- galaxy-dev - lists.galaxyproject.org

Tool shed tools, manual dep installation
by David Trudgian 14 Apr '16

14 Apr '16

Hi All, I'm currently caught between the requests of our Galaxy users to install things from main tool-shed, and our information security dept's concerns r.e. the automated installation of tool-deps on our systems. Due to restrictive web access policies for servers here our galaxy server can't access SourceForge, where many tool-dep downloads are. A request to unblock this for a particular tool-dep package led to our infosec justifiably raising concerns r.e. a tool-dep package that is quite out of date (details sent off list previously). We're now currently unable to install tool-shed tools that users have requested. The current proposal from our infosec dept is to get all our deps from system repos etc. However the way I'm aware of implementing this for tool-shed tools, which need to run across our cluster, would be something pretty arduous like: * Clone the tool from the upstream toolshed repo * Edit the tool code to remove the package requirements * Identify and install all the requirements on the cluster as system pkgs / environment modules - with attention to versions so things work as expected * Edit the tool code so it knows to load the right environment modules / set right PATH when it runs * Install the tool into our galaxy 'tools' dir , not the 'shed_tools' * Manually add the tool to galaxy's tool_conf.xml.main * Schedule downtime to restart galaxy * Test things out .... or we have to host our own tool shed, import tools we want from upstream, edit out the package requirements, provide the deps ourselves. These have all the headaches of merging things in when upstream shed-tools change. Just wondering if I'm missing anything? I know you can turn off 'handle repository dependencies' when installing a tool, but the tool still defines 'requirements' in its XML file and shows 'Missing repository/tool dependencies' in the Admin. Has anyone had any experience of dealing with this kind of situation? Many thanks! -- David Trudgian Ph.D. Computational Scientist, BioHPC Lyda Hill Department of Bioinformatics UT Southwestern Medical Center Dallas, TX 75390-9039 Tel: (214) 648-4833 ________________________________ UT Southwestern Medical Center The future of medicine, today.

4 9

tool shed bug on uploading incorrect files
by Christian Brenninkmeijer 14 Apr '16

14 Apr '16

Hi All, There is a bug in the toolshed code when you upload a file with an error. For example a jar file containing an tool_dependency.xml which refers to a non existing dependency. The toolshed correct refuses to except the upload and stays at the old version, However the files are added to the database/community_files/xxx/repo_yyy directory. If I then later upload a different jar with different files the previous files are NOT deleted. If you try to delete there from the webbrouser you get an error. Quick Fix is to go into database/community_files/xxx/repo_yyy and delete the files manually. Christian University of Manchester PS. I was able to replicate this with a brand new toolshed. create admin user, category ect create a tool and add a jar with a tool_dependecy.xml file with which reference a dependency not there upload a different jar which does not include a tool_dependency.xml file browse ...tip file mark tool_dependency.xml which is showing and attempt to delete.

1 0

Planemo test with SGE
by D K 11 Apr '16

11 Apr '16

Hi, I posted this question to biostars but didn't get an answer.... Is it possible to use "planemo test" functionality on an SGE cluster? I can correctly run a custom tool on an SGE cluster when I manually run a job through the galaxy interface. If I change the job_conf.xml so that the job is run locally, I can use "planemo test" successfully, but if I change the job_conf.xml so that Galaxy uses the SGE cluster, planemo fails: Traceback (most recent call last): File "/remote/home/galaxyd/galaxy-test-SGE/test/functional/test_toolbox.py", line 289, in test_tool self.do_it( td ) File "/remote/home/galaxyd/galaxy-test-SGE/test/functional/test_toolbox.py", line 38, in do_it stage_data_in_history( galaxy_interactor, testdef.test_data(), test_history, shed_tool_id ) File "/remote/home/galaxyd/galaxy-test-SGE/test/base/interactor.py", line 43, in stage_data_in_history upload_wait() File "/remote/home/galaxyd/galaxy-test-SGE/test/base/interactor.py", line 280, in wait while not self.__history_ready( history_id ): File "/remote/home/galaxyd/galaxy-test-SGE/test/base/interactor.py", line 298, in __history_ready return self._state_ready( state, error_msg="History in error state." ) File "/remote/home/galaxyd/galaxy-test-SGE/test/base/interactor.py", line 361, in _state_ready raise Exception( error_msg ) Exception: History in error state. -------------------- >> begin captured stdout << --------------------- History with id 2891970512fa2d5a in error - summary of datasets in error below. -------------------------------------- | 1 - MTB_Genes.fasta (HID - NAME) | Dataset Blurb: | tool error | Dataset Info: | The cluster DRM system terminated this job | Dataset Job Standard Output: | *Standard output was empty.* | Dataset Job Standard Error: | *Standard error was empty.* | -------------------------------------- --------------------- >> end captured stdout << ---------------------- Is this a problem with my configuration or a limitation of planemo? Thanks!

2 2

Re: [galaxy-dev] init scripts version 16.01
by Eric Kuyt 11 Apr '16

11 Apr '16

Thanks, works like a charm! Clean easy fix, Now why I couldn't come up with this myself. On 2 April 2016 at 11:49, Marius van den Beek <m.vandenbeek(a)gmail.com> wrote: > ld have been mentioned with the release notes. > I didn't test this, but it might be sufficient to replace > PYTHON="/usr/bin/python" > with PYTHON="<path/to/venv/bin/python>". > If that is sufficient for you, let us know and we will update the wiki and > adjust the script in > -- Central Veterinary Institute of Wageningen UR (CVI) Department of Infection Biology PO box 65, 8200 AB Lelystad, NL Visiting address: ASG, Edelhertweg 15, 8219 PH Lelystad Tel: +31-(0)320-293391 Fax: +31-(0)320-238153 E-mail: eric.kuijt(a)wur.nl Web: http://www.cvi.wur.nl

3 3

Re: [galaxy-dev] probleme tool galaxy
by navratil 08 Apr '16

08 Apr '16

Salut, je te laisse envoyer ta question sur la liste galaxy-user(a)listes.univ-lyon1.fr. Je répondrais à ta question directement (tes séquences doivent être d'une longeur de 30 nt minimum) sur la liste histoire que tout le monde puisse bénéficier du retour d'expérience, Par ailleurs est tu inscrite sur cette liste de diffusion ? Merci pour ta contribution, A+ Vincent Le 08/04/16 14:37, Rita Rebollo a écrit : > > > Bonjour, > > J'essaye d utiliser cd-hit-dup avec une trentaines de sequences en > format fasta ou fastq et ça ne marche pas. Il me donne une erreur. J > ai aussi essayé sur le galaxy.edu et ça ne marche pas non plus. > Saurais tu dire pourquoi s il te plait? > > Mon petit fichier: > > @HWI-ST132:549:C0FYUACXX:5:1101:1213:1910_1:N:0:TGGTTT > TGGTCGATGGTTATTCTGGATAACG > + > ?@@DDDFFHH<DFHHIHIIAHIIFG > @HWI-ST132:549:C0FYUACXX:5:1101:1106:1958_1:N:0:TGGTTT > AAAGATGAATCGGTAGATCGAAAT > + > ;??DDBDFFFFFFBEHGBHFF;EH > @HWI-ST132:549:C0FYUACXX:5:1101:1944:1926_1:N:0:TGGTTT > ATAACAGTGAATTTTGGACAGTG > + > ?@?D;AD=CAD<,A:,8A<CA3C > @HWI-ST132:549:C0FYUACXX:5:1101:1981:1949_1:N:0:TGGTTT > TATTGCACATTCACCGGCCTGA > + > @@@FDFFFHH4DFGHHIGGHIG > @HWI-ST132:549:C0FYUACXX:5:1101:1943:1970_1:N:0:TGGTTT > GAGGTTCCGCAAATCTGCATATAGGG > + > =@@DADBDHHDHHGIIIIIAHIIIII > @HWI-ST132:549:C0FYUACXX:5:1101:1752:1987_1:N:0:TGGTTT > AGATATGTTTGATATTCTTGGTTG > + > @@@FDDFFHGDHHIJGJJJGEIII > @HWI-ST132:549:C0FYUACXX:5:1101:1995:1987_1:N:0:TGGTTT > GGAACCTCGATGGACGTGGAGTGC > + > ;<?DDDDDH<AF:?A?EHFBFEF> > @HWI-ST132:549:C0FYUACXX:5:1101:2027:1925_1:N:0:TGGTTT > TGTATGCATTGCTTTCACTTCACAGA > + > @@@FFFDFHFDBHIJIIIJFHHGGEI > @HWI-ST132:549:C0FYUACXX:5:1101:2449:1910_1:N:0:TGGTTT > TGAAATGACTTATTGCCCAATGAATTGC > + > CCCFFFFFHHHHHJJJJJJIJIIJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2306:1925_1:N:0:TGGTTT > CGGAGAACGCAGAAAGGTGAGCT > + > BCCFFFEFHHFHHJJJJFHJIJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2470:1932_1:N:0:TGGTTT > TGGATAGCTGCACAACCCGTGGTACC > + > @@@FFFDDHHHHHHI@HHHHGIEH9E > @HWI-ST132:549:C0FYUACXX:5:1101:2332:1938_1:N:0:TGGTTT > CCCCCTTAAGGTGAAGTAGGACCTGTC > + > CCCFFFFFGHDACFGIHJIGIIJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2327:1996_1:N:0:TGGTTT > TTGCCTGTCTGTATCTCAATTGAAGT > + > @@@DDDBDDDHFBBEHGHBHEHCEFH > @HWI-ST132:549:C0FYUACXX:5:1101:2539:1874_1:N:0:TGGTTT > CTTCTGTAGTTTGTAATTCTTTTAAA > + > 1=DDFFFFHFHHIIIIIIEHIIIIII > @HWI-ST132:549:C0FYUACXX:5:1101:2585:1888_1:N:0:TGGTTT > TCTTTGGTGATTTTAGCTGTAT > + > CCCFFFFDHHHHHJJJJJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2506:1903_1:N:0:TGGTTT > TTGGATCGGAGTCTAAACTTTCGGAGC > + > CBCFFFFFHGHHHJIIJIJJJHIHGHG > @HWI-ST132:549:C0FYUACXX:5:1101:2534:1932_1:N:0:TGGTTT > TGCATGGATTCCAGAGCAGACTCGGC > + > @C@FFFFFGGBHDBGIIIGGHII?FB > @HWI-ST132:549:C0FYUACXX:5:1101:2629:1937_1:N:0:TGGTTT > TGCTTGGACTACATATGGTTGAGGGTTGTA > + > CCCFFFFFHHHHHJJJJJHGGGIJJJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:2808:1935_1:N:0:TGGTTT > TGGATGTTTTCGAGAAAAAGAGAGA > + > CCCFFFFFHHHHGJJIJJIJIJIJI > @HWI-ST132:549:C0FYUACXX:5:1101:3230:1884_1:N:0:TGGTTT > CGGGTTCAATTCCCGGTATGGGAACCA > + > @BCFDDFFHHHHHJJJFHIJJJJJJJI > @HWI-ST132:549:C0FYUACXX:5:1101:3201:1901_1:N:0:TGGTTT > TTCCCTTTGGCTTGAGAAATGCTGC > + > BBBFFFFFHHGHHJJJIJJJIIJFI > @HWI-ST132:549:C0FYUACXX:5:1101:3202:1980_1:N:0:TGGTTT > AGAGTATTGCCAGCAAACTAATCGGTC > + > ??@DADFFHGDHGICHGGHGGIIIIII > @HWI-ST132:549:C0FYUACXX:5:1101:3183:1994_1:N:0:TGGTTT > TCACTGGGCTTTGTTTATCTCA > + > @@@FFDABFAHHGHGIJIIGHI > @HWI-ST132:549:C0FYUACXX:5:1101:3490:1888_1:N:0:TGGTTT > AGGTTGAACAGGCGTTCTGAAATGAA > + > ==?ADDFFHHHHHJGIHJJIIIJJIJ > @HWI-ST132:549:C0FYUACXX:5:1101:3286:1900_1:N:0:TGGTTT > TAGTACATCGGAACACAAGAGTCAAAAAAA > + > B@BFFFFFHHHHHIJJJIJIIDHHIIJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3389:1907_1:N:0:TGGTTT > TTATTTCGCTCGCTACTGATTGCAG > + > ???DDD4A@D;@CEEC+22AA+ACE > @HWI-ST132:549:C0FYUACXX:5:1101:3323:1917_1:N:0:TGGTTT > TTTGGATTGGCTACCTCTGGGATTGGGA > + > 111==2AB3CD<C;F@HDGEGBGEAD?C > @HWI-ST132:549:C0FYUACXX:5:1101:3398:1919_1:N:0:TGGTTT > TTCGTCGAAGATACAGAACTGTTATT > + > ?@?DDDDFHGHGFEHIGGGIGHJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3538:1907_1:N:0:TGGTTT > CGTTACTCTGCCCTTTCGCGACCCAGAA > + > @@@FFFFFHHHHHJJJJJJJIJJJIJGG > @HWI-ST132:549:C0FYUACXX:5:1101:3531:1929_1:N:0:TGGTTT > AAAAGAGTCGGACTCCTATTGTG > + > ??@DDDFFHHFFHIHEGIHI@BH > @HWI-ST132:549:C0FYUACXX:5:1101:3648:1970_1:N:0:TGGTTT > TGGAAGACTAGTGATTTTGTTGTT > + > CCCFFFFFHHHHHEHJJJIJJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3662:1998_1:N:0:TGGTTT > ATGGACTGAGAACCGGAATTTTT > + > CCCFFFFFHHHHHJJJIJIIJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3752:1916_1:N:0:TGGTTT > AGGACGAGATTCGCTAATGCAATGCC > + > CCCFFFFFHHHHHJJJJJJJJJIHIJ > @HWI-ST132:549:C0FYUACXX:5:1101:3864:1924_1:N:0:TGGTTT > TGCTTGGACTACATATGGTTGAGGGTTGTA > + > CCCFFFFFHHHHHJIJJJHIIJJJJIJJJJ > @HWI-ST132:549:C0FYUACXX:5:1101:3786:1958_1:N:0:TGGTTT > TGGAAAATAAAACCTTCTCGAAGGG > + > @C@FFFFFHHFHHJJJJJJJJJJII > @HWI-ST132:549:C0FYUACXX:5:1101:3793:1988_1:N:0:TGGTTT > GAATTCGTAGAAGGAAGATTTTTCGCGGT > + > =@@?DDDEHHHFBGGGGGHIIJIDGEFE? > @HWI-ST132:549:C0FYUACXX:5:1101:4123:1921_1:N:0:TGGTTT > GCATGGATTCCAGAGCAGACTCGGC > + > CCCFFFFFHHHHHIJJJJJJJJCGG > @HWI-ST132:549:C0FYUACXX:5:1101:4030:1974_1:N:0:TGGTTT > GAAGATATTAATTCGCGAGTCTTA > + > CCCFFFFFHHHHHJJJJJJGHIII > @HWI-ST132:549:C0FYUACXX:5:1101:4468:1880_1:N:0:TGGTTT > ATGATGATAGAGACGGCTTGGTAA > + > 1=DFFFFHHHHHGIJJJJJJJCGH > > > > Les parametres > > Input Parameter Value Note for rerun > Single or Paired-end reads single > Select reads 11: FASTQ Groomer on data 10 > Filter out chimeric clusters false > Length of prefix to be used in the analysis 0 > Match length True > Maximum number/percent of mismatches allowed None > Description length 0 > > Les erreurs: > Fatal error: Exit code 134 () > cd-hit-dup: cdhit-dup.cxx:159: int HashingDepth(int, int): Assertion `len >= min' failed. > Aborted > From input: /data/galaxy.prabi.fr/database/files/025/dataset_25721.dat > Total number of sequences: 39 > Longest: 30 > Shortest: 22 > Sorted by length ... > Start clustering duplicated sequences ... > primer = 0

2 1

2016 Galaxy Community Conference: June 25-29, Bloomington, Indiana
by Dave Clements 08 Apr '16

08 Apr '16

Hello all, Here's the official email announcement for the 2016 Galaxy Community Conference. Please redistribute to any of your communities that would benefit from attending. Also please note: * 1. Oral presentation abstracts are due March 25.* 2. The June 2016 GMOD Meeting <https://www.eventbrite.com/e/gmod-2016-community-meeting-tickets-22224544210> will be held immediately after GCC2016. Thanks, Dave C --------------- The *2016 Galaxy Community Conference *(*GCC2016*, *gcc2016.iu.edu <http://gcc2016.iu.edu/>*) features two days of presentations, discussions, poster sessions, lightning talks, computer demos, keynotes, and birds-of-a-feather meetups, *all about data-intensive biology and the tools that support it*. Keynote speaker Yoav Gilad <http://genes.uchicago.edu/directory/yoav-gilad-phd/>, a professor of human genetics at the University of Chicago, will kick-start the main conference with a discussion on the analysis of large gene regulatory data sets. Preconference events include data <https://gcc2016.iu.edu/hacks/hacks-data.php> and coding <https://gcc2016.iu.edu/hacks/hacks-coding.php> hackathons <https://gcc2016.iu.edu/hacks/index.php>, and *two days of training* <https://gcc16.sched.org/overview/type/Training+%E2%80%94+Any> in five concurrent tracks covering 26 topics. *GCC2016* will be held at *Indiana University* in Bloomington, Indiana, June 25-29, 2016. Since it started seven years ago, GCC has been a well-attended gathering of biologists, genome researchers, bioinformaticians, and others in data-intensive biomedical research around the world. Galaxy <https://galaxyproject.org/> is an open, web-based platform for data-intensive biomedical research and enables easy interactive analysis through the web on arbitrarily large data sets. The Galaxy framework is a major resource in achieving key research goals within the biological field. It provides next-generation sequencing (NGS) tools and workflows for short-read mapping, ChIP-seq, RNA-seq, metagenomics, variant analysis, visualization, and support for Galaxy in the cloud. There are hundreds of local installs, and *over 80 publicly accessible servers* around the world. *Abstract submission** for oral presentations closes March 25. *Abstract submission for posters and computer demonstrations closes May 20. *Early registration* is now open. Registration starts at less than $45/day for post-docs and students. Registering early assures you a place at the conference and also a spot in the training workshops <https://gcc16.sched.org/overview/type/Training+%E2%80%94+Any> you want to attend. You can also *book conference housing* when you register. *Registration and lodging scholarships* are available for attendees from underrepresented groups and developing countries. Thanks, and we hope to see you in Bloomington! The *GCC2016 Exec* -- http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ https://wiki.galaxyproject.org/

1 2

"\${GALAXY_SLOTS:-4}" usage help
by Poole, Richard 08 Apr '16

08 Apr '16

Could somebody point me to a good explanation of how to setup and use GALAXY_SLOTS correctly on my server? A basic explanation is good but I also make use of Pulsar to stage some jobs on our cluster here (my machine is 4-core and cluster I use is 12-core) so I am wondering if GALAXY_SLOTS can handle this (so I don't need to specify exact thread numbers in e.g. tool wrappers) Thanks, Richard

2 3

Problem with LDAP authentication
by Scott Szakonyi 08 Apr '16

08 Apr '16

Hi all, I'm having some difficulties with logging into my production website. I get the following error message in the logs: galaxy.web.framework.webapp WARNING 2016-04-06 18:47:41,852 User logged in as 'userID' externally, but has a cookie as 'userID(a)vectorbase.org' invalidating session This started rather suddenly today after there was a space crisis on our hard drive, which is the subject of my other recent email to this list. We are using LDAP for external authentication. The same LDAP server is being used by my "Pre" server, and logins are working fine. I've compared both galaxy.ini and httpd.conf and can't find any discrepancies. If someone has suggestions to offer, I would surely appreciate them. Thanks! -- Scott B. Szakonyi Research Programmer *Center for Research Computing* 107 Information Technology Center Notre Dame, IN 46556 http://crc.nd.edu

2 2

File_path setting not working
by Scott Szakonyi 07 Apr '16

07 Apr '16

Hello, I'm trying to set our Galaxy instance to put Dataset and Temporary files on a Symlinked drive, as there isn't sufficient room on the Galaxy server to handle those files. However, I can't get it to work. Even though I've changed these settings, Galaxy still seems to be creating large numbers of files in our local database directory. Am I missing something here? I'm including the relevant section of my galaxy.ini: # -- Files and directories # Dataset files are stored in this directory. #file_path = database/files file_path = /data/galaxy/database/files # Temporary files are stored in this directory. #new_file_path = database/tmp new_file_path = /data/galaxy/tmp Thanks! -- Scott B. Szakonyi Research Programmer *Center for Research Computing* 107 Information Technology Center Notre Dame, IN 46556 http://crc.nd.edu

2 1

dbkeys_list.yaml
by William Ge 05 Apr '16

05 Apr '16

Hi, Just wonder where I can download the full sample file of dbkeys_list.yaml, which contents all the dbkeys and all DMs from the main tool shed. I'd appreciate if you would send me a copy. The sample file that comes with the ansible role only has a few lines. Thanks, Bill

1 0