- galaxy-dev - lists.galaxyproject.org

[hg] galaxy 2811: Fix spelling of Successfully when running a wo...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/2364764e3604 changeset: 2811:2364764e3604 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Thu Oct 01 11:39:55 2009 -0400 description: Fix spelling of Successfully when running a workflow. 1 file(s) affected in this change: templates/workflow/run_complete.mako diffs (19 lines): diff -r 6eb4f3017fbe -r 2364764e3604 templates/workflow/run_complete.mako --- a/templates/workflow/run_complete.mako Thu Oct 01 09:09:40 2009 -0400 +++ b/templates/workflow/run_complete.mako Thu Oct 01 11:39:55 2009 -0400 @@ -14,7 +14,7 @@ <body> <div class="donemessage"> <p> - Sucesfully ran workflow "${workflow.name}", the following datasets have + Successfully ran workflow "${workflow.name}", the following datasets have been added to the queue. </p> @@ -28,4 +28,4 @@ </div> </body> -</html> \ No newline at end of file +</html>

1 0

[hg] galaxy 2810: Fixed trimmer test
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/6eb4f3017fbe changeset: 2810:6eb4f3017fbe user: Anton Nekrutenko <anton(a)bx.psu.edu> date: Thu Oct 01 09:09:40 2009 -0400 description: Fixed trimmer test 1 file(s) affected in this change: tools/filters/trimmer.xml diffs (12 lines): diff -r 3bd7acfe34cc -r 6eb4f3017fbe tools/filters/trimmer.xml --- a/tools/filters/trimmer.xml Wed Sep 30 15:35:05 2009 -0400 +++ b/tools/filters/trimmer.xml Thu Oct 01 09:09:40 2009 -0400 @@ -1,7 +1,7 @@ <tool id="trimmer" name="Trim" version="0.0.1"> <description>leading or trailing characters</description> <command interpreter="python"> - chopper.py -a -f $input1 -c $col -s $start -e $end -i $ignore $fastq > $out_file1 + trimmer.py -a -f $input1 -c $col -s $start -e $end -i $ignore $fastq > $out_file1 </command> <inputs> <param format="tabular,text" name="input1" type="data" label="this dataset"/>

1 0

[hg] galaxy 2809: Allow for a specified target for display links...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3bd7acfe34cc changeset: 2809:3bd7acfe34cc user: Greg Von Kuster <greg(a)bx.psu.edu> date: Wed Sep 30 15:35:05 2009 -0400 description: Allow for a specified target for display links, rahter than forcing it to be _blank - this will allow external tools like GeneTrack to run inside the Galaxy frame set. 3 file(s) affected in this change: lib/galaxy/datatypes/data.py lib/galaxy/datatypes/tracks.py templates/root/history_common.mako diffs (64 lines): diff -r 9cc7a17e0ac7 -r 3bd7acfe34cc lib/galaxy/datatypes/data.py --- a/lib/galaxy/datatypes/data.py Wed Sep 30 14:47:17 2009 -0400 +++ b/lib/galaxy/datatypes/data.py Wed Sep 30 15:35:05 2009 -0400 @@ -171,11 +171,11 @@ def get_mime(self): """Returns the mime type of the datatype""" return 'application/octet-stream' - def add_display_app (self, app_id, label, file_function, links_function ): + def add_display_app ( self, app_id, label, file_function, links_function ): """ Adds a display app to the datatype. app_id is a unique id - label is the primary display label, ie display at 'UCSC' + label is the primary display label, e.g., display at 'UCSC' file_function is a string containing the name of the function that returns a properly formatted display links_function is a string containing the name of the function that returns a list of (link_name,link) """ @@ -205,7 +205,7 @@ except: log.exception('Function %s is referred to in datatype %s for displaying as type %s, but is not accessible' % (self.supported_display_apps[type]['file_function'], self.__class__.__name__, type) ) return "This display type (%s) is not implemented for this datatype (%s)." % ( type, dataset.ext) - def get_display_links(self, dataset, type, app, base_url, **kwd): + def get_display_links( self, dataset, type, app, base_url, target_frame='_blank', **kwd ): """ Returns a list of tuples of (name, link) for a particular display type. No check on 'access' permissions is done here - if you can view the dataset, you can also save it @@ -214,7 +214,7 @@ """ try: if type in self.get_display_types(): - return getattr (self, self.supported_display_apps[type]['links_function']) (dataset, type, app, base_url, **kwd) + return target_frame, getattr ( self, self.supported_display_apps[type]['links_function'] ) ( dataset, type, app, base_url, **kwd ) except: log.exception( 'Function %s is referred to in datatype %s for generating links for type %s, but is not accessible' \ % ( self.supported_display_apps[type]['links_function'], self.__class__.__name__, type ) ) diff -r 9cc7a17e0ac7 -r 3bd7acfe34cc lib/galaxy/datatypes/tracks.py --- a/lib/galaxy/datatypes/tracks.py Wed Sep 30 14:47:17 2009 -0400 +++ b/lib/galaxy/datatypes/tracks.py Wed Sep 30 15:35:05 2009 -0400 @@ -27,6 +27,8 @@ def __init__(self, **kwargs): super( GeneTrack, self ).__init__( **kwargs ) self.add_display_app( 'genetrack', 'View in GeneTrack', '', 'genetrack_link' ) + def get_display_links( self, dataset, type, app, base_url, target_frame='galaxy_main', **kwd ): + return data.Binary.get_display_links( self, dataset, type, app, base_url, target_frame=target_frame, **kwd ) def genetrack_link( self, hda, type, app, base_url ): ret_val = [] if hda.has_data: diff -r 9cc7a17e0ac7 -r 3bd7acfe34cc templates/root/history_common.mako --- a/templates/root/history_common.mako Wed Sep 30 14:47:17 2009 -0400 +++ b/templates/root/history_common.mako Wed Sep 30 15:35:05 2009 -0400 @@ -83,11 +83,11 @@ <a href="${h.url_for( action='display', id=data.id, tofile='yes', toext=data.ext )}" target="_blank">save</a> | <a href="${h.url_for( controller='tool_runner', action='rerun', id=data.id )}" target="galaxy_main">rerun</a> %for display_app in data.datatype.get_display_types(): - <% display_links = data.datatype.get_display_links( data, display_app, app, request.base ) %> + <% target_frame, display_links = data.datatype.get_display_links( data, display_app, app, request.base ) %> %if len( display_links ) > 0: | ${data.datatype.get_display_label(display_app)} %for display_name, display_link in display_links: - <a target="_blank" href="${display_link}">${_(display_name)}</a> + <a target="${target_frame}" href="${display_link}">${_(display_name)}</a> %endfor %endif %endfor

1 0

[hg] galaxy 2808: If you populate a history before logging in, t...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/9cc7a17e0ac7 changeset: 2808:9cc7a17e0ac7 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Wed Sep 30 14:47:17 2009 -0400 description: If you populate a history before logging in, then login, your current history will be the one you populated before logging in - fixes ticket number 163. Also added additional functional tests to cover scenario. 2 file(s) affected in this change: lib/galaxy/web/framework/__init__.py test/functional/test_history_functions.py diffs (65 lines): diff -r aafecc059ba6 -r 9cc7a17e0ac7 lib/galaxy/web/framework/__init__.py --- a/lib/galaxy/web/framework/__init__.py Wed Sep 30 14:11:01 2009 -0400 +++ b/lib/galaxy/web/framework/__init__.py Wed Sep 30 14:47:17 2009 -0400 @@ -404,18 +404,17 @@ except: users_last_session = None last_accessed = False - if users_last_session and users_last_session.current_history: + if prev_galaxy_session.current_history and prev_galaxy_session.current_history.datasets: + if prev_galaxy_session.current_history.user is None or prev_galaxy_session.current_history.user == user: + # If the previous galaxy session had a history, associate it with the new + # session, but only if it didn't belong to a different user. + history = prev_galaxy_session.current_history + elif self.galaxy_session.current_history: + history = self.galaxy_session.current_history + if not history and users_last_session and users_last_session.current_history: history = users_last_session.current_history - if not history: - if prev_galaxy_session.current_history: - if prev_galaxy_session.current_history.user is None or prev_galaxy_session.current_history.user == user: - # If the previous galaxy session had a history, associate it with the new - # session, but only if it didn't belong to a different user. - history = prev_galaxy_session.current_history - elif self.galaxy_session.current_history: - history = self.galaxy_session.current_history - else: - history = self.get_history( create=True ) + elif not history: + history = self.get_history( create=True ) if history not in self.galaxy_session.histories: self.galaxy_session.add_history( history ) if history.user is None: diff -r aafecc059ba6 -r 9cc7a17e0ac7 test/functional/test_history_functions.py --- a/test/functional/test_history_functions.py Wed Sep 30 14:11:01 2009 -0400 +++ b/test/functional/test_history_functions.py Wed Sep 30 14:47:17 2009 -0400 @@ -9,11 +9,28 @@ """Testing history behavior between logout and login""" self.logout() self.history_options() - # Make sure we have created the following 4 accounts + # Create a new, empty history named anonymous + name = 'anonymous' + self.new_history( name=name ) + global anonymous_history + anonymous_history = galaxy.model.History \ + .filter( and_( galaxy.model.History.table.c.deleted==False, + galaxy.model.History.table.c.name==name ) ) \ + .order_by( desc( galaxy.model.History.table.c.create_time ) ) \ + .first() + assert anonymous_history is not None, "Problem retrieving anonymous_history from database" + # Upload a dataset to anonymous_history so it will be set as the current history after login + self.upload_file( '1.bed', dbkey='hg18' ) self.login( email='test1(a)bx.psu.edu' ) global regular_user1 regular_user1 = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() assert regular_user1 is not None, 'Problem retrieving user with email "test1(a)bx.psu.edu" from the database' + # Current history should be anonymous_history + self.check_history_for_string( name ) + self.logout() + # Login as the same user again to ensure anonymous_history is still the current history + self.login( email=regular_user1.email ) + self.check_history_for_string( name ) self.logout() self.login( email='test2(a)bx.psu.edu' ) global regular_user2

1 0

[hg] galaxy 2806: Fix reporting number of regions processed in M...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/268ab95fc8a7 changeset: 2806:268ab95fc8a7 user: Dan Blankenberg <dan(a)bx.psu.edu> date: Wed Sep 30 14:06:06 2009 -0400 description: Fix reporting number of regions processed in MAF Stats tool. 1 file(s) affected in this change: tools/maf/maf_stats.py diffs (22 lines): diff -r c63a444cd7ba -r 268ab95fc8a7 tools/maf/maf_stats.py --- a/tools/maf/maf_stats.py Wed Sep 30 11:40:09 2009 -0400 +++ b/tools/maf/maf_stats.py Wed Sep 30 14:06:06 2009 -0400 @@ -54,7 +54,7 @@ out = open(output_filename, 'w') - num_region = 0 + num_region = None species_summary = {} total_length = 0 #loop through interval file @@ -97,7 +97,8 @@ for spec in species_summary: out.write( "%s\t%s\t%.4f\n" % ( spec, species_summary[spec], float( species_summary[spec] ) / total_length ) ) out.close() - print "%i regions were processed with a total length of %i." % ( num_region, total_length ) + if num_region is not None: + print "%i regions were processed with a total length of %i." % ( num_region + 1, total_length ) maf_utilities.remove_temp_index_file( index_filename ) if __name__ == "__main__": __main__()

1 0

[hg] galaxy 2807: Added text trimmer that can be used to groom f...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/aafecc059ba6 changeset: 2807:aafecc059ba6 user: Anton Nekrutenko <anton(a)bx.psu.edu> date: Wed Sep 30 14:11:01 2009 -0400 description: Added text trimmer that can be used to groom fastq data 6 file(s) affected in this change: test-data/trimmer_a_f_c0_s1_e13_i62.dat test-data/trimmer_a_f_c2_s1_e2_i62.dat test-data/trimmer_tab_delimited.dat tool_conf.xml.sample tools/filters/trimmer.py tools/filters/trimmer.xml diffs (273 lines): diff -r 268ab95fc8a7 -r aafecc059ba6 test-data/trimmer_a_f_c0_s1_e13_i62.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trimmer_a_f_c0_s1_e13_i62.dat Wed Sep 30 14:11:01 2009 -0400 @@ -0,0 +1,5 @@ +12345 abcdef +67890 ghjkl g +>assa lljlj ljlj +sasas hghg hg +@dgf gfgf gfg diff -r 268ab95fc8a7 -r aafecc059ba6 test-data/trimmer_a_f_c2_s1_e2_i62.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trimmer_a_f_c2_s1_e2_i62.dat Wed Sep 30 14:11:01 2009 -0400 @@ -0,0 +1,5 @@ +12345 ab xyz +67890 gh ghjt +>assa lljlj ljlj +sasas hg hghg +@dgf gf gfgf diff -r 268ab95fc8a7 -r aafecc059ba6 test-data/trimmer_tab_delimited.dat --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trimmer_tab_delimited.dat Wed Sep 30 14:11:01 2009 -0400 @@ -0,0 +1,5 @@ +12345 abcdef xyz +67890 ghjkl ghjt +>assa lljlj ljlj +sasas hghg hghg +@dgf gfgf gfgf diff -r 268ab95fc8a7 -r aafecc059ba6 tool_conf.xml.sample --- a/tool_conf.xml.sample Wed Sep 30 14:06:06 2009 -0400 +++ b/tool_conf.xml.sample Wed Sep 30 14:11:01 2009 -0400 @@ -45,6 +45,7 @@ <tool file="filters/remove_beginning.xml" /> <tool file="filters/headWrapper.xml" /> <tool file="filters/tailWrapper.xml" /> + <tool file="filters/trimmer.xml" /> </section> <section name="Filter and Sort" id="filter"> <tool file="stats/filtering.xml" /> diff -r 268ab95fc8a7 -r aafecc059ba6 tools/filters/trimmer.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/filters/trimmer.py Wed Sep 30 14:11:01 2009 -0400 @@ -0,0 +1,108 @@ +#!/usr/bin/env python + +import sys +import optparse + +def stop_err( msg ): + sys.stderr.write( msg ) + sys.exit() + +def main(): + usage = """%prog [options] + +options (listed below) default to 'None' if omitted + """ + parser = optparse.OptionParser(usage=usage) + + parser.add_option( + '-a','--ascii', + dest='ascii', + action='store_true', + default = False, + help='Use ascii codes to defined ignored beginnings instead of raw characters') + + parser.add_option( + '-q','--fastq', + dest='fastq', + action='store_true', + default = False, + help='The input data in fastq format. It selected the script skips every even line since they contain sequence ids') + + parser.add_option( + '-i','--ignore', + dest='ignore', + help='A comma separated list on ignored beginnings (e.g., ">,@"), or its ascii codes (e.g., "60,42") if option -a is enabled') + + parser.add_option( + '-s','--start', + dest='start', + default = '0', + help='Trim from beginning to here (1-based)') + + parser.add_option( + '-e','--end', + dest='end', + default = '0', + help='Trim from here to the ned (1-based)') + + parser.add_option( + '-f','--file', + dest='input_txt', + default = False, + help='Name of file to be chopped. STDIN is default') + + parser.add_option( + '-c','--column', + dest='col', + default = '0', + help='Column to chop. If 0 = chop the whole line') + + + options, args = parser.parse_args() + invalid_starts = [] + + if options.input_txt: + infile = open ( options.input_txt, 'r') + else: + infile = sys.stdin + + if options.ignore and options.ignore != "None": + invalid_starts = options.ignore.split(',') + + if options.ascii and options.ignore and options.ignore != "None": + for i, item in enumerate( invalid_starts ): + invalid_starts[i] = chr( int( item ) ) + + col = int( options.col ) + + for i, line in enumerate( infile ): + line = line.rstrip( '\r\n' ) + if line: + + if options.fastq and i % 2 == 0: + print line + continue + + if options.fastq and line.startswith('@'): + stop_err('Malformed fastq file: even numbered line starts with @') + + if line[0] not in invalid_starts: + if col == 0: + if int( options.end ) > 0: + line = line[ int( options.start )-1 : int( options.end ) ] + else: + line = line[ int( options.start )-1 : ] + else: + fields = line.split( '\t' ) + if col-1 > len( fields ): + stop_err('Column %d does not exist. Check input parameters\n' % col) + + if int( options.end ) > 0: + fields[col - 1] = fields[col - 1][ int( options.start )-1 : int( options.end ) ] + else: + fields[col - 1] = fields[col - 1][ int( options.start )-1 : ] + line = '\t'.join(fields) + print line + +if __name__ == "__main__": main() + diff -r 268ab95fc8a7 -r aafecc059ba6 tools/filters/trimmer.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/filters/trimmer.xml Wed Sep 30 14:11:01 2009 -0400 @@ -0,0 +1,119 @@ +<tool id="trimmer" name="Trim" version="0.0.1"> + <description>leading or trailing characters</description> + <command interpreter="python"> + chopper.py -a -f $input1 -c $col -s $start -e $end -i $ignore $fastq > $out_file1 + </command> + <inputs> + <param format="tabular,text" name="input1" type="data" label="this dataset"/> + <param name="col" type="integer" value="0" label="Trim this column only" help="0 = process entire line" /> + <param name="start" type="integer" size="10" value="1" label="Trim from the beginning to this position" help="1 = do not trim the beginning"/> + <param name="end" type="integer" size="10" value="0" label="Remove everything from this position to the end" help="0 = do not trim the end"/> + <param name="fastq" type="select" label="Is input dataset in fastq format?" help="If set to YES, the tool will not trim evenly numbered lines (0, 2, 4, etc...)"> + <option value="-q">Yes</option> + <option value="">No</option> + </param> + <param name="ignore" type="select" display="checkboxes" multiple="True" label="Ignore lines beginning with these characters" help="lines beginning with these are not trimmed"> + <option value="62">></option> + <option value="64">@</option> + <option value="43">+</option> + <option value="60"><</option> + <option value="42">*</option> + <option value="45">-</option> + <option value="61">=</option> + <option value="124">|</option> + <option value="63">?</option> + <option value="36">$</option> + <option value="46">.</option> + <option value="58">:</option> + <option value="38">&</option> + <option value="37">%</option> + <option value="94">^</option> + </param> + </inputs> + <outputs> + <data name="out_file1" format="input" metadata_source="input1"/> + </outputs> + <tests> + <test> + <param name="input1" value="trimmer_tab_delimited.dat"/> + <param name="col" value="0"/> + <param name="start" value="1"/> + <param name="end" value="13"/> + <param name="ignore" value="62"/> + <param name="fastq" value="No"/> + <output name="out_file1" file="trimmer_a_f_c0_s1_e13_i62.dat"/> + </test> + <test> + <param name="input1" value="trimmer_tab_delimited.dat"/> + <param name="col" value="2"/> + <param name="start" value="1"/> + <param name="end" value="2"/> + <param name="ignore" value="62"/> + <param name="fastq" value="No"/> + <output name="out_file1" file="trimmer_a_f_c2_s1_e2_i62.dat"/> + </test> + + </tests> + + <help> + + +**What it does** + +Trims specified number of characters from a dataset or its field (if dataset is tab-delimited). + +----- + +**Example 1** + +Trimming this dataset:: + + 1234567890 + abcdefghijk + +by setting **Trim from the beginning to this position** to *2* and **Remove everything from this position to the end** to *6* will produce:: + + 23456 + bcdef + +----- + +**Eaxmple 2** + +Trimming column 2 of this dataset:: + + bcde 12345 fghij 67890 + fghij 67890 abcde 12345 + +by setting **Trim content of this column only** to *2*, **Trim from the beginning to this position** to *2*, and **Remove everything from this position to the end** to *4* will produce:: + + abcde 234 fghij 67890 + fghij 789 abcde 12345 + +----- + +**Trimming FASTQ datasets** + +This tool can be used to trim sequences and quality strings in fastq datasets. This is done by selected *Yes* from the **Is input dataset in fastq format?** dropdown. If set to *Yes*, the tool will skip all even numbered lines (see warning below). For example, trimming last 5 bases of this dataset:: + + @081017-and-081020:1:1:1715:1759 + GGACTCAGATAGTAATCCACGCTCCTTTAAAATATC + + + II#IIIIIII$5+.(9IIIIIII$%*$G$A31I&&B + +cab done by setting **Remove everything from this position to the end** to 31:: + + @081017-and-081020:1:1:1715:1759 + GGACTCAGATAGTAATCCACGCTCCTTTAAA + + + II#IIIIIII$5+.(9IIIIIII$%*$G$A3 + +**Note** that headers are skipped. + +.. class:: warningmark + +**WARNING:** This tool will only work on properly formatted fastq datasets where (1) each read and quality string occupy one line and (2) '@' (read header) and "+" (quality header) lines are evenly numbered like in the above example. + + + </help> +</tool>

1 0

[hg] galaxy 2805: Requests functional tests: fixed a hack in use...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/c63a444cd7ba changeset: 2805:c63a444cd7ba user: rc date: Wed Sep 30 11:40:09 2009 -0400 description: Requests functional tests: fixed a hack in user address creation 1 file(s) affected in this change: test/functional/test_forms_and_requests.py diffs (60 lines): diff -r 3e5428b298b1 -r c63a444cd7ba test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Wed Sep 30 10:40:08 2009 -0400 +++ b/test/functional/test_forms_and_requests.py Wed Sep 30 11:40:09 2009 -0400 @@ -12,14 +12,14 @@ ( 'Received', 'Sample tube received' ), ( 'Done', 'Sequence run complete' ) ] address1 = dict( short_desc="Office", - name="James Bond", + name="James+Bond", institution="MI6" , - address1="MI6 Headquaters", + address1="MI6+Headquarters", address2="", city="London", state="London", postal_code="007", - country="United Kingdom", + country="United+Kingdom", phone="007-007-0007" ) @@ -165,26 +165,21 @@ self.visit_url( '%s/library_admin/browse_library?obj_id=%s' % ( self.url, str( library_one.id ) ) ) self.check_page_for_string( name ) # create address - #self.create_address( user_address1 ) - #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] ) - ## TODO: FIX HACK - ## the user address creation should be done as a test. + self.logout() + self.login( email='test1(a)bx.psu.edu' ) + self.home() + url_str = '%s/user/new_address?short_desc=%s&name=%s&institution=%s&address1=%s&address2=%s&city=%s&state=%s&postal_code=%s&country=%s&phone=%s' \ + % ( self.url, address1[ 'short_desc' ], address1[ 'name' ], address1[ 'institution' ], + address1[ 'address1' ], address1[ 'address2' ], address1[ 'city' ], address1[ 'state' ], + address1[ 'postal_code' ], address1[ 'country' ], address1[ 'phone' ] ) + print url_str + self.visit_url( url_str ) + self.check_page_for_string( 'Address <b>%s</b> has been added' % address1[ 'short_desc' ] ) global regular_user regular_user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() global user_address - user_address = galaxy.model.UserAddress() - user_address.user = regular_user - user_address.desc = address1[ 'short_desc' ] - user_address.name = address1[ 'name' ] - user_address.institution = address1[ 'institution' ] - user_address.address = address1[ 'address1' ]+' '+address1[ 'address2' ] - user_address.city = address1[ 'city' ] - user_address.state = address1[ 'state' ] - user_address.postal_code = address1[ 'postal_code' ] - user_address.country = address1[ 'country' ] - user_address.phone = address1[ 'phone' ] - user_address.flush() - user_address.user.refresh() + user_address = galaxy.model.UserAddress.filter( and_( galaxy.model.UserAddress.table.c.desc==address1[ 'short_desc' ], + galaxy.model.UserAddress.table.c.deleted==False ) ).first() def test_030_create_request( self ): """Testing creating, editing and submitting a request as a regular user""" # login as a regular user

1 0

[hg] galaxy 2804: More functional tests for Requests
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/3e5428b298b1 changeset: 2804:3e5428b298b1 user: rc date: Wed Sep 30 10:40:08 2009 -0400 description: More functional tests for Requests 2 file(s) affected in this change: templates/admin/forms/show_form_read_only.mako test/functional/test_forms_and_requests.py diffs (141 lines): diff -r 88fdb7f40b0e -r 3e5428b298b1 templates/admin/forms/show_form_read_only.mako --- a/templates/admin/forms/show_form_read_only.mako Wed Sep 30 09:22:02 2009 -0400 +++ b/templates/admin/forms/show_form_read_only.mako Wed Sep 30 10:40:08 2009 -0400 @@ -62,7 +62,11 @@ </%def> <div class="toolForm"> - <div class="toolFormTitle">${form.name} - <i>${form.desc}</i></div> + %if form.desc: + <div class="toolFormTitle">${form.name} - <i>${form.desc}</i></div> + %else: + <div class="toolFormTitle">${form.name}</div> + %endif <form name="library" action="${h.url_for( controller='forms', action='manage' )}" method="post" > %if form.type == trans.app.model.FormDefinition.types.SAMPLE: %if not len(form.layout): diff -r 88fdb7f40b0e -r 3e5428b298b1 test/functional/test_forms_and_requests.py --- a/test/functional/test_forms_and_requests.py Wed Sep 30 09:22:02 2009 -0400 +++ b/test/functional/test_forms_and_requests.py Wed Sep 30 10:40:08 2009 -0400 @@ -169,9 +169,11 @@ #self.check_page_for_string( 'Address <b>%s</b> has been added' % user_address1[ 'short_desc' ] ) ## TODO: FIX HACK ## the user address creation should be done as a test. + global regular_user + regular_user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() global user_address user_address = galaxy.model.UserAddress() - user_address.user = galaxy.model.User.filter( galaxy.model.User.table.c.email=='test1(a)bx.psu.edu' ).first() + user_address.user = regular_user user_address.desc = address1[ 'short_desc' ] user_address.name = address1[ 'name' ] user_address.institution = address1[ 'institution' ] @@ -211,14 +213,22 @@ for field_value in fields: self.check_page_for_string( field_value ) # edit this request - fields = ['field one value (editted)', 'field two value (editted)', str(user_address.id)] + fields = ['field one value (edited)', 'field two value (edited)', str(user_address.id)] self.edit_request(request_one.id, request_one.name, request_one.name+' (Renamed)', request_one.desc+' (Re-described)', library_one.id, folder_one.id, fields) request_one.refresh() self.check_page_for_string( request_name+' (Renamed)' ) self.check_page_for_string( request_desc+' (Re-described)' ) + # check if the request is showing in the 'unsubmitted' filter + self.home() + self.visit_url( '%s/requests/list?show_filter=Unsubmitted' % self.url ) + self.check_page_for_string( request_one.name ) # submit the request self.submit_request( request_one.id, request_one.name ) request_one.refresh() + # check if the request is showing in the 'submitted' filter + self.home() + self.visit_url( '%s/requests/list?show_filter=Submitted' % self.url ) + self.check_page_for_string( request_one.name ) # check if the request's state is now set to 'submitted' assert request_one.state is not request_one.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.SUBMITTED ) def test_035_request_lifecycle( self ): @@ -250,40 +260,50 @@ self.visit_url('%s/requests_admin/list?show_filter=Complete' % self.url) self.check_page_for_string( request_one.name ) assert request_one.state is not request_one.states.COMPLETE, "The state of the request '%s' should be set to '%s'" % ( request_one.name, request_one.states.COMPLETE ) -# def test_40_admin_create_request_on_behalf_of_regular_user( self ): -# """Testing creating and submitting a request as an admin on behalf of a regular user""" -# self.logout() -# self.login( email='test(a)bx.psu.edu' ) -## permissions_in = [ k for k, v in galaxy.model.Library.permitted_actions.items() ] -## permissions_out = [] -## self.set_library_permissions( str( library_one.id ), library_one.name, str( admin_user_private_role.id ), permissions_in, permissions_out ) -# # set field values -# fields = ['field one value', 'field two value', str(user_address.id)] -# # create the request -# request_name, request_desc = 'Request Two', 'Request Two Description' -# self.create_request_admin(request_type.id, regular_user1.id, request_name, request_desc, library_one.id, fields) -# self.check_page_for_string( request_name ) -# self.check_page_for_string( request_desc ) -# global request_two -# request_one = galaxy.model.Request.filter( and_( galaxy.model.Request.table.c.name==request_name, -# galaxy.model.Request.table.c.deleted==False ) ).first() -# # check if the request's state is now set to 'unsubmitted' -# assert request_two.state is not request_two.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.UNSUBMITTED ) -# # sample fields -# samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ), -# ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ] -# # add samples to this request -# self.add_samples( request_two.id, request_two.name, samples ) -# for sample_name, fields in samples: -# self.check_page_for_string( sample_name ) -# self.check_page_for_string( 'Unsubmitted' ) -# for field_value in fields: -# self.check_page_for_string( field_value ) -# # submit the request -# self.submit_request( request_two.id, request_two.name ) -# request_two.refresh() -# # check if the request's state is now set to 'submitted' -# assert request_two.state is not request_two.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.SUBMITTED ) + def test_40_admin_create_request_on_behalf_of_regular_user( self ): + """Testing creating and submitting a request as an admin on behalf of a regular user""" + self.logout() + self.login( email='test(a)bx.psu.edu' ) + request_name = "RequestTwo" + # simulate request creation + url_str = '%s/requests_admin/new?create=True&create_request_button=Save&select_request_type=%i&select_user=%i&name=%s&library_id=%i&folder_id=%i&refresh=True&field_1=%s&field_2=%i' \ + % ( self.url, request_type.id, regular_user.id, request_name, library_one.id, library_one.root_folder.id, "field_1_value", user_address.id ) + self.home() + self.visit_url( url_str ) + self.check_page_for_string( "The new request named %s has been created" % request_name ) + global request_two + request_two = galaxy.model.Request.filter( and_( galaxy.model.Request.table.c.name==request_name, + galaxy.model.Request.table.c.deleted==False ) ).first() + # check if the request is showing in the 'unsubmitted' filter + self.home() + self.visit_url( '%s/requests_admin/list?show_filter=Unsubmitted' % self.url ) + self.check_page_for_string( request_two.name ) + # check if the request's state is now set to 'unsubmitted' + assert request_two.state is not request_two.states.UNSUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.UNSUBMITTED ) + # sample fields + samples = [ ( 'Sample One', [ 'S1 Field 0 Value' ] ), + ( 'Sample Two', [ 'S2 Field 0 Value' ] ) ] + # add samples to this request + self.add_samples( request_two.id, request_two.name, samples ) + for sample_name, fields in samples: + self.check_page_for_string( sample_name ) + self.check_page_for_string( 'Unsubmitted' ) + for field_value in fields: + self.check_page_for_string( field_value ) + # submit the request + self.submit_request( request_two.id, request_two.name ) + request_two.refresh() + # check if the request is showing in the 'submitted' filter + self.home() + self.visit_url( '%s/requests_admin/list?show_filter=Submitted' % self.url ) + self.check_page_for_string( request_two.name ) + # check if the request's state is now set to 'submitted' + assert request_two.state is not request_two.states.SUBMITTED, "The state of the request '%s' should be set to '%s'" % ( request_two.name, request_two.states.SUBMITTED ) + # check if both the requests is showing in the 'All' filter + self.home() + self.visit_url( '%s/requests_admin/list?show_filter=All' % self.url ) + self.check_page_for_string( request_one.name ) + self.check_page_for_string( request_two.name )

1 0

[hg] galaxy 2803: Prevent script tags in uploads as reported by ...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/88fdb7f40b0e changeset: 2803:88fdb7f40b0e user: Nate Coraor <nate(a)bx.psu.edu> date: Wed Sep 30 09:22:02 2009 -0400 description: Prevent script tags in uploads as reported by Mitsuteru Nakao 1 file(s) affected in this change: tools/data_source/upload.py diffs (16 lines): diff -r feec758a8774 -r 88fdb7f40b0e tools/data_source/upload.py --- a/tools/data_source/upload.py Wed Sep 30 08:28:31 2009 -0400 +++ b/tools/data_source/upload.py Wed Sep 30 09:22:02 2009 -0400 @@ -49,10 +49,11 @@ regexp2 = re.compile( "<IFRAME[^>]*>", re.I ) regexp3 = re.compile( "<FRAMESET[^>]*>", re.I ) regexp4 = re.compile( "<META[^>]*>", re.I ) + regexp5 = re.compile( "<SCRIPT[^>]*>", re.I ) lineno = 0 for line in temp: lineno += 1 - matches = regexp1.search( line ) or regexp2.search( line ) or regexp3.search( line ) or regexp4.search( line ) + matches = regexp1.search( line ) or regexp2.search( line ) or regexp3.search( line ) or regexp4.search( line ) or regexp5.search( line ) if matches: if chunk is None: temp.close()

1 0

[hg] galaxy 2802: Functional test fixes for uploading and sniffi...
by Nate Coraor 02 Oct '09

02 Oct '09

details: http://www.bx.psu.edu/hg/galaxy/rev/feec758a8774 changeset: 2802:feec758a8774 user: Greg Von Kuster <greg(a)bx.psu.edu> date: Wed Sep 30 08:28:31 2009 -0400 description: Functional test fixes for uploading and sniffing metadata - not sure when the behavior for these changed. 1 file(s) affected in this change: test/functional/test_sniffing_and_metadata_settings.py diffs (48 lines): diff -r 22addc979108 -r feec758a8774 test/functional/test_sniffing_and_metadata_settings.py --- a/test/functional/test_sniffing_and_metadata_settings.py Wed Sep 30 05:16:17 2009 -0400 +++ b/test/functional/test_sniffing_and_metadata_settings.py Wed Sep 30 08:28:31 2009 -0400 @@ -32,7 +32,7 @@ self.check_metadata_for_string( 'value="1.bed" value="\?"' ) self.check_metadata_for_string( 'Chrom column: <option value="1" selected> Start column: <option value="2" selected>' ) self.check_metadata_for_string( 'End column: <option value="3" selected> Strand column <option value="6" selected>' ) - self.check_metadata_for_string( 'Convert to new format <option value="bed">Genomic Intervals To BED <option value="gff">BED to GFF' ) + self.check_metadata_for_string( 'Convert to new format value="bed">Convert Genomic Intervals To BED <option value="gff">Convert BED to GFF' ) self.check_metadata_for_string( 'Change data type selected value="bed" selected="yes"' ) latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first() @@ -97,7 +97,7 @@ self.verify_dataset_correctness( '5.gff' ) self.check_history_for_string( '5.gff format: <span class="gff">gff</span>, database: \? Info: uploaded file' ) self.check_metadata_for_string( 'value="5.gff" value="\?"' ) - self.check_metadata_for_string( 'Convert to new format <option value="bed">GFF to BED' ) + self.check_metadata_for_string( 'Convert to new format <option value="bed">Convert GFF to BED' ) self.check_metadata_for_string( 'Change data type selected value="gff" selected="yes"' ) latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first() @@ -110,7 +110,7 @@ self.verify_dataset_correctness( '5.gff3' ) self.check_history_for_string( '5.gff3 format: <span class="gff3">gff3</span>, database: \? Info: uploaded file' ) self.check_metadata_for_string( 'value="5.gff3" value="\?"' ) - self.check_metadata_for_string( 'Convert to new format <option value="bed">GFF to BED' ) + self.check_metadata_for_string( 'Convert to new format <option value="bed">Convert GFF to BED' ) self.check_metadata_for_string( 'Change data type selected value="gff3" selected="yes"' ) latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first() @@ -138,7 +138,7 @@ self.check_metadata_for_string( 'value="1.interval" value="\?"' ) self.check_metadata_for_string( 'Chrom column: <option value="1" selected> Start column: <option value="2" selected>' ) self.check_metadata_for_string( 'End column: <option value="3" selected> Strand column <option value="6" selected>' ) - self.check_metadata_for_string( 'Convert to new format <option value="bed">Genomic Intervals To BED' ) + self.check_metadata_for_string( 'Convert to new format <option value="bed">Convert Genomic Intervals To BED' ) self.check_metadata_for_string( 'Change data type selected value="interval" selected="yes"' ) latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first() @@ -163,7 +163,7 @@ self.verify_dataset_correctness( '3.maf' ) self.check_history_for_string( '3.maf format: <span class="maf">maf</span>, database: \? Info: uploaded file' ) self.check_metadata_for_string( 'value="3.maf" value="\?"' ) - self.check_metadata_for_string( 'Convert to new format <option value="interval">MAF to Genomic Intervals <option value="fasta">MAF to Fasta' ) + self.check_metadata_for_string( 'Convert to new format <option value="interval">Convert MAF to Genomic Intervals <option value="fasta">Convert MAF to Fasta' ) self.check_metadata_for_string( 'Change data type selected value="maf" selected="yes"' ) latest_hda = galaxy.model.HistoryDatasetAssociation.query() \ .order_by( desc( galaxy.model.HistoryDatasetAssociation.table.c.create_time ) ).first()

1 0