', id=trans.security.encode_id( info['library'].id ) )}">${info['library'].name}</a></td> %else: @@ -182,8 +238,9 @@ <td></td> %endif %if request.submitted() or request.complete(): - <td> - <a href="${h.url_for( controller='requests_admin', action='show_datatx_page', sample_id=trans.security.encode_id(sample.id) )}">${len(sample.dataset_files)}</a> + <td id="sampleDatasets-${sample.id}"> + ${render_sample_datasets( sample )} +## <a href="${h.url_for( controller='requests_admin', action='show_datatx_page', sample_id=trans.security.encode_id(sample.id) )}">${len(sample.dataset_files)}</a> </td> %endif @@ -358,6 +415,14 @@ <label>There are no samples.</label> %endif </div> + + %if request.samples and request.submitted(): + <script type="text/javascript"> + // Updater + updater({${ ",".join( [ '"%s" : "%s"' % ( s.id, s.current_state().name ) for s in request.samples ] ) }}); + </script> + %endif + %if edit_mode == 'False': <table class="grid"> <tbody> diff -r 6d079d53f9db -r 3c124a19ae94 templates/requests/sample_datasets.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/requests/sample_datasets.mako Mon Mar 15 12:40:30 2010 -0400 @@ -0,0 +1,7 @@ +<%def name="render_sample_datasets( sample )"> + <a href="${h.url_for(controller='requests_admin', action='show_datatx_page', sample_id=trans.security.encode_id(sample.id))}">${sample.transferred_dataset_files()}</a> +</%def> + + + +${render_sample_datasets( sample )} diff -r 6d079d53f9db -r 3c124a19ae94 templates/requests/sample_state.mako --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/templates/requests/sample_state.mako Mon Mar 15 12:40:30 2010 -0400 @@ -0,0 +1,5 @@ +<%def name="render_sample_state( sample )"> + <a href="${h.url_for( controller='requests_admin', action='show_events', sample_id=sample.id)}">${sample.current_state().name}</a> +</%def> + +${render_sample_state( sample )}

1 0