galaxy-commits
Threads by month
- ----- 2026 -----
- February
- January
- ----- 2025 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2024 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2023 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2022 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2021 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2020 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2019 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2018 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2017 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2016 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2015 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2014 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2013 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2012 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2011 -----
- December
- November
- October
- September
- August
- July
- June
- May
- April
- March
- February
- January
- ----- 2010 -----
- December
- November
- October
- September
- August
- July
- June
- May
- 15302 discussions
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Dannon Baker <dannon.baker(a)emory.edu>
# Date 1277490919 14400
# Node ID 71b1a5920fc12514a9e151770eaf250d6fc6da46
# Parent c02ecbcc8dab54e7007b35db5a05e31211d77b01
# Parent d666e89f178eddb4175c388e81d8758096de72df
Merge.
1
0
galaxy-dist commit 42a4c30c7486: More bug fixes for the job wrapper user property.
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Nate Coraor <nate(a)bx.psu.edu>
# Date 1277395476 14400
# Node ID 42a4c30c7486b95ff8ce9c5fec116e76855996c7
# Parent a9afce9276da25ad1a56c185016fa19ecf242ccb
More bug fixes for the job wrapper user property.
--- a/lib/galaxy/jobs/__init__.py
+++ b/lib/galaxy/jobs/__init__.py
@@ -712,12 +712,16 @@ class JobWrapper( object ):
@property
def user( self ):
job = self.sa_session.query( model.Job ).get( self.job_id )
- if job.user is None and job.galaxy_session is not None:
+ if job.user is not None:
+ return job.user.email
+ elif job.galaxy_session is not None and job.galaxy_session.user is not None:
+ return job.galaxy_session.user.email
+ elif job.history is not None and job.history.user is not None:
+ return job.history.user.email
+ elif job.galaxy_session is not None:
return 'anonymous@' + job.galaxy_session.remote_addr.split()[-1]
- elif job.user is None:
+ else:
return 'anonymous@unknown'
- else:
- return job.history.user.email
class DefaultJobDispatcher( object ):
def __init__( self, app ):
1
0
galaxy-dist commit df5010a5df58: Changed the way sam_indel_filter expects quality score cutoffs and fixed bug so it checks qualities for correct bases in all cases
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Kelly Vincent <kpvincent(a)bx.psu.edu>
# Date 1277401418 14400
# Node ID df5010a5df581674896beec9b35ca50bf477f380
# Parent 42a4c30c7486b95ff8ce9c5fec116e76855996c7
Changed the way sam_indel_filter expects quality score cutoffs and fixed bug so it checks qualities for correct bases in all cases
--- a/tools/samtools/sam_indel_filter.py
+++ b/tools/samtools/sam_indel_filter.py
@@ -26,14 +26,26 @@ def __main__():
# prep output file
output = open( options.output, 'wb' )
# patterns
- pat_indel = re.compile( '(?P<before_match>(\d+[MIDNSHP])*)(?P<lmatch>\d+)M(?P<ins_del_width>\d+)(?P<ins_del>[ID])(?P<rmatch>\d+)M' )
+ pat_indel = re.compile( '(?P<before_match>(\d+[MNSHP])*)(?P<lmatch>\d+)M(?P<ins_del_width>\d+)(?P<ins_del>[ID])(?P<rmatch>\d+)M(?P<after_match>(\d+[MNSHP])*)' )
pat_matches = re.compile( '(\d+[MIDNSHP])+' )
- qual_thresh = int( options.quality_threshold )
- adj_bases = int( options.adjacent_bases )
+ try:
+ qual_thresh = int( options.quality_threshold ) + 33
+ if qual_thresh < 33 or qual_thresh > 126:
+ raise ValueError
+ except ValueError:
+ stop_err( 'Your quality threshold should be an integer between 0 and 93, inclusive.' )
+ try:
+ adj_bases = int( options.adjacent_bases )
+ if adj_bases < 1:
+ raise ValueError
+ except ValueError:
+ stop_err( 'The number of adjacent bases should be an integer greater than 1.' )
# record lines skipped because of more than one indel
multi_indel_lines = 0
# go through all lines in input file
- for line in open( options.input, 'rb' ):
+ for i,line in enumerate(open( options.input, 'rb' )):
+ if i > 1000:
+ break
if line and not line.startswith( '#' ) and not line.startswith( '@' ) :
split_line = line.split( '\t' )
cigar = split_line[5]
@@ -52,15 +64,15 @@ def __main__():
if pre_left_groups:
for pl in pre_left_groups.groups():
if pl.endswith( 'M' ) or pl.endswith( 'S' ) or pl.endswith( 'P' ):
- pre_left += int( pl[:-1] )
+ pre_left += pl[:-1]
parts[ 'pre_left' ] = pre_left
matches.append( parts )
- cigar_copy = cigar_copy[ len( parts[ 'lmatch' ] ) : ]
+ cigar_copy = cigar_copy[ len( parts[ 'lmatch' ] ) + 1 : ]
# see if matches meet filter requirements
if len( matches ) > 1:
multi_indel_lines += 1
elif len( matches ) == 1:
- pre_left = matches[0][ 'pre_left' ]
+ pre_left = int( matches[0][ 'pre_left' ] )
left = int( matches[0][ 'lmatch' ] )
right = int( matches[0][ 'rmatch' ] )
if matches[0][ 'ins_del' ] == 'D':
@@ -69,25 +81,23 @@ def __main__():
middle = 0
# if there are enough adjacent bases to check, then do so
if left >= adj_bases and right >= adj_bases:
- qual = split_line[10]
- left_bases = qual[ pre_left : pre_left + left ][ -adj_bases : ]
- right_bases = qual[ pre_left + left + middle - 1 : pre_left + left + middle + right ][ : adj_bases ]
+ quals = split_line[10]
+ left_quals = quals[ pre_left : pre_left + left ][ -adj_bases : ]
+ middle_quals = quals[ pre_left + left : pre_left + left + middle ]
+ right_quals = quals[ pre_left + left + middle : pre_left + left + middle + right ][ : adj_bases ]
qual_thresh_met = True
- for l in left_bases:
+ for l in left_quals:
if ord( l ) < qual_thresh:
qual_thresh_met = False
break
if qual_thresh_met:
- for r in right_bases:
+ for r in right_quals:
if ord( r ) < qual_thresh:
qual_thresh_met = False
break
# if filter reqs met, output line
if qual_thresh_met:
output.write( line )
- # error if there are multiple indels
- elif len( matches ) > 1:
- stop_err( 'There is more than one indel present in the alignment:\n%s' % line )
# close out file
output.close()
# if skipped lines because of more than one indel, output message
--- a/tools/samtools/sam_indel_filter.xml
+++ b/tools/samtools/sam_indel_filter.xml
@@ -9,7 +9,7 @@
</command><inputs><param format="sam" name="input1" type="data" label="Select dataset to filter" />
- <param name="quality_threshold" type="integer" value="40" label="Quality threshold for adjacent bases" help="You need to give the true value, not offset (see chart below), regardless of source FASTQ type" />
+ <param name="quality_threshold" type="integer" value="40" label="Quality threshold for adjacent bases" help="Takes Phred value assuming Sanger scale; usually between 0 and 40, but up to 93" /><param name="adjacent_bases" type="integer" value="1" label="The number of adjacent bases to match on either side of the indel" help="If one side is shorter than this width, it will still match if the long-enough side matches" /></inputs><outputs>
@@ -18,19 +18,19 @@
<tests><test><param name="input1" value="sam_indel_filter_in1.sam" ftype="sam"/>
- <param name="quality_threshold" value="47"/>
+ <param name="quality_threshold" value="14"/><param name="adjacent_bases" value="2"/><output name="out_file1" file="sam_indel_filter_out1.sam" ftype="sam"/></test><test><param name="input1" value="sam_indel_filter_in1.sam" ftype="sam"/>
- <param name="quality_threshold" value="62"/>
+ <param name="quality_threshold" value="29"/><param name="adjacent_bases" value="5"/><output name="out_file1" file="sam_indel_filter_out2.sam" ftype="sam"/></test><test><param name="input1" value="sam_indel_filter_in2.sam" ftype="sam"/>
- <param name="quality_threshold" value="40"/>
+ <param name="quality_threshold" value="7"/><param name="adjacent_bases" value="1"/><output name="out_file1" file="sam_indel_filter_out3.sam" ftype="sam"/></test>
@@ -39,7 +39,7 @@
**What it does**
-Allows extracting indels from SAM. Currently it can handle SAM with alignments with only one insertion or one deletion, and will throw an error if it encounters an alignment with more than one. It matches CIGAR strings (column 6 in the SAM file) like 5M3I5M or 4M2D10M, so there must be a match or mismatch of sufficient length on either side of the indel.
+Allows extracting indels from SAM. Currently it can handle SAM with alignments with only one insertion or one deletion, and will skip that alignment if it encounters one with more than one indel. It matches CIGAR strings (column 6 in the SAM file) like 5M3I5M or 4M2D10M, so there must be a match or mismatch of sufficient length on either side of the indel.
-----
@@ -49,10 +49,7 @@ Suppose you have the following::
r770 89 ref 116 37 17M1I5M = 72131356 0 CACACTGTGACAGACAGCGCAGC 00/02!!0//1200210AA44/1 XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
r770 181 ref 116 0 24M = 72131356 0 TTGGTGCGCGCGGTTGAGGGTTGG $$(#%%#$%#%####$%%##$###
- r1945 113 ref 181247988 0 23M 41710908 41710908 0 GAGAGAGAGAGAGAGAGAGAGAG PQRVUMNXYRPUXYXWXSOSZ]M XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
r1945 177 ref 41710908 0 23M 190342418 181247988 0 AGAGAGAGAGAGAGAGAGAGAGA SQQWZYURVYWX]]YXTSY]]ZM XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:163148 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
- r2363 115 ref 19671878 0 23M = 19671877 -1 AGAGAGAGAGAGAGAGAGAGTCT 77543:<55#"4!&=964518A> XT:A:R CM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:137 XM:i:2 XO:i:0 XG:i:0 MD:Z:23
- r2363 179 ref 19671877 0 23M = 19671878 1 GAGAGAGAGAGAGAGAGAGAGTC LE7402DD34FL:27AKE>;432 XT:A:R CM:i:0 SM:i:0 AM:i:0 X0:i:265 XM:i:0 XO:i:0 XG:i:0 MD:Z:23
r3671 117 ref 190342418 0 24M = 190342418 0 CTGGCGTTCTCGGCGTGGATGGGT #####$$##$#%#%%###%$#$##
r3671 153 ref 190342418 37 16M1I6M = 190342418 0 TCTAACTTAGCCTCATAATAGCT /<<!"0///////00/!!0121/ XT:A:U CM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:1 XO:i:1 XG:i:1 MD:Z:22
r3824 117 ref 80324999 0 24M = 80324999 0 TCCAGTCGCGTTGTTAGGTTCGGA #$#$$$#####%##%%###**#+/
1
0
galaxy-dist commit c02ecbcc8dab: New Feature: Administrative Job Lock.
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Dannon Baker <dannon.baker(a)emory.edu>
# Date 1277490892 14400
# Node ID c02ecbcc8dab54e7007b35db5a05e31211d77b01
# Parent df5010a5df581674896beec9b35ca50bf477f380
New Feature: Administrative Job Lock.
Admins can now lock (and unlock) all job dispatching. New jobs will remain in the job queue in the 'waiting' state until the lock is removed. Existing dispatched jobs are unaffected, and jobs can still be submitted, but they will not dispatch.
--- a/lib/galaxy/jobs/__init__.py
+++ b/lib/galaxy/jobs/__init__.py
@@ -73,6 +73,7 @@ class JobQueue( object ):
"""Start the job manager"""
self.app = app
self.sa_session = app.model.context
+ self.job_lock = False
# Should we read jobs form the database, or use an in memory queue
self.track_jobs_in_database = app.config.get_bool( 'track_jobs_in_database', False )
# Keep track of the pid that started the job manager, only it
@@ -197,8 +198,13 @@ class JobQueue( object ):
elif job_state == JOB_INPUT_DELETED:
log.info( "job %d unable to run: one or more inputs deleted" % job.job_id )
elif job_state == JOB_READY:
- self.dispatcher.put( job )
- log.debug( "job %d dispatched" % job.job_id)
+ if self.job_lock:
+ log.info("Job dispatch attempted for %s, but prevented by administrative lock." % job.job_id)
+ if not self.track_jobs_in_database:
+ new_waiting.append( job )
+ else:
+ self.dispatcher.put( job )
+ log.debug( "job %d dispatched" % job.job_id)
elif job_state == JOB_DELETED:
msg = "job %d deleted by user while still queued" % job.job_id
job.info = msg
--- a/lib/galaxy/web/base/controller.py
+++ b/lib/galaxy/web/base/controller.py
@@ -1404,7 +1404,8 @@ class Admin( object ):
@web.expose
@web.require_admin
- def jobs( self, trans, stop = [], stop_msg = None, cutoff = 180, **kwd ):
+ def jobs( self, trans, stop = [], stop_msg = None, cutoff = 180, job_lock = None, **kwd ):
+ # DBTODO admin job lock.
deleted = []
msg = None
status = None
@@ -1425,6 +1426,10 @@ class Admin( object ):
msg += ' for deletion: '
msg += ', '.join( deleted )
status = 'done'
+ if job_lock == 'lock':
+ trans.app.job_manager.job_queue.job_lock = True
+ elif job_lock == 'unlock':
+ trans.app.job_manager.job_queue.job_lock = False
cutoff_time = datetime.utcnow() - timedelta( seconds=int( cutoff ) )
jobs = trans.sa_session.query( trans.app.model.Job ) \
.filter( and_( trans.app.model.Job.table.c.update_time < cutoff_time,
@@ -1445,7 +1450,8 @@ class Admin( object ):
last_updated = last_updated,
cutoff = cutoff,
msg = msg,
- status = status )
+ status = status,
+ job_lock = trans.app.job_manager.job_queue.job_lock )
## ---- Utility methods -------------------------------------------------------
--- a/templates/admin/jobs.mako
+++ b/templates/admin/jobs.mako
@@ -110,5 +110,30 @@
</div></div></div>
+ <p/>
+ <div class="toolForm">
+ <div class="toolFormTitle">
+ Administrative Job Lock
+ </div>
+ <div class="toolFormBody">
+ %if job_lock==True:
+ <div class="form-row">
+ <p>All job execution is currently locked. Click here to unlock.</p>
+ <input type='hidden' name='job_lock' value='unlock'/>
+ </div>
+ <div class="form-row">
+ <input type="submit" class="primary-button" name="submit" value="Unlock">
+ </div>
+ %else:
+ <div class="form-row">
+ <p>To prevent new jobs from dispatching, you can lock down the job queue here.</p>
+ <input type='hidden' name='job_lock' value='lock'/>
+ </div>
+ <div class="form-row">
+ <input type="submit" class="primary-button" name="submit" value="Lock">
+ </div>
+ %endif
+ </div>
+ </div></form>
1
0
galaxy-dist commit 4dd860651b7e: GTF enhancements: add GTF as a default datatype for Galaxy, set column metadata, and add GTF sniffer.
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User jeremy goecks <jeremy.goecks(a)emory.edu>
# Date 1277480436 14400
# Node ID 4dd860651b7e46b24f9942e06bfacdbf6ab3b28e
# Parent df5010a5df581674896beec9b35ca50bf477f380
GTF enhancements: add GTF as a default datatype for Galaxy, set column metadata, and add GTF sniffer.
--- a/lib/galaxy/datatypes/interval.py
+++ b/lib/galaxy/datatypes/interval.py
@@ -854,9 +854,83 @@ class Gff3( Gff ):
class Gtf( Gff ):
"""Tab delimited data in Gtf format"""
file_ext = "gtf"
+ column_names = [ 'Seqname', 'Source', 'Feature', 'Start', 'End', 'Score', 'Strand', 'Frame', 'Attributes' ]
+
+ """Add metadata elements"""
+ MetadataElement( name="columns", default=9, desc="Number of columns", readonly=True, visible=False )
+ MetadataElement( name="column_types", default=['str','str','str','int','int','float','str','int','list'], param=metadata.ColumnTypesParameter, desc="Column types", readonly=True, visible=False )
+
def sniff( self, filename ):
- return False
+ """
+ Determines whether the file is in gtf format
+
+ GTF lines have nine required fields that must be tab-separated. The first eight GTF fields are the same as GFF.
+ The group field has been expanded into a list of attributes. Each attribute consists of a type/value pair.
+ Attributes must end in a semi-colon, and be separated from any following attribute by exactly one space.
+ The attribute list must begin with the two mandatory attributes:
+
+ gene_id value - A globally unique identifier for the genomic source of the sequence.
+ transcript_id value - A globally unique identifier for the predicted transcript.
+
+ For complete details see http://genome.ucsc.edu/FAQ/FAQformat#format4
+
+ >>> fname = get_test_fname( '1.bed' )
+ >>> Gtf().sniff( fname )
+ False
+ >>> fname = get_test_fname( 'test.gff' )
+ >>> Gtf().sniff( fname )
+ False
+ >>> fname = get_test_fname( 'test.gtf' )
+ >>> Gtf().sniff( fname )
+ True
+ """
+ headers = get_headers( filename, '\t' )
+ try:
+ if len(headers) < 2:
+ return False
+ for hdr in headers:
+ if hdr and hdr[0].startswith( '##gff-version' ) and hdr[0].find( '2' ) < 0:
+ return False
+ if hdr and hdr[0] and not hdr[0].startswith( '#' ):
+ if len(hdr) != 9:
+ return False
+ try:
+ int( hdr[3] )
+ int( hdr[4] )
+ except:
+ return False
+ if hdr[5] != '.':
+ try:
+ score = float( hdr[5] )
+ except:
+ return False
+ if hdr[6] not in data.valid_strand:
+ return False
+
+ # Check attributes for gene_id, transcript_id
+ attributes = hdr[8].split(";")
+ if len( attributes ) >= 2:
+ try:
+ # Imprecise: should check for a single space per the spec.
+ attr_name, attr_value = attributes[0].split(" ")
+ if attr_name != 'gene_id':
+ return False
+ except:
+ return False
+ try:
+ # Imprecise: should check for a single space per the spec.
+ attr_name, attr_value = attributes[1][1:].split(" ")
+ if attr_name != 'transcript_id':
+ return False
+ except:
+ return False
+ else:
+ return False
+ return True
+ except:
+ return False
+
class Wiggle( Tabular, _RemoteCallMixin ):
"""Tab delimited data in wiggle format"""
--- a/lib/galaxy/datatypes/sniff.py
+++ b/lib/galaxy/datatypes/sniff.py
@@ -238,6 +238,9 @@ def guess_ext( fname, sniff_order=None,
>>> fname = get_test_fname('file.html')
>>> guess_ext(fname)
'html'
+ >>> fname = get_test_fname('test.gtf')
+ >>> guess_ext(fname)
+ 'gtf'
>>> fname = get_test_fname('test.gff')
>>> guess_ext(fname)
'gff'
--- /dev/null
+++ b/lib/galaxy/datatypes/test/test.gtf
@@ -0,0 +1,500 @@
+chr13 Cufflinks transcript 3405463 3405542 1000 . . gene_id "CUFF.50189"; transcript_id "CUFF.50189.1"; FPKM "6.3668918357"; frac "1.000000"; conf_lo "0.000000"; conf_hi "17.963819"; cov "0.406914";
+chr13 Cufflinks exon 3405463 3405542 1000 . . gene_id "CUFF.50189"; transcript_id "CUFF.50189.1"; exon_number "1"; FPKM "6.3668918357"; frac "1.000000"; conf_lo "0.000000"; conf_hi "17.963819"; cov "0.406914";
+chr13 Cufflinks transcript 3473337 3473372 1000 . . gene_id "CUFF.50191"; transcript_id "CUFF.50191.1"; FPKM "11.7350749444"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.205225"; cov "0.750000";
+chr13 Cufflinks exon 3473337 3473372 1000 . . gene_id "CUFF.50191"; transcript_id "CUFF.50191.1"; exon_number "1"; FPKM "11.7350749444"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.205225"; cov "0.750000";
+chr13 Cufflinks transcript 3490319 3490350 1000 . . gene_id "CUFF.50193"; transcript_id "CUFF.50193.1"; FPKM "39.6058779373"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.338807"; cov "2.531250";
+chr13 Cufflinks exon 3490319 3490350 1000 . . gene_id "CUFF.50193"; transcript_id "CUFF.50193.1"; exon_number "1"; FPKM "39.6058779373"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.338807"; cov "2.531250";
+chr13 Cufflinks transcript 3565855 3566203 1000 - . gene_id "CUFF.50195"; transcript_id "CUFF.50195.1"; FPKM "29.8710998584"; frac "1.000000"; conf_lo "7.290671"; conf_hi "52.451529"; cov "1.909091";
+chr13 Cufflinks exon 3565855 3565913 1000 - . gene_id "CUFF.50195"; transcript_id "CUFF.50195.1"; exon_number "1"; FPKM "29.8710998584"; frac "1.000000"; conf_lo "7.290671"; conf_hi "52.451529"; cov "1.909091";
+chr13 Cufflinks exon 3566164 3566203 1000 - . gene_id "CUFF.50195"; transcript_id "CUFF.50195.1"; exon_number "2"; FPKM "29.8710998584"; frac "1.000000"; conf_lo "7.290671"; conf_hi "52.451529"; cov "1.909091";
+chr13 Cufflinks transcript 3566475 3566560 1000 . . gene_id "CUFF.50197"; transcript_id "CUFF.50197.1"; FPKM "14.7370708604"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.753975"; cov "0.941860";
+chr13 Cufflinks exon 3566475 3566560 1000 . . gene_id "CUFF.50197"; transcript_id "CUFF.50197.1"; exon_number "1"; FPKM "14.7370708604"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.753975"; cov "0.941860";
+chr13 Cufflinks transcript 3566664 3566942 1000 . . gene_id "CUFF.50199"; transcript_id "CUFF.50199.1"; FPKM "31.7874813134"; frac "1.000000"; conf_lo "17.911934"; conf_hi "45.663029"; cov "2.031569";
+chr13 Cufflinks exon 3566664 3566942 1000 . . gene_id "CUFF.50199"; transcript_id "CUFF.50199.1"; exon_number "1"; FPKM "31.7874813134"; frac "1.000000"; conf_lo "17.911934"; conf_hi "45.663029"; cov "2.031569";
+chr13 Cufflinks transcript 3568042 3568068 1000 . . gene_id "CUFF.50201"; transcript_id "CUFF.50201.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 3568042 3568068 1000 . . gene_id "CUFF.50201"; transcript_id "CUFF.50201.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 3569564 3569626 1000 . . gene_id "CUFF.50203"; transcript_id "CUFF.50203.1"; FPKM "13.4115142222"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.378260"; cov "0.857143";
+chr13 Cufflinks exon 3569564 3569626 1000 . . gene_id "CUFF.50203"; transcript_id "CUFF.50203.1"; exon_number "1"; FPKM "13.4115142222"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.378260"; cov "0.857143";
+chr13 Cufflinks transcript 3594171 3594199 1000 . . gene_id "CUFF.50205"; transcript_id "CUFF.50205.1"; FPKM "29.1353584826"; frac "1.000000"; conf_lo "0.000000"; conf_hi "70.338978"; cov "1.862069";
+chr13 Cufflinks exon 3594171 3594199 1000 . . gene_id "CUFF.50205"; transcript_id "CUFF.50205.1"; exon_number "1"; FPKM "29.1353584826"; frac "1.000000"; conf_lo "0.000000"; conf_hi "70.338978"; cov "1.862069";
+chr13 Cufflinks transcript 3606116 3613028 1000 - . gene_id "CUFF.50207"; transcript_id "CUFF.50207.1"; FPKM "19.6171377865"; frac "1.000000"; conf_lo "0.936995"; conf_hi "38.297281"; cov "1.253750";
+chr13 Cufflinks exon 3606116 3606146 1000 - . gene_id "CUFF.50207"; transcript_id "CUFF.50207.1"; exon_number "1"; FPKM "19.6171377865"; frac "1.000000"; conf_lo "0.936995"; conf_hi "38.297281"; cov "1.253750";
+chr13 Cufflinks exon 3612965 3613028 1000 - . gene_id "CUFF.50207"; transcript_id "CUFF.50207.1"; exon_number "2"; FPKM "19.6171377865"; frac "1.000000"; conf_lo "0.936995"; conf_hi "38.297281"; cov "1.253750";
+chr13 Cufflinks transcript 3603507 3603533 1000 . . gene_id "CUFF.50209"; transcript_id "CUFF.50209.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 3603507 3603533 1000 . . gene_id "CUFF.50209"; transcript_id "CUFF.50209.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 3604709 3604735 1000 . . gene_id "CUFF.50211"; transcript_id "CUFF.50211.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 3604709 3604735 1000 . . gene_id "CUFF.50211"; transcript_id "CUFF.50211.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 3612524 3612550 1000 . . gene_id "CUFF.50213"; transcript_id "CUFF.50213.1"; FPKM "117.3321730764"; frac "1.000000"; conf_lo "31.638086"; conf_hi "203.026260"; cov "7.498813";
+chr13 Cufflinks exon 3612524 3612550 1000 . . gene_id "CUFF.50213"; transcript_id "CUFF.50213.1"; exon_number "1"; FPKM "117.3321730764"; frac "1.000000"; conf_lo "31.638086"; conf_hi "203.026260"; cov "7.498813";
+chr13 Cufflinks transcript 3639250 3639290 1000 . . gene_id "CUFF.50215"; transcript_id "CUFF.50215.1"; FPKM "30.9119047316"; frac "1.000000"; conf_lo "0.000000"; conf_hi "66.605898"; cov "1.975610";
+chr13 Cufflinks exon 3639250 3639290 1000 . . gene_id "CUFF.50215"; transcript_id "CUFF.50215.1"; exon_number "1"; FPKM "30.9119047316"; frac "1.000000"; conf_lo "0.000000"; conf_hi "66.605898"; cov "1.975610";
+chr13 Cufflinks transcript 3649635 3649777 1000 . . gene_id "CUFF.50217"; transcript_id "CUFF.50217.1"; FPKM "14.7714230069"; frac "1.000000"; conf_lo "1.559461"; conf_hi "27.983385"; cov "0.944056";
+chr13 Cufflinks exon 3649635 3649777 1000 . . gene_id "CUFF.50217"; transcript_id "CUFF.50217.1"; exon_number "1"; FPKM "14.7714230069"; frac "1.000000"; conf_lo "1.559461"; conf_hi "27.983385"; cov "0.944056";
+chr13 Cufflinks transcript 3649976 3650072 1000 . . gene_id "CUFF.50219"; transcript_id "CUFF.50219.1"; FPKM "26.1317132782"; frac "1.000000"; conf_lo "4.795259"; conf_hi "47.468168"; cov "1.670103";
+chr13 Cufflinks exon 3649976 3650072 1000 . . gene_id "CUFF.50219"; transcript_id "CUFF.50219.1"; exon_number "1"; FPKM "26.1317132782"; frac "1.000000"; conf_lo "4.795259"; conf_hi "47.468168"; cov "1.670103";
+chr13 Cufflinks transcript 3650165 3650345 1000 . . gene_id "CUFF.50221"; transcript_id "CUFF.50221.1"; FPKM "16.3383363867"; frac "1.000000"; conf_lo "3.987715"; conf_hi "28.688958"; cov "1.044199";
+chr13 Cufflinks exon 3650165 3650345 1000 . . gene_id "CUFF.50221"; transcript_id "CUFF.50221.1"; exon_number "1"; FPKM "16.3383363867"; frac "1.000000"; conf_lo "3.987715"; conf_hi "28.688958"; cov "1.044199";
+chr13 Cufflinks transcript 3650498 3651017 1000 . . gene_id "CUFF.50223"; transcript_id "CUFF.50223.1"; FPKM "38.9965567383"; frac "1.000000"; conf_lo "27.739220"; conf_hi "50.253893"; cov "2.492308";
+chr13 Cufflinks exon 3650498 3651017 1000 . . gene_id "CUFF.50223"; transcript_id "CUFF.50223.1"; exon_number "1"; FPKM "38.9965567383"; frac "1.000000"; conf_lo "27.739220"; conf_hi "50.253893"; cov "2.492308";
+chr13 Cufflinks transcript 3652248 3652287 1000 . . gene_id "CUFF.50225"; transcript_id "CUFF.50225.1"; FPKM "21.1231348999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.995759"; cov "1.350000";
+chr13 Cufflinks exon 3652248 3652287 1000 . . gene_id "CUFF.50225"; transcript_id "CUFF.50225.1"; exon_number "1"; FPKM "21.1231348999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.995759"; cov "1.350000";
+chr13 Cufflinks transcript 3652708 3652757 1000 . . gene_id "CUFF.50227"; transcript_id "CUFF.50227.1"; FPKM "16.8985079199"; frac "1.000000"; conf_lo "0.000000"; conf_hi "40.796607"; cov "1.080000";
+chr13 Cufflinks exon 3652708 3652757 1000 . . gene_id "CUFF.50227"; transcript_id "CUFF.50227.1"; exon_number "1"; FPKM "16.8985079199"; frac "1.000000"; conf_lo "0.000000"; conf_hi "40.796607"; cov "1.080000";
+chr13 Cufflinks transcript 3652858 3652892 1000 . . gene_id "CUFF.50229"; transcript_id "CUFF.50229.1"; FPKM "24.1407255999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "58.280867"; cov "1.542857";
+chr13 Cufflinks exon 3652858 3652892 1000 . . gene_id "CUFF.50229"; transcript_id "CUFF.50229.1"; exon_number "1"; FPKM "24.1407255999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "58.280867"; cov "1.542857";
+chr13 Cufflinks transcript 3803155 3803189 1000 . . gene_id "CUFF.50231"; transcript_id "CUFF.50231.1"; FPKM "193.0684834367"; frac "1.000000"; conf_lo "96.519912"; conf_hi "289.617054"; cov "12.339194";
+chr13 Cufflinks exon 3803155 3803189 1000 . . gene_id "CUFF.50231"; transcript_id "CUFF.50231.1"; exon_number "1"; FPKM "193.0684834367"; frac "1.000000"; conf_lo "96.519912"; conf_hi "289.617054"; cov "12.339194";
+chr13 Cufflinks transcript 3881504 3881530 1000 . . gene_id "CUFF.50233"; transcript_id "CUFF.50233.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 3881504 3881530 1000 . . gene_id "CUFF.50233"; transcript_id "CUFF.50233.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 3881847 3881940 1000 . . gene_id "CUFF.50235"; transcript_id "CUFF.50235.1"; FPKM "11.2303742880"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.439173"; cov "0.717744";
+chr13 Cufflinks exon 3881847 3881940 1000 . . gene_id "CUFF.50235"; transcript_id "CUFF.50235.1"; exon_number "1"; FPKM "11.2303742880"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.439173"; cov "0.717744";
+chr13 Cufflinks transcript 3882719 3882811 1000 . . gene_id "CUFF.50237"; transcript_id "CUFF.50237.1"; FPKM "9.0852193118"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.933660"; cov "0.580645";
+chr13 Cufflinks exon 3882719 3882811 1000 . . gene_id "CUFF.50237"; transcript_id "CUFF.50237.1"; exon_number "1"; FPKM "9.0852193118"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.933660"; cov "0.580645";
+chr13 Cufflinks transcript 3940646 3940672 1000 . . gene_id "CUFF.50239"; transcript_id "CUFF.50239.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 3940646 3940672 1000 . . gene_id "CUFF.50239"; transcript_id "CUFF.50239.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 4135893 4135996 1000 . . gene_id "CUFF.50241"; transcript_id "CUFF.50241.1"; FPKM "8.1242826538"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.613753"; cov "0.519231";
+chr13 Cufflinks exon 4135893 4135996 1000 . . gene_id "CUFF.50241"; transcript_id "CUFF.50241.1"; exon_number "1"; FPKM "8.1242826538"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.613753"; cov "0.519231";
+chr13 Cufflinks transcript 4246054 4246080 1000 . . gene_id "CUFF.50243"; transcript_id "CUFF.50243.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 4246054 4246080 1000 . . gene_id "CUFF.50243"; transcript_id "CUFF.50243.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 4246081 4246107 1000 . . gene_id "CUFF.50245"; transcript_id "CUFF.50245.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 4246081 4246107 1000 . . gene_id "CUFF.50245"; transcript_id "CUFF.50245.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 4247347 4247373 1000 . . gene_id "CUFF.50247"; transcript_id "CUFF.50247.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 4247347 4247373 1000 . . gene_id "CUFF.50247"; transcript_id "CUFF.50247.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 4247393 4247419 1000 . . gene_id "CUFF.50249"; transcript_id "CUFF.50249.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 4247393 4247419 1000 . . gene_id "CUFF.50249"; transcript_id "CUFF.50249.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 4253585 4253611 1000 . . gene_id "CUFF.50251"; transcript_id "CUFF.50251.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 4253585 4253611 1000 . . gene_id "CUFF.50251"; transcript_id "CUFF.50251.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 4356816 4356842 1000 . . gene_id "CUFF.50253"; transcript_id "CUFF.50253.1"; FPKM "31.2563804501"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.485841"; cov "1.997626";
+chr13 Cufflinks exon 4356816 4356842 1000 . . gene_id "CUFF.50253"; transcript_id "CUFF.50253.1"; exon_number "1"; FPKM "31.2563804501"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.485841"; cov "1.997626";
+chr13 Cufflinks transcript 4591975 4592074 1000 . . gene_id "CUFF.50255"; transcript_id "CUFF.50255.1"; FPKM "16.8985079199"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.797016"; cov "1.080000";
+chr13 Cufflinks exon 4591975 4592074 1000 . . gene_id "CUFF.50255"; transcript_id "CUFF.50255.1"; exon_number "1"; FPKM "16.8985079199"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.797016"; cov "1.080000";
+chr13 Cufflinks transcript 4592148 4592531 1000 . . gene_id "CUFF.50257"; transcript_id "CUFF.50257.1"; FPKM "22.0032655207"; frac "1.000000"; conf_lo "12.163106"; conf_hi "31.843425"; cov "1.406250";
+chr13 Cufflinks exon 4592148 4592531 1000 . . gene_id "CUFF.50257"; transcript_id "CUFF.50257.1"; exon_number "1"; FPKM "22.0032655207"; frac "1.000000"; conf_lo "12.163106"; conf_hi "31.843425"; cov "1.406250";
+chr13 Cufflinks transcript 4592862 4592890 1000 . . gene_id "CUFF.50259"; transcript_id "CUFF.50259.1"; FPKM "58.2707169652"; frac "1.000000"; conf_lo "0.000000"; conf_hi "116.541434"; cov "3.724138";
+chr13 Cufflinks exon 4592862 4592890 1000 . . gene_id "CUFF.50259"; transcript_id "CUFF.50259.1"; exon_number "1"; FPKM "58.2707169652"; frac "1.000000"; conf_lo "0.000000"; conf_hi "116.541434"; cov "3.724138";
+chr13 Cufflinks transcript 4594319 4594938 1000 - . gene_id "CUFF.50261"; transcript_id "CUFF.50261.1"; FPKM "29.3887094260"; frac "1.000000"; conf_lo "8.607754"; conf_hi "50.169665"; cov "1.878261";
+chr13 Cufflinks exon 4594319 4594400 1000 - . gene_id "CUFF.50261"; transcript_id "CUFF.50261.1"; exon_number "1"; FPKM "29.3887094260"; frac "1.000000"; conf_lo "8.607754"; conf_hi "50.169665"; cov "1.878261";
+chr13 Cufflinks exon 4594906 4594938 1000 - . gene_id "CUFF.50261"; transcript_id "CUFF.50261.1"; exon_number "2"; FPKM "29.3887094260"; frac "1.000000"; conf_lo "8.607754"; conf_hi "50.169665"; cov "1.878261";
+chr13 Cufflinks transcript 4596799 4598059 1000 - . gene_id "CUFF.50263"; transcript_id "CUFF.50263.1"; FPKM "22.8358215134"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.671643"; cov "1.459459";
+chr13 Cufflinks exon 4596799 4596828 1000 - . gene_id "CUFF.50263"; transcript_id "CUFF.50263.1"; exon_number "1"; FPKM "22.8358215134"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.671643"; cov "1.459459";
+chr13 Cufflinks exon 4598016 4598059 1000 - . gene_id "CUFF.50263"; transcript_id "CUFF.50263.1"; exon_number "2"; FPKM "22.8358215134"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.671643"; cov "1.459459";
+chr13 Cufflinks transcript 4601790 4601816 1000 . . gene_id "CUFF.50265"; transcript_id "CUFF.50265.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 4601790 4601816 1000 . . gene_id "CUFF.50265"; transcript_id "CUFF.50265.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 4601884 4601952 1000 . . gene_id "CUFF.50267"; transcript_id "CUFF.50267.1"; FPKM "12.2452955941"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.562759"; cov "0.782609";
+chr13 Cufflinks exon 4601884 4601952 1000 . . gene_id "CUFF.50267"; transcript_id "CUFF.50267.1"; exon_number "1"; FPKM "12.2452955941"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.562759"; cov "0.782609";
+chr13 Cufflinks transcript 3541632 3541797 1000 . . gene_id "CUFF.50269"; transcript_id "CUFF.50269.1"; FPKM "10.1798240481"; frac "1.000000"; conf_lo "0.000000"; conf_hi "20.359648"; cov "0.650602";
+chr13 Cufflinks exon 3541632 3541797 1000 . . gene_id "CUFF.50269"; transcript_id "CUFF.50269.1"; exon_number "1"; FPKM "10.1798240481"; frac "1.000000"; conf_lo "0.000000"; conf_hi "20.359648"; cov "0.650602";
+chr13 Cufflinks transcript 3541917 3542016 1000 . . gene_id "CUFF.50271"; transcript_id "CUFF.50271.1"; FPKM "12.6738809399"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.308418"; cov "0.810000";
+chr13 Cufflinks exon 3541917 3542016 1000 . . gene_id "CUFF.50271"; transcript_id "CUFF.50271.1"; exon_number "1"; FPKM "12.6738809399"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.308418"; cov "0.810000";
+chr13 Cufflinks transcript 3542096 3542122 1000 . . gene_id "CUFF.50273"; transcript_id "CUFF.50273.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 3542096 3542122 1000 . . gene_id "CUFF.50273"; transcript_id "CUFF.50273.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 3548183 3548209 1000 . . gene_id "CUFF.50275"; transcript_id "CUFF.50275.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 3548183 3548209 1000 . . gene_id "CUFF.50275"; transcript_id "CUFF.50275.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 3559238 3559264 1000 . . gene_id "CUFF.50277"; transcript_id "CUFF.50277.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 3559238 3559264 1000 . . gene_id "CUFF.50277"; transcript_id "CUFF.50277.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 3559265 3559291 1000 . . gene_id "CUFF.50279"; transcript_id "CUFF.50279.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 3559265 3559291 1000 . . gene_id "CUFF.50279"; transcript_id "CUFF.50279.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 3561489 3561515 1000 . . gene_id "CUFF.50281"; transcript_id "CUFF.50281.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 3561489 3561515 1000 . . gene_id "CUFF.50281"; transcript_id "CUFF.50281.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 3561516 3561616 1000 . . gene_id "CUFF.50283"; transcript_id "CUFF.50283.1"; FPKM "12.5483969702"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.038038"; cov "0.801980";
+chr13 Cufflinks exon 3561516 3561616 1000 . . gene_id "CUFF.50283"; transcript_id "CUFF.50283.1"; exon_number "1"; FPKM "12.5483969702"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.038038"; cov "0.801980";
+chr13 Cufflinks transcript 3563788 3563913 1000 . . gene_id "CUFF.50285"; transcript_id "CUFF.50285.1"; FPKM "16.7564314774"; frac "1.000000"; conf_lo "1.765464"; conf_hi "31.747399"; cov "1.070920";
+chr13 Cufflinks exon 3563788 3563913 1000 . . gene_id "CUFF.50285"; transcript_id "CUFF.50285.1"; exon_number "1"; FPKM "16.7564314774"; frac "1.000000"; conf_lo "1.765464"; conf_hi "31.747399"; cov "1.070920";
+chr13 Cufflinks transcript 3564114 3564162 1000 . . gene_id "CUFF.50287"; transcript_id "CUFF.50287.1"; FPKM "68.9735017140"; frac "1.000000"; conf_lo "20.201871"; conf_hi "117.745132"; cov "4.408163";
+chr13 Cufflinks exon 3564114 3564162 1000 . . gene_id "CUFF.50287"; transcript_id "CUFF.50287.1"; exon_number "1"; FPKM "68.9735017140"; frac "1.000000"; conf_lo "20.201871"; conf_hi "117.745132"; cov "4.408163";
+chr13 Cufflinks transcript 5861035 5872268 1000 - . gene_id "CUFF.50289"; transcript_id "CUFF.50289.1"; FPKM "7.5439767500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "18.212771"; cov "0.482143";
+chr13 Cufflinks exon 5861035 5861117 1000 - . gene_id "CUFF.50289"; transcript_id "CUFF.50289.1"; exon_number "1"; FPKM "7.5439767500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "18.212771"; cov "0.482143";
+chr13 Cufflinks exon 5872240 5872268 1000 - . gene_id "CUFF.50289"; transcript_id "CUFF.50289.1"; exon_number "2"; FPKM "7.5439767500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "18.212771"; cov "0.482143";
+chr13 Cufflinks transcript 5864061 5864135 1000 . . gene_id "CUFF.50291"; transcript_id "CUFF.50291.1"; FPKM "16.8985079199"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.411224"; cov "1.080000";
+chr13 Cufflinks exon 5864061 5864135 1000 . . gene_id "CUFF.50291"; transcript_id "CUFF.50291.1"; exon_number "1"; FPKM "16.8985079199"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.411224"; cov "1.080000";
+chr13 Cufflinks transcript 5864192 5864585 1000 . . gene_id "CUFF.50293"; transcript_id "CUFF.50293.1"; FPKM "18.2280859542"; frac "1.000000"; conf_lo "9.386166"; conf_hi "27.070006"; cov "1.164975";
+chr13 Cufflinks exon 5864192 5864585 1000 . . gene_id "CUFF.50293"; transcript_id "CUFF.50293.1"; exon_number "1"; FPKM "18.2280859542"; frac "1.000000"; conf_lo "9.386166"; conf_hi "27.070006"; cov "1.164975";
+chr13 Cufflinks transcript 5865070 5865096 1000 . . gene_id "CUFF.50295"; transcript_id "CUFF.50295.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 5865070 5865096 1000 . . gene_id "CUFF.50295"; transcript_id "CUFF.50295.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 5865442 5866941 1000 + . gene_id "CUFF.50297"; transcript_id "CUFF.50297.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.446269"; cov "0.843750";
+chr13 Cufflinks exon 5865442 5865510 1000 + . gene_id "CUFF.50297"; transcript_id "CUFF.50297.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.446269"; cov "0.843750";
+chr13 Cufflinks exon 5866915 5866941 1000 + . gene_id "CUFF.50297"; transcript_id "CUFF.50297.1"; exon_number "2"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.446269"; cov "0.843750";
+chr13 Cufflinks transcript 5866598 5866661 1000 . . gene_id "CUFF.50299"; transcript_id "CUFF.50299.1"; FPKM "92.4137151871"; frac "1.000000"; conf_lo "43.016507"; conf_hi "141.810924"; cov "5.906250";
+chr13 Cufflinks exon 5866598 5866661 1000 . . gene_id "CUFF.50299"; transcript_id "CUFF.50299.1"; exon_number "1"; FPKM "92.4137151871"; frac "1.000000"; conf_lo "43.016507"; conf_hi "141.810924"; cov "5.906250";
+chr13 Cufflinks transcript 5866756 5866871 1000 . . gene_id "CUFF.50301"; transcript_id "CUFF.50301.1"; FPKM "83.7641556375"; frac "1.000000"; conf_lo "48.832088"; conf_hi "118.696223"; cov "5.353448";
+chr13 Cufflinks exon 5866756 5866871 1000 . . gene_id "CUFF.50301"; transcript_id "CUFF.50301.1"; exon_number "1"; FPKM "83.7641556375"; frac "1.000000"; conf_lo "48.832088"; conf_hi "118.696223"; cov "5.353448";
+chr13 Cufflinks transcript 5866964 5867014 1000 . . gene_id "CUFF.50303"; transcript_id "CUFF.50303.1"; FPKM "124.2537347053"; frac "1.000000"; conf_lo "60.089382"; conf_hi "188.418087"; cov "7.941176";
+chr13 Cufflinks exon 5866964 5867014 1000 . . gene_id "CUFF.50303"; transcript_id "CUFF.50303.1"; exon_number "1"; FPKM "124.2537347053"; frac "1.000000"; conf_lo "60.089382"; conf_hi "188.418087"; cov "7.941176";
+chr13 Cufflinks transcript 5867386 5867412 1000 . . gene_id "CUFF.50305"; transcript_id "CUFF.50305.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 5867386 5867412 1000 . . gene_id "CUFF.50305"; transcript_id "CUFF.50305.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 5867480 5867506 1000 . . gene_id "CUFF.50307"; transcript_id "CUFF.50307.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 5867480 5867506 1000 . . gene_id "CUFF.50307"; transcript_id "CUFF.50307.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 5867688 5867737 1000 . . gene_id "CUFF.50309"; transcript_id "CUFF.50309.1"; FPKM "25.3477618799"; frac "1.000000"; conf_lo "0.000000"; conf_hi "54.616836"; cov "1.620000";
+chr13 Cufflinks exon 5867688 5867737 1000 . . gene_id "CUFF.50309"; transcript_id "CUFF.50309.1"; exon_number "1"; FPKM "25.3477618799"; frac "1.000000"; conf_lo "0.000000"; conf_hi "54.616836"; cov "1.620000";
+chr13 Cufflinks transcript 5867820 5868008 1000 . . gene_id "CUFF.50311"; transcript_id "CUFF.50311.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "3.818923"; conf_hi "27.474610"; cov "1.000000";
+chr13 Cufflinks exon 5867820 5868008 1000 . . gene_id "CUFF.50311"; transcript_id "CUFF.50311.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "3.818923"; conf_hi "27.474610"; cov "1.000000";
+chr13 Cufflinks transcript 5868254 5868314 1000 . . gene_id "CUFF.50313"; transcript_id "CUFF.50313.1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246";
+chr13 Cufflinks exon 5868254 5868314 1000 . . gene_id "CUFF.50313"; transcript_id "CUFF.50313.1"; exon_number "1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246";
+chr13 Cufflinks transcript 5869125 5869300 1000 . . gene_id "CUFF.50315"; transcript_id "CUFF.50315.1"; FPKM "88.8131808291"; frac "1.000000"; conf_lo "59.611587"; conf_hi "118.014775"; cov "5.676136";
+chr13 Cufflinks exon 5869125 5869300 1000 . . gene_id "CUFF.50315"; transcript_id "CUFF.50315.1"; exon_number "1"; FPKM "88.8131808291"; frac "1.000000"; conf_lo "59.611587"; conf_hi "118.014775"; cov "5.676136";
+chr13 Cufflinks transcript 5869455 5869484 1000 . . gene_id "CUFF.50317"; transcript_id "CUFF.50317.1"; FPKM "133.7631356353"; frac "1.000000"; conf_lo "46.960728"; conf_hi "220.565544"; cov "8.548931";
+chr13 Cufflinks exon 5869455 5869484 1000 . . gene_id "CUFF.50317"; transcript_id "CUFF.50317.1"; exon_number "1"; FPKM "133.7631356353"; frac "1.000000"; conf_lo "46.960728"; conf_hi "220.565544"; cov "8.548931";
+chr13 Cufflinks transcript 5869555 5869581 1000 . . gene_id "CUFF.50319"; transcript_id "CUFF.50319.1"; FPKM "125.1741327402"; frac "1.000000"; conf_lo "36.662655"; conf_hi "213.685611"; cov "8.000000";
+chr13 Cufflinks exon 5869555 5869581 1000 . . gene_id "CUFF.50319"; transcript_id "CUFF.50319.1"; exon_number "1"; FPKM "125.1741327402"; frac "1.000000"; conf_lo "36.662655"; conf_hi "213.685611"; cov "8.000000";
+chr13 Cufflinks transcript 6205097 6205155 1000 . . gene_id "CUFF.50321"; transcript_id "CUFF.50321.1"; FPKM "14.3207694237"; frac "1.000000"; conf_lo "0.000000"; conf_hi "34.573396"; cov "0.915254";
+chr13 Cufflinks exon 6205097 6205155 1000 . . gene_id "CUFF.50321"; transcript_id "CUFF.50321.1"; exon_number "1"; FPKM "14.3207694237"; frac "1.000000"; conf_lo "0.000000"; conf_hi "34.573396"; cov "0.915254";
+chr13 Cufflinks transcript 6227260 6227293 1000 . . gene_id "CUFF.50323"; transcript_id "CUFF.50323.1"; FPKM "18.6233083846"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.047086"; cov "1.190234";
+chr13 Cufflinks exon 6227260 6227293 1000 . . gene_id "CUFF.50323"; transcript_id "CUFF.50323.1"; exon_number "1"; FPKM "18.6233083846"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.047086"; cov "1.190234";
+chr13 Cufflinks transcript 6553021 6553051 1000 . . gene_id "CUFF.50325"; transcript_id "CUFF.50325.1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935";
+chr13 Cufflinks exon 6553021 6553051 1000 . . gene_id "CUFF.50325"; transcript_id "CUFF.50325.1"; exon_number "1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935";
+chr13 Cufflinks transcript 6576412 6576471 1000 . . gene_id "CUFF.50327"; transcript_id "CUFF.50327.1"; FPKM "14.0820899333"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.997173"; cov "0.900000";
+chr13 Cufflinks exon 6576412 6576471 1000 . . gene_id "CUFF.50327"; transcript_id "CUFF.50327.1"; exon_number "1"; FPKM "14.0820899333"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.997173"; cov "0.900000";
+chr13 Cufflinks transcript 6576625 6576734 1000 . . gene_id "CUFF.50329"; transcript_id "CUFF.50329.1"; FPKM "26.8839898726"; frac "1.000000"; conf_lo "6.561604"; conf_hi "47.206376"; cov "1.718182";
+chr13 Cufflinks exon 6576625 6576734 1000 . . gene_id "CUFF.50329"; transcript_id "CUFF.50329.1"; exon_number "1"; FPKM "26.8839898726"; frac "1.000000"; conf_lo "6.561604"; conf_hi "47.206376"; cov "1.718182";
+chr13 Cufflinks transcript 6577727 6577820 1000 . . gene_id "CUFF.50331"; transcript_id "CUFF.50331.1"; FPKM "31.4599881488"; frac "1.000000"; conf_lo "7.678472"; conf_hi "55.241504"; cov "2.010638";
+chr13 Cufflinks exon 6577727 6577820 1000 . . gene_id "CUFF.50331"; transcript_id "CUFF.50331.1"; exon_number "1"; FPKM "31.4599881488"; frac "1.000000"; conf_lo "7.678472"; conf_hi "55.241504"; cov "2.010638";
+chr13 Cufflinks transcript 6579706 6579858 1000 . . gene_id "CUFF.50333"; transcript_id "CUFF.50333.1"; FPKM "11.0447764182"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.089553"; cov "0.705882";
+chr13 Cufflinks exon 6579706 6579858 1000 . . gene_id "CUFF.50333"; transcript_id "CUFF.50333.1"; exon_number "1"; FPKM "11.0447764182"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.089553"; cov "0.705882";
+chr13 Cufflinks transcript 6580126 6580152 1000 . . gene_id "CUFF.50335"; transcript_id "CUFF.50335.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 6580126 6580152 1000 . . gene_id "CUFF.50335"; transcript_id "CUFF.50335.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 6580257 6580295 1000 . . gene_id "CUFF.50337"; transcript_id "CUFF.50337.1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
+chr13 Cufflinks exon 6580257 6580295 1000 . . gene_id "CUFF.50337"; transcript_id "CUFF.50337.1"; exon_number "1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
+chr13 Cufflinks transcript 6583845 6585843 1000 - . gene_id "CUFF.50339"; transcript_id "CUFF.50339.1"; FPKM "163.2242242265"; frac "1.000000"; conf_lo "127.815919"; conf_hi "198.632530"; cov "10.431818";
+chr13 Cufflinks exon 6583845 6583946 1000 - . gene_id "CUFF.50339"; transcript_id "CUFF.50339.1"; exon_number "1"; FPKM "163.2242242265"; frac "1.000000"; conf_lo "127.815919"; conf_hi "198.632530"; cov "10.431818";
+chr13 Cufflinks exon 6585726 6585843 1000 - . gene_id "CUFF.50339"; transcript_id "CUFF.50339.1"; exon_number "2"; FPKM "163.2242242265"; frac "1.000000"; conf_lo "127.815919"; conf_hi "198.632530"; cov "10.431818";
+chr13 Cufflinks transcript 6586295 6587966 1000 - . gene_id "CUFF.50341"; transcript_id "CUFF.50341.1"; FPKM "82.5011329424"; frac "1.000000"; conf_lo "60.835274"; conf_hi "104.166992"; cov "5.272727";
+chr13 Cufflinks exon 6586295 6586359 1000 - . gene_id "CUFF.50341"; transcript_id "CUFF.50341.1"; exon_number "1"; FPKM "82.5011329424"; frac "1.000000"; conf_lo "60.835274"; conf_hi "104.166992"; cov "5.272727";
+chr13 Cufflinks exon 6587735 6587966 1000 - . gene_id "CUFF.50341"; transcript_id "CUFF.50341.1"; exon_number "2"; FPKM "82.5011329424"; frac "1.000000"; conf_lo "60.835274"; conf_hi "104.166992"; cov "5.272727";
+chr13 Cufflinks transcript 6588113 6588703 1000 . . gene_id "CUFF.50343"; transcript_id "CUFF.50343.1"; FPKM "42.8896140100"; frac "1.000000"; conf_lo "31.815563"; conf_hi "53.963665"; cov "2.741117";
+chr13 Cufflinks exon 6588113 6588703 1000 . . gene_id "CUFF.50343"; transcript_id "CUFF.50343.1"; exon_number "1"; FPKM "42.8896140100"; frac "1.000000"; conf_lo "31.815563"; conf_hi "53.963665"; cov "2.741117";
+chr13 Cufflinks transcript 6588763 6588911 1000 . . gene_id "CUFF.50345"; transcript_id "CUFF.50345.1"; FPKM "31.1885213287"; frac "1.000000"; conf_lo "12.381135"; conf_hi "49.995907"; cov "1.993289";
+chr13 Cufflinks exon 6588763 6588911 1000 . . gene_id "CUFF.50345"; transcript_id "CUFF.50345.1"; exon_number "1"; FPKM "31.1885213287"; frac "1.000000"; conf_lo "12.381135"; conf_hi "49.995907"; cov "1.993289";
+chr13 Cufflinks transcript 6588964 6589091 1000 . . gene_id "CUFF.50347"; transcript_id "CUFF.50347.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.403919"; cov "0.843750";
+chr13 Cufflinks exon 6588964 6589091 1000 . . gene_id "CUFF.50347"; transcript_id "CUFF.50347.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.403919"; cov "0.843750";
+chr13 Cufflinks transcript 6589153 6589383 1000 . . gene_id "CUFF.50349"; transcript_id "CUFF.50349.1"; FPKM "12.8018999393"; frac "1.000000"; conf_lo "3.124573"; conf_hi "22.479227"; cov "0.818182";
+chr13 Cufflinks exon 6589153 6589383 1000 . . gene_id "CUFF.50349"; transcript_id "CUFF.50349.1"; exon_number "1"; FPKM "12.8018999393"; frac "1.000000"; conf_lo "3.124573"; conf_hi "22.479227"; cov "0.818182";
+chr13 Cufflinks transcript 6589994 6590086 1000 . . gene_id "CUFF.50351"; transcript_id "CUFF.50351.1"; FPKM "9.0852193118"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.933660"; cov "0.580645";
+chr13 Cufflinks exon 6589994 6590086 1000 . . gene_id "CUFF.50351"; transcript_id "CUFF.50351.1"; exon_number "1"; FPKM "9.0852193118"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.933660"; cov "0.580645";
+chr13 Cufflinks transcript 6590329 6590359 1000 . . gene_id "CUFF.50353"; transcript_id "CUFF.50353.1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935";
+chr13 Cufflinks exon 6590329 6590359 1000 . . gene_id "CUFF.50353"; transcript_id "CUFF.50353.1"; exon_number "1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935";
+chr13 Cufflinks transcript 6590592 6590645 1000 . . gene_id "CUFF.50355"; transcript_id "CUFF.50355.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.774636"; cov "1.000000";
+chr13 Cufflinks exon 6590592 6590645 1000 . . gene_id "CUFF.50355"; transcript_id "CUFF.50355.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.774636"; cov "1.000000";
+chr13 Cufflinks transcript 6590963 6591056 1000 . . gene_id "CUFF.50357"; transcript_id "CUFF.50357.1"; FPKM "17.9771360850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.954272"; cov "1.148936";
+chr13 Cufflinks exon 6590963 6591056 1000 . . gene_id "CUFF.50357"; transcript_id "CUFF.50357.1"; exon_number "1"; FPKM "17.9771360850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.954272"; cov "1.148936";
+chr13 Cufflinks transcript 6591182 6591208 1000 . . gene_id "CUFF.50359"; transcript_id "CUFF.50359.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 6591182 6591208 1000 . . gene_id "CUFF.50359"; transcript_id "CUFF.50359.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 6591662 6591724 1000 . . gene_id "CUFF.50361"; transcript_id "CUFF.50361.1"; FPKM "13.4115142222"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.378260"; cov "0.857143";
+chr13 Cufflinks exon 6591662 6591724 1000 . . gene_id "CUFF.50361"; transcript_id "CUFF.50361.1"; exon_number "1"; FPKM "13.4115142222"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.378260"; cov "0.857143";
+chr13 Cufflinks transcript 6592773 6592874 1000 . . gene_id "CUFF.50363"; transcript_id "CUFF.50363.1"; FPKM "12.4253734705"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.772959"; cov "0.794118";
+chr13 Cufflinks exon 6592773 6592874 1000 . . gene_id "CUFF.50363"; transcript_id "CUFF.50363.1"; exon_number "1"; FPKM "12.4253734705"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.772959"; cov "0.794118";
+chr13 Cufflinks transcript 6580385 6581757 1000 - . gene_id "CUFF.50365"; transcript_id "CUFF.50365.1"; FPKM "324.9135847836"; frac "1.000000"; conf_lo "293.684884"; conf_hi "356.142286"; cov "20.765542";
+chr13 Cufflinks exon 6580385 6580838 1000 - . gene_id "CUFF.50365"; transcript_id "CUFF.50365.1"; exon_number "1"; FPKM "324.9135847836"; frac "1.000000"; conf_lo "293.684884"; conf_hi "356.142286"; cov "20.765542";
+chr13 Cufflinks exon 6581649 6581757 1000 - . gene_id "CUFF.50365"; transcript_id "CUFF.50365.1"; exon_number "2"; FPKM "324.9135847836"; frac "1.000000"; conf_lo "293.684884"; conf_hi "356.142286"; cov "20.765542";
+chr13 Cufflinks transcript 6594213 6594242 1000 . . gene_id "CUFF.50367"; transcript_id "CUFF.50367.1"; FPKM "28.1641798665"; frac "1.000000"; conf_lo "0.000000"; conf_hi "67.994345"; cov "1.800000";
+chr13 Cufflinks exon 6594213 6594242 1000 . . gene_id "CUFF.50367"; transcript_id "CUFF.50367.1"; exon_number "1"; FPKM "28.1641798665"; frac "1.000000"; conf_lo "0.000000"; conf_hi "67.994345"; cov "1.800000";
+chr13 Cufflinks transcript 6594897 6594938 1000 . . gene_id "CUFF.50369"; transcript_id "CUFF.50369.1"; FPKM "20.1172713332"; frac "1.000000"; conf_lo "0.000000"; conf_hi "48.567389"; cov "1.285714";
+chr13 Cufflinks exon 6594897 6594938 1000 . . gene_id "CUFF.50369"; transcript_id "CUFF.50369.1"; exon_number "1"; FPKM "20.1172713332"; frac "1.000000"; conf_lo "0.000000"; conf_hi "48.567389"; cov "1.285714";
+chr13 Cufflinks transcript 6594742 6594836 1000 . . gene_id "CUFF.50371"; transcript_id "CUFF.50371.1"; FPKM "13.3409273052"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.745703"; cov "0.852632";
+chr13 Cufflinks exon 6594742 6594836 1000 . . gene_id "CUFF.50371"; transcript_id "CUFF.50371.1"; exon_number "1"; FPKM "13.3409273052"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.745703"; cov "0.852632";
+chr13 Cufflinks transcript 6595072 6595132 1000 . . gene_id "CUFF.50373"; transcript_id "CUFF.50373.1"; FPKM "20.7768539999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "44.767898"; cov "1.327869";
+chr13 Cufflinks exon 6595072 6595132 1000 . . gene_id "CUFF.50373"; transcript_id "CUFF.50373.1"; exon_number "1"; FPKM "20.7768539999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "44.767898"; cov "1.327869";
+chr13 Cufflinks transcript 6595199 6595225 1000 . . gene_id "CUFF.50375"; transcript_id "CUFF.50375.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 6595199 6595225 1000 . . gene_id "CUFF.50375"; transcript_id "CUFF.50375.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 6595246 6595272 1000 . . gene_id "CUFF.50377"; transcript_id "CUFF.50377.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 6595246 6595272 1000 . . gene_id "CUFF.50377"; transcript_id "CUFF.50377.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 6598001 6598027 1000 . . gene_id "CUFF.50379"; transcript_id "CUFF.50379.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 6598001 6598027 1000 . . gene_id "CUFF.50379"; transcript_id "CUFF.50379.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 6601936 6601990 1000 . . gene_id "CUFF.50381"; transcript_id "CUFF.50381.1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818";
+chr13 Cufflinks exon 6601936 6601990 1000 . . gene_id "CUFF.50381"; transcript_id "CUFF.50381.1"; exon_number "1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818";
+chr13 Cufflinks transcript 6604226 6604297 1000 . . gene_id "CUFF.50383"; transcript_id "CUFF.50383.1"; FPKM "17.6026124166"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.928358"; cov "1.125000";
+chr13 Cufflinks exon 6604226 6604297 1000 . . gene_id "CUFF.50383"; transcript_id "CUFF.50383.1"; exon_number "1"; FPKM "17.6026124166"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.928358"; cov "1.125000";
+chr13 Cufflinks transcript 6616305 6616331 1000 . . gene_id "CUFF.50385"; transcript_id "CUFF.50385.1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks exon 6616305 6616331 1000 . . gene_id "CUFF.50385"; transcript_id "CUFF.50385.1"; exon_number "1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks transcript 6616841 6616921 1000 . . gene_id "CUFF.50387"; transcript_id "CUFF.50387.1"; FPKM "5.2155888642"; frac "1.000000"; conf_lo "0.000000"; conf_hi "15.646767"; cov "0.333333";
+chr13 Cufflinks exon 6616841 6616921 1000 . . gene_id "CUFF.50387"; transcript_id "CUFF.50387.1"; exon_number "1"; FPKM "5.2155888642"; frac "1.000000"; conf_lo "0.000000"; conf_hi "15.646767"; cov "0.333333";
+chr13 Cufflinks transcript 6617878 6617990 1000 . . gene_id "CUFF.50389"; transcript_id "CUFF.50389.1"; FPKM "11.2158238407"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.166742"; cov "0.716814";
+chr13 Cufflinks exon 6617878 6617990 1000 . . gene_id "CUFF.50389"; transcript_id "CUFF.50389.1"; exon_number "1"; FPKM "11.2158238407"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.166742"; cov "0.716814";
+chr13 Cufflinks transcript 6618127 6618156 1000 . . gene_id "CUFF.50391"; transcript_id "CUFF.50391.1"; FPKM "28.1641798665"; frac "1.000000"; conf_lo "0.000000"; conf_hi "67.994345"; cov "1.800000";
+chr13 Cufflinks exon 6618127 6618156 1000 . . gene_id "CUFF.50391"; transcript_id "CUFF.50391.1"; exon_number "1"; FPKM "28.1641798665"; frac "1.000000"; conf_lo "0.000000"; conf_hi "67.994345"; cov "1.800000";
+chr13 Cufflinks transcript 6618432 6618463 1000 . . gene_id "CUFF.50393"; transcript_id "CUFF.50393.1"; FPKM "26.4039186249"; frac "1.000000"; conf_lo "0.000000"; conf_hi "63.744698"; cov "1.687500";
+chr13 Cufflinks exon 6618432 6618463 1000 . . gene_id "CUFF.50393"; transcript_id "CUFF.50393.1"; exon_number "1"; FPKM "26.4039186249"; frac "1.000000"; conf_lo "0.000000"; conf_hi "63.744698"; cov "1.687500";
+chr13 Cufflinks transcript 6618765 6618809 1000 . . gene_id "CUFF.50395"; transcript_id "CUFF.50395.1"; FPKM "28.1641798665"; frac "1.000000"; conf_lo "0.000000"; conf_hi "60.685374"; cov "1.800000";
+chr13 Cufflinks exon 6618765 6618809 1000 . . gene_id "CUFF.50395"; transcript_id "CUFF.50395.1"; exon_number "1"; FPKM "28.1641798665"; frac "1.000000"; conf_lo "0.000000"; conf_hi "60.685374"; cov "1.800000";
+chr13 Cufflinks transcript 6620226 6620259 1000 . . gene_id "CUFF.50397"; transcript_id "CUFF.50397.1"; FPKM "24.8507469411"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.995010"; cov "1.588235";
+chr13 Cufflinks exon 6620226 6620259 1000 . . gene_id "CUFF.50397"; transcript_id "CUFF.50397.1"; exon_number "1"; FPKM "24.8507469411"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.995010"; cov "1.588235";
+chr13 Cufflinks transcript 6795860 6795886 1000 . . gene_id "CUFF.50399"; transcript_id "CUFF.50399.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 6795860 6795886 1000 . . gene_id "CUFF.50399"; transcript_id "CUFF.50399.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 7155940 7155966 1000 . . gene_id "CUFF.50401"; transcript_id "CUFF.50401.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 7155940 7155966 1000 . . gene_id "CUFF.50401"; transcript_id "CUFF.50401.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 7676033 7676123 1000 . . gene_id "CUFF.50403"; transcript_id "CUFF.50403.1"; FPKM "9.2848944615"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.415718"; cov "0.593407";
+chr13 Cufflinks exon 7676033 7676123 1000 . . gene_id "CUFF.50403"; transcript_id "CUFF.50403.1"; exon_number "1"; FPKM "9.2848944615"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.415718"; cov "0.593407";
+chr13 Cufflinks transcript 8202861 8202907 1000 . . gene_id "CUFF.50405"; transcript_id "CUFF.50405.1"; FPKM "17.9771360850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "43.400646"; cov "1.148936";
+chr13 Cufflinks exon 8202861 8202907 1000 . . gene_id "CUFF.50405"; transcript_id "CUFF.50405.1"; exon_number "1"; FPKM "17.9771360850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "43.400646"; cov "1.148936";
+chr13 Cufflinks transcript 8210506 8210549 1000 . . gene_id "CUFF.50407"; transcript_id "CUFF.50407.1"; FPKM "19.2028499090"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.359781"; cov "1.227273";
+chr13 Cufflinks exon 8210506 8210549 1000 . . gene_id "CUFF.50407"; transcript_id "CUFF.50407.1"; exon_number "1"; FPKM "19.2028499090"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.359781"; cov "1.227273";
+chr13 Cufflinks transcript 8240024 8240081 1000 . . gene_id "CUFF.50409"; transcript_id "CUFF.50409.1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.169489"; cov "0.931034";
+chr13 Cufflinks exon 8240024 8240081 1000 . . gene_id "CUFF.50409"; transcript_id "CUFF.50409.1"; exon_number "1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.169489"; cov "0.931034";
+chr13 Cufflinks transcript 8277443 8277522 1000 . . gene_id "CUFF.50411"; transcript_id "CUFF.50411.1"; FPKM "10.5615674500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.497879"; cov "0.675000";
+chr13 Cufflinks exon 8277443 8277522 1000 . . gene_id "CUFF.50411"; transcript_id "CUFF.50411.1"; exon_number "1"; FPKM "10.5615674500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.497879"; cov "0.675000";
+chr13 Cufflinks transcript 8277606 8277673 1000 . . gene_id "CUFF.50413"; transcript_id "CUFF.50413.1"; FPKM "24.8507469411"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.701494"; cov "1.588235";
+chr13 Cufflinks exon 8277606 8277673 1000 . . gene_id "CUFF.50413"; transcript_id "CUFF.50413.1"; exon_number "1"; FPKM "24.8507469411"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.701494"; cov "1.588235";
+chr13 Cufflinks transcript 8277822 8277848 1000 . . gene_id "CUFF.50415"; transcript_id "CUFF.50415.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8277822 8277848 1000 . . gene_id "CUFF.50415"; transcript_id "CUFF.50415.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8277918 8277977 1000 . . gene_id "CUFF.50417"; transcript_id "CUFF.50417.1"; FPKM "21.1231348999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.514030"; cov "1.350000";
+chr13 Cufflinks exon 8277918 8277977 1000 . . gene_id "CUFF.50417"; transcript_id "CUFF.50417.1"; exon_number "1"; FPKM "21.1231348999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.514030"; cov "1.350000";
+chr13 Cufflinks transcript 8278095 8278121 1000 . . gene_id "CUFF.50419"; transcript_id "CUFF.50419.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8278095 8278121 1000 . . gene_id "CUFF.50419"; transcript_id "CUFF.50419.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8278201 8278350 1000 . . gene_id "CUFF.50421"; transcript_id "CUFF.50421.1"; FPKM "14.0820899333"; frac "1.000000"; conf_lo "1.486686"; conf_hi "26.677494"; cov "0.900000";
+chr13 Cufflinks exon 8278201 8278350 1000 . . gene_id "CUFF.50421"; transcript_id "CUFF.50421.1"; exon_number "1"; FPKM "14.0820899333"; frac "1.000000"; conf_lo "1.486686"; conf_hi "26.677494"; cov "0.900000";
+chr13 Cufflinks transcript 8278906 8278932 1000 . . gene_id "CUFF.50423"; transcript_id "CUFF.50423.1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks exon 8278906 8278932 1000 . . gene_id "CUFF.50423"; transcript_id "CUFF.50423.1"; exon_number "1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks transcript 8281673 8281699 1000 . . gene_id "CUFF.50425"; transcript_id "CUFF.50425.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8281673 8281699 1000 . . gene_id "CUFF.50425"; transcript_id "CUFF.50425.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8311626 8311652 1000 . . gene_id "CUFF.50427"; transcript_id "CUFF.50427.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8311626 8311652 1000 . . gene_id "CUFF.50427"; transcript_id "CUFF.50427.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8321948 8321974 1000 . . gene_id "CUFF.50429"; transcript_id "CUFF.50429.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8321948 8321974 1000 . . gene_id "CUFF.50429"; transcript_id "CUFF.50429.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8330761 8330829 1000 . . gene_id "CUFF.50431"; transcript_id "CUFF.50431.1"; FPKM "12.2452955941"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.562759"; cov "0.782609";
+chr13 Cufflinks exon 8330761 8330829 1000 . . gene_id "CUFF.50431"; transcript_id "CUFF.50431.1"; exon_number "1"; FPKM "12.2452955941"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.562759"; cov "0.782609";
+chr13 Cufflinks transcript 8334495 8335002 1000 . . gene_id "CUFF.50433"; transcript_id "CUFF.50433.1"; FPKM "24.1169650432"; frac "1.000000"; conf_lo "15.160149"; conf_hi "33.073781"; cov "1.541339";
+chr13 Cufflinks exon 8334495 8335002 1000 . . gene_id "CUFF.50433"; transcript_id "CUFF.50433.1"; exon_number "1"; FPKM "24.1169650432"; frac "1.000000"; conf_lo "15.160149"; conf_hi "33.073781"; cov "1.541339";
+chr13 Cufflinks transcript 8335517 8335639 1000 . . gene_id "CUFF.50435"; transcript_id "CUFF.50435.1"; FPKM "13.7386243251"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.477249"; cov "0.878049";
+chr13 Cufflinks exon 8335517 8335639 1000 . . gene_id "CUFF.50435"; transcript_id "CUFF.50435.1"; exon_number "1"; FPKM "13.7386243251"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.477249"; cov "0.878049";
+chr13 Cufflinks transcript 8390965 8390991 1000 . . gene_id "CUFF.50437"; transcript_id "CUFF.50437.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8390965 8390991 1000 . . gene_id "CUFF.50437"; transcript_id "CUFF.50437.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8431938 8432046 1000 . . gene_id "CUFF.50439"; transcript_id "CUFF.50439.1"; FPKM "15.5032182752"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.006437"; cov "0.990826";
+chr13 Cufflinks exon 8431938 8432046 1000 . . gene_id "CUFF.50439"; transcript_id "CUFF.50439.1"; exon_number "1"; FPKM "15.5032182752"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.006437"; cov "0.990826";
+chr13 Cufflinks transcript 8431688 8431754 1000 . . gene_id "CUFF.50441"; transcript_id "CUFF.50441.1"; FPKM "12.6108268059"; frac "1.000000"; conf_lo "0.000000"; conf_hi "30.445229"; cov "0.805970";
+chr13 Cufflinks exon 8431688 8431754 1000 . . gene_id "CUFF.50441"; transcript_id "CUFF.50441.1"; exon_number "1"; FPKM "12.6108268059"; frac "1.000000"; conf_lo "0.000000"; conf_hi "30.445229"; cov "0.805970";
+chr13 Cufflinks transcript 8432289 8432315 1000 . . gene_id "CUFF.50443"; transcript_id "CUFF.50443.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 8432289 8432315 1000 . . gene_id "CUFF.50443"; transcript_id "CUFF.50443.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 8432115 8432188 1000 . . gene_id "CUFF.50445"; transcript_id "CUFF.50445.1"; FPKM "11.4179107567"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.565275"; cov "0.729730";
+chr13 Cufflinks exon 8432115 8432188 1000 . . gene_id "CUFF.50445"; transcript_id "CUFF.50445.1"; exon_number "1"; FPKM "11.4179107567"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.565275"; cov "0.729730";
+chr13 Cufflinks transcript 8463173 8463199 1000 . . gene_id "CUFF.50447"; transcript_id "CUFF.50447.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8463173 8463199 1000 . . gene_id "CUFF.50447"; transcript_id "CUFF.50447.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8482167 8482193 1000 . . gene_id "CUFF.50449"; transcript_id "CUFF.50449.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8482167 8482193 1000 . . gene_id "CUFF.50449"; transcript_id "CUFF.50449.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8518188 8518214 1000 . . gene_id "CUFF.50451"; transcript_id "CUFF.50451.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8518188 8518214 1000 . . gene_id "CUFF.50451"; transcript_id "CUFF.50451.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8619978 8620005 1000 . . gene_id "CUFF.50453"; transcript_id "CUFF.50453.1"; FPKM "30.1759069999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "72.851084"; cov "1.928571";
+chr13 Cufflinks exon 8619978 8620005 1000 . . gene_id "CUFF.50453"; transcript_id "CUFF.50453.1"; exon_number "1"; FPKM "30.1759069999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "72.851084"; cov "1.928571";
+chr13 Cufflinks transcript 8669464 8669490 1000 . . gene_id "CUFF.50455"; transcript_id "CUFF.50455.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8669464 8669490 1000 . . gene_id "CUFF.50455"; transcript_id "CUFF.50455.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8705396 8705459 1000 . . gene_id "CUFF.50457"; transcript_id "CUFF.50457.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750";
+chr13 Cufflinks exon 8705396 8705459 1000 . . gene_id "CUFF.50457"; transcript_id "CUFF.50457.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750";
+chr13 Cufflinks transcript 8719319 8719345 1000 . . gene_id "CUFF.50459"; transcript_id "CUFF.50459.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8719319 8719345 1000 . . gene_id "CUFF.50459"; transcript_id "CUFF.50459.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8766868 8767005 1000 . . gene_id "CUFF.50461"; transcript_id "CUFF.50461.1"; FPKM "12.2452955941"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.490591"; cov "0.782609";
+chr13 Cufflinks exon 8766868 8767005 1000 . . gene_id "CUFF.50461"; transcript_id "CUFF.50461.1"; exon_number "1"; FPKM "12.2452955941"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.490591"; cov "0.782609";
+chr13 Cufflinks transcript 8767194 8767393 1000 . . gene_id "CUFF.50463"; transcript_id "CUFF.50463.1"; FPKM "12.6738809399"; frac "1.000000"; conf_lo "2.325700"; conf_hi "23.022061"; cov "0.810000";
+chr13 Cufflinks exon 8767194 8767393 1000 . . gene_id "CUFF.50463"; transcript_id "CUFF.50463.1"; exon_number "1"; FPKM "12.6738809399"; frac "1.000000"; conf_lo "2.325700"; conf_hi "23.022061"; cov "0.810000";
+chr13 Cufflinks transcript 8767461 8767531 1000 . . gene_id "CUFF.50465"; transcript_id "CUFF.50465.1"; FPKM "17.8505365351"; frac "1.000000"; conf_lo "0.000000"; conf_hi "38.462561"; cov "1.140845";
+chr13 Cufflinks exon 8767461 8767531 1000 . . gene_id "CUFF.50465"; transcript_id "CUFF.50465.1"; exon_number "1"; FPKM "17.8505365351"; frac "1.000000"; conf_lo "0.000000"; conf_hi "38.462561"; cov "1.140845";
+chr13 Cufflinks transcript 8767695 8767885 1000 . . gene_id "CUFF.50467"; transcript_id "CUFF.50467.1"; FPKM "17.6947726910"; frac "1.000000"; conf_lo "5.182679"; conf_hi "30.206866"; cov "1.130890";
+chr13 Cufflinks exon 8767695 8767885 1000 . . gene_id "CUFF.50467"; transcript_id "CUFF.50467.1"; exon_number "1"; FPKM "17.6947726910"; frac "1.000000"; conf_lo "5.182679"; conf_hi "30.206866"; cov "1.130890";
+chr13 Cufflinks transcript 8767947 8767992 1000 . . gene_id "CUFF.50469"; transcript_id "CUFF.50469.1"; FPKM "27.5519150868"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.366126"; cov "1.760870";
+chr13 Cufflinks exon 8767947 8767992 1000 . . gene_id "CUFF.50469"; transcript_id "CUFF.50469.1"; exon_number "1"; FPKM "27.5519150868"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.366126"; cov "1.760870";
+chr13 Cufflinks transcript 8784118 8784193 1000 . . gene_id "CUFF.50471"; transcript_id "CUFF.50471.1"; FPKM "16.6761591315"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.932129"; cov "1.065789";
+chr13 Cufflinks exon 8784118 8784193 1000 . . gene_id "CUFF.50471"; transcript_id "CUFF.50471.1"; exon_number "1"; FPKM "16.6761591315"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.932129"; cov "1.065789";
+chr13 Cufflinks transcript 8802391 8802417 1000 . . gene_id "CUFF.50473"; transcript_id "CUFF.50473.1"; FPKM "109.5273661476"; frac "1.000000"; conf_lo "26.732460"; conf_hi "192.322273"; cov "7.000000";
+chr13 Cufflinks exon 8802391 8802417 1000 . . gene_id "CUFF.50473"; transcript_id "CUFF.50473.1"; exon_number "1"; FPKM "109.5273661476"; frac "1.000000"; conf_lo "26.732460"; conf_hi "192.322273"; cov "7.000000";
+chr13 Cufflinks transcript 8802581 8802610 1000 . . gene_id "CUFF.50475"; transcript_id "CUFF.50475.1"; FPKM "154.9029892659"; frac "1.000000"; conf_lo "61.492972"; conf_hi "248.313006"; cov "9.900000";
+chr13 Cufflinks exon 8802581 8802610 1000 . . gene_id "CUFF.50475"; transcript_id "CUFF.50475.1"; exon_number "1"; FPKM "154.9029892659"; frac "1.000000"; conf_lo "61.492972"; conf_hi "248.313006"; cov "9.900000";
+chr13 Cufflinks transcript 8803098 8803283 1000 . . gene_id "CUFF.50477"; transcript_id "CUFF.50477.1"; FPKM "18.1704386236"; frac "1.000000"; conf_lo "5.321998"; conf_hi "31.018879"; cov "1.161290";
+chr13 Cufflinks exon 8803098 8803283 1000 . . gene_id "CUFF.50477"; transcript_id "CUFF.50477.1"; exon_number "1"; FPKM "18.1704386236"; frac "1.000000"; conf_lo "5.321998"; conf_hi "31.018879"; cov "1.161290";
+chr13 Cufflinks transcript 8803340 8803703 1000 . . gene_id "CUFF.50479"; transcript_id "CUFF.50479.1"; FPKM "12.7584623804"; frac "1.000000"; conf_lo "5.062328"; conf_hi "20.454597"; cov "0.815406";
+chr13 Cufflinks exon 8803340 8803703 1000 . . gene_id "CUFF.50479"; transcript_id "CUFF.50479.1"; exon_number "1"; FPKM "12.7584623804"; frac "1.000000"; conf_lo "5.062328"; conf_hi "20.454597"; cov "0.815406";
+chr13 Cufflinks transcript 8803760 8819743 1000 + . gene_id "CUFF.50481"; transcript_id "CUFF.50481.1"; FPKM "15.1783005269"; frac "1.000000"; conf_lo "2.785270"; conf_hi "27.571331"; cov "0.970060";
+chr13 Cufflinks exon 8803760 8803879 1000 + . gene_id "CUFF.50481"; transcript_id "CUFF.50481.1"; exon_number "1"; FPKM "15.1783005269"; frac "1.000000"; conf_lo "2.785270"; conf_hi "27.571331"; cov "0.970060";
+chr13 Cufflinks exon 8819697 8819743 1000 + . gene_id "CUFF.50481"; transcript_id "CUFF.50481.1"; exon_number "2"; FPKM "15.1783005269"; frac "1.000000"; conf_lo "2.785270"; conf_hi "27.571331"; cov "0.970060";
+chr13 Cufflinks transcript 8819122 8819153 1000 . . gene_id "CUFF.50483"; transcript_id "CUFF.50483.1"; FPKM "26.4039186249"; frac "1.000000"; conf_lo "0.000000"; conf_hi "63.744698"; cov "1.687500";
+chr13 Cufflinks exon 8819122 8819153 1000 . . gene_id "CUFF.50483"; transcript_id "CUFF.50483.1"; exon_number "1"; FPKM "26.4039186249"; frac "1.000000"; conf_lo "0.000000"; conf_hi "63.744698"; cov "1.687500";
+chr13 Cufflinks transcript 8831114 8831142 1000 . . gene_id "CUFF.50485"; transcript_id "CUFF.50485.1"; FPKM "29.1353584826"; frac "1.000000"; conf_lo "0.000000"; conf_hi "70.338978"; cov "1.862069";
+chr13 Cufflinks exon 8831114 8831142 1000 . . gene_id "CUFF.50485"; transcript_id "CUFF.50485.1"; exon_number "1"; FPKM "29.1353584826"; frac "1.000000"; conf_lo "0.000000"; conf_hi "70.338978"; cov "1.862069";
+chr13 Cufflinks transcript 8831216 8831252 1000 . . gene_id "CUFF.50487"; transcript_id "CUFF.50487.1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189";
+chr13 Cufflinks exon 8831216 8831252 1000 . . gene_id "CUFF.50487"; transcript_id "CUFF.50487.1"; exon_number "1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189";
+chr13 Cufflinks transcript 8831404 8831522 1000 . . gene_id "CUFF.50489"; transcript_id "CUFF.50489.1"; FPKM "17.7505335293"; frac "1.000000"; conf_lo "1.873974"; conf_hi "33.627093"; cov "1.134454";
+chr13 Cufflinks exon 8831404 8831522 1000 . . gene_id "CUFF.50489"; transcript_id "CUFF.50489.1"; exon_number "1"; FPKM "17.7505335293"; frac "1.000000"; conf_lo "1.873974"; conf_hi "33.627093"; cov "1.134454";
+chr13 Cufflinks transcript 8849862 8849935 1000 . . gene_id "CUFF.50491"; transcript_id "CUFF.50491.1"; FPKM "17.1268661351"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.903268"; cov "1.094595";
+chr13 Cufflinks exon 8849862 8849935 1000 . . gene_id "CUFF.50491"; transcript_id "CUFF.50491.1"; exon_number "1"; FPKM "17.1268661351"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.903268"; cov "1.094595";
+chr13 Cufflinks transcript 8850038 8850347 1000 . . gene_id "CUFF.50493"; transcript_id "CUFF.50493.1"; FPKM "9.5394802774"; frac "1.000000"; conf_lo "2.328311"; conf_hi "16.750650"; cov "0.609677";
+chr13 Cufflinks exon 8850038 8850347 1000 . . gene_id "CUFF.50493"; transcript_id "CUFF.50493.1"; exon_number "1"; FPKM "9.5394802774"; frac "1.000000"; conf_lo "2.328311"; conf_hi "16.750650"; cov "0.609677";
+chr13 Cufflinks transcript 8864952 8864979 1000 . . gene_id "CUFF.50495"; transcript_id "CUFF.50495.1"; FPKM "75.4397674996"; frac "1.000000"; conf_lo "7.964388"; conf_hi "142.915147"; cov "4.821429";
+chr13 Cufflinks exon 8864952 8864979 1000 . . gene_id "CUFF.50495"; transcript_id "CUFF.50495.1"; exon_number "1"; FPKM "75.4397674996"; frac "1.000000"; conf_lo "7.964388"; conf_hi "142.915147"; cov "4.821429";
+chr13 Cufflinks transcript 8855128 8864773 1000 - . gene_id "CUFF.50497"; transcript_id "CUFF.50497.1"; FPKM "6.4009499697"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.202850"; cov "0.409091";
+chr13 Cufflinks exon 8855128 8855158 1000 - . gene_id "CUFF.50497"; transcript_id "CUFF.50497.1"; exon_number "1"; FPKM "6.4009499697"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.202850"; cov "0.409091";
+chr13 Cufflinks exon 8864739 8864773 1000 - . gene_id "CUFF.50497"; transcript_id "CUFF.50497.1"; exon_number "2"; FPKM "6.4009499697"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.202850"; cov "0.409091";
+chr13 Cufflinks transcript 8965678 8965704 1000 . . gene_id "CUFF.50499"; transcript_id "CUFF.50499.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 8965678 8965704 1000 . . gene_id "CUFF.50499"; transcript_id "CUFF.50499.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 8972036 8972065 1000 . . gene_id "CUFF.50501"; transcript_id "CUFF.50501.1"; FPKM "112.6567194661"; frac "1.000000"; conf_lo "32.996389"; conf_hi "192.317050"; cov "7.200000";
+chr13 Cufflinks exon 8972036 8972065 1000 . . gene_id "CUFF.50501"; transcript_id "CUFF.50501.1"; exon_number "1"; FPKM "112.6567194661"; frac "1.000000"; conf_lo "32.996389"; conf_hi "192.317050"; cov "7.200000";
+chr13 Cufflinks transcript 9133705 9133859 1000 . . gene_id "CUFF.50503"; transcript_id "CUFF.50503.1"; FPKM "8.1766973806"; frac "1.000000"; conf_lo "0.000000"; conf_hi "17.618334"; cov "0.522581";
+chr13 Cufflinks exon 9133705 9133859 1000 . . gene_id "CUFF.50503"; transcript_id "CUFF.50503.1"; exon_number "1"; FPKM "8.1766973806"; frac "1.000000"; conf_lo "0.000000"; conf_hi "17.618334"; cov "0.522581";
+chr13 Cufflinks transcript 9134178 9134256 1000 . . gene_id "CUFF.50505"; transcript_id "CUFF.50505.1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
+chr13 Cufflinks exon 9134178 9134256 1000 . . gene_id "CUFF.50505"; transcript_id "CUFF.50505.1"; exon_number "1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
+chr13 Cufflinks transcript 9272120 9272153 1000 . . gene_id "CUFF.50507"; transcript_id "CUFF.50507.1"; FPKM "24.8212432986"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.944638"; cov "1.586350";
+chr13 Cufflinks exon 9272120 9272153 1000 . . gene_id "CUFF.50507"; transcript_id "CUFF.50507.1"; exon_number "1"; FPKM "24.8212432986"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.944638"; cov "1.586350";
+chr13 Cufflinks transcript 9169898 9172437 1000 + . gene_id "CUFF.50509"; transcript_id "CUFF.50509.1"; FPKM "41.4918721248"; frac "1.000000"; conf_lo "16.471332"; conf_hi "66.512412"; cov "2.651786";
+chr13 Cufflinks exon 9169898 9169928 1000 + . gene_id "CUFF.50509"; transcript_id "CUFF.50509.1"; exon_number "1"; FPKM "41.4918721248"; frac "1.000000"; conf_lo "16.471332"; conf_hi "66.512412"; cov "2.651786";
+chr13 Cufflinks exon 9172357 9172437 1000 + . gene_id "CUFF.50509"; transcript_id "CUFF.50509.1"; exon_number "2"; FPKM "41.4918721248"; frac "1.000000"; conf_lo "16.471332"; conf_hi "66.512412"; cov "2.651786";
+chr13 Cufflinks transcript 9171841 9172220 1000 . . gene_id "CUFF.50511"; transcript_id "CUFF.50511.1"; FPKM "108.9509063258"; frac "1.000000"; conf_lo "86.939499"; conf_hi "130.962313"; cov "6.963158";
+chr13 Cufflinks exon 9171841 9172220 1000 . . gene_id "CUFF.50511"; transcript_id "CUFF.50511.1"; exon_number "1"; FPKM "108.9509063258"; frac "1.000000"; conf_lo "86.939499"; conf_hi "130.962313"; cov "6.963158";
+chr13 Cufflinks transcript 9172647 9173652 1000 . . gene_id "CUFF.50513"; transcript_id "CUFF.50513.1"; FPKM "111.9143215254"; frac "1.000000"; conf_lo "98.203357"; conf_hi "125.625287"; cov "7.152553";
+chr13 Cufflinks exon 9172647 9173652 1000 . . gene_id "CUFF.50513"; transcript_id "CUFF.50513.1"; exon_number "1"; FPKM "111.9143215254"; frac "1.000000"; conf_lo "98.203357"; conf_hi "125.625287"; cov "7.152553";
+chr13 Cufflinks transcript 9277893 9277953 1000 . . gene_id "CUFF.50515"; transcript_id "CUFF.50515.1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246";
+chr13 Cufflinks exon 9277893 9277953 1000 . . gene_id "CUFF.50515"; transcript_id "CUFF.50515.1"; exon_number "1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246";
+chr13 Cufflinks transcript 9278033 9278094 1000 . . gene_id "CUFF.50517"; transcript_id "CUFF.50517.1"; FPKM "13.6278289677"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.900490"; cov "0.870968";
+chr13 Cufflinks exon 9278033 9278094 1000 . . gene_id "CUFF.50517"; transcript_id "CUFF.50517.1"; exon_number "1"; FPKM "13.6278289677"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.900490"; cov "0.870968";
+chr13 Cufflinks transcript 9278482 9278551 1000 . . gene_id "CUFF.50519"; transcript_id "CUFF.50519.1"; FPKM "18.1055441999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.012026"; cov "1.157143";
+chr13 Cufflinks exon 9278482 9278551 1000 . . gene_id "CUFF.50519"; transcript_id "CUFF.50519.1"; exon_number "1"; FPKM "18.1055441999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.012026"; cov "1.157143";
+chr13 Cufflinks transcript 9278167 9278308 1000 . . gene_id "CUFF.50521"; transcript_id "CUFF.50521.1"; FPKM "17.8505365351"; frac "1.000000"; conf_lo "3.275634"; conf_hi "32.425439"; cov "1.140845";
+chr13 Cufflinks exon 9278167 9278308 1000 . . gene_id "CUFF.50521"; transcript_id "CUFF.50521.1"; exon_number "1"; FPKM "17.8505365351"; frac "1.000000"; conf_lo "3.275634"; conf_hi "32.425439"; cov "1.140845";
+chr13 Cufflinks transcript 9346823 9346849 1000 . . gene_id "CUFF.50523"; transcript_id "CUFF.50523.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9346823 9346849 1000 . . gene_id "CUFF.50523"; transcript_id "CUFF.50523.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9373600 9373693 1000 . . gene_id "CUFF.50525"; transcript_id "CUFF.50525.1"; FPKM "8.9885680425"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.700323"; cov "0.574468";
+chr13 Cufflinks exon 9373600 9373693 1000 . . gene_id "CUFF.50525"; transcript_id "CUFF.50525.1"; exon_number "1"; FPKM "8.9885680425"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.700323"; cov "0.574468";
+chr13 Cufflinks transcript 9353602 9373527 1000 - . gene_id "CUFF.50527"; transcript_id "CUFF.50527.1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.010792"; cov "1.038462";
+chr13 Cufflinks exon 9353602 9353648 1000 - . gene_id "CUFF.50527"; transcript_id "CUFF.50527.1"; exon_number "1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.010792"; cov "1.038462";
+chr13 Cufflinks exon 9373497 9373527 1000 - . gene_id "CUFF.50527"; transcript_id "CUFF.50527.1"; exon_number "2"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.010792"; cov "1.038462";
+chr13 Cufflinks transcript 9386521 9386547 1000 . . gene_id "CUFF.50529"; transcript_id "CUFF.50529.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9386521 9386547 1000 . . gene_id "CUFF.50529"; transcript_id "CUFF.50529.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9391996 9392202 1000 . . gene_id "CUFF.50531"; transcript_id "CUFF.50531.1"; FPKM "12.2404495852"; frac "1.000000"; conf_lo "2.244186"; conf_hi "22.236713"; cov "0.782299";
+chr13 Cufflinks exon 9391996 9392202 1000 . . gene_id "CUFF.50531"; transcript_id "CUFF.50531.1"; exon_number "1"; FPKM "12.2404495852"; frac "1.000000"; conf_lo "2.244186"; conf_hi "22.236713"; cov "0.782299";
+chr13 Cufflinks transcript 9392422 9392467 1000 . . gene_id "CUFF.50533"; transcript_id "CUFF.50533.1"; FPKM "9.1839716956"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.551915"; cov "0.586957";
+chr13 Cufflinks exon 9392422 9392467 1000 . . gene_id "CUFF.50533"; transcript_id "CUFF.50533.1"; exon_number "1"; FPKM "9.1839716956"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.551915"; cov "0.586957";
+chr13 Cufflinks transcript 9392265 9392321 1000 . . gene_id "CUFF.50535"; transcript_id "CUFF.50535.1"; FPKM "14.8232525613"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.786497"; cov "0.947368";
+chr13 Cufflinks exon 9392265 9392321 1000 . . gene_id "CUFF.50535"; transcript_id "CUFF.50535.1"; exon_number "1"; FPKM "14.8232525613"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.786497"; cov "0.947368";
+chr13 Cufflinks transcript 9392577 9392603 1000 . . gene_id "CUFF.50537"; transcript_id "CUFF.50537.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9392577 9392603 1000 . . gene_id "CUFF.50537"; transcript_id "CUFF.50537.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9396631 9396825 1000 . . gene_id "CUFF.50539"; transcript_id "CUFF.50539.1"; FPKM "8.6659014974"; frac "1.000000"; conf_lo "0.000000"; conf_hi "17.331803"; cov "0.553846";
+chr13 Cufflinks exon 9396631 9396825 1000 . . gene_id "CUFF.50539"; transcript_id "CUFF.50539.1"; exon_number "1"; FPKM "8.6659014974"; frac "1.000000"; conf_lo "0.000000"; conf_hi "17.331803"; cov "0.553846";
+chr13 Cufflinks transcript 9397263 9397434 1000 . . gene_id "CUFF.50541"; transcript_id "CUFF.50541.1"; FPKM "17.1932493371"; frac "1.000000"; conf_lo "4.196374"; conf_hi "30.190124"; cov "1.098837";
+chr13 Cufflinks exon 9397263 9397434 1000 . . gene_id "CUFF.50541"; transcript_id "CUFF.50541.1"; exon_number "1"; FPKM "17.1932493371"; frac "1.000000"; conf_lo "4.196374"; conf_hi "30.190124"; cov "1.098837";
+chr13 Cufflinks transcript 9398210 9398294 1000 . . gene_id "CUFF.50543"; transcript_id "CUFF.50543.1"; FPKM "9.9402987764"; frac "1.000000"; conf_lo "0.000000"; conf_hi "23.998004"; cov "0.635294";
+chr13 Cufflinks exon 9398210 9398294 1000 . . gene_id "CUFF.50543"; transcript_id "CUFF.50543.1"; exon_number "1"; FPKM "9.9402987764"; frac "1.000000"; conf_lo "0.000000"; conf_hi "23.998004"; cov "0.635294";
+chr13 Cufflinks transcript 9406013 9406051 1000 . . gene_id "CUFF.50545"; transcript_id "CUFF.50545.1"; FPKM "10.8323768717"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.497131"; cov "0.692308";
+chr13 Cufflinks exon 9406013 9406051 1000 . . gene_id "CUFF.50545"; transcript_id "CUFF.50545.1"; exon_number "1"; FPKM "10.8323768717"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.497131"; cov "0.692308";
+chr13 Cufflinks transcript 9413644 9413670 1000 . . gene_id "CUFF.50547"; transcript_id "CUFF.50547.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9413644 9413670 1000 . . gene_id "CUFF.50547"; transcript_id "CUFF.50547.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9414053 9414143 1000 . . gene_id "CUFF.50549"; transcript_id "CUFF.50549.1"; FPKM "9.2848944615"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.415718"; cov "0.593407";
+chr13 Cufflinks exon 9414053 9414143 1000 . . gene_id "CUFF.50549"; transcript_id "CUFF.50549.1"; exon_number "1"; FPKM "9.2848944615"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.415718"; cov "0.593407";
+chr13 Cufflinks transcript 9415960 9416015 1000 . . gene_id "CUFF.50551"; transcript_id "CUFF.50551.1"; FPKM "15.0879534999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.425542"; cov "0.964286";
+chr13 Cufflinks exon 9415960 9416015 1000 . . gene_id "CUFF.50551"; transcript_id "CUFF.50551.1"; exon_number "1"; FPKM "15.0879534999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.425542"; cov "0.964286";
+chr13 Cufflinks transcript 9442325 9442351 1000 . . gene_id "CUFF.50553"; transcript_id "CUFF.50553.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9442325 9442351 1000 . . gene_id "CUFF.50553"; transcript_id "CUFF.50553.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9517895 9517921 1000 . . gene_id "CUFF.50555"; transcript_id "CUFF.50555.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9517895 9517921 1000 . . gene_id "CUFF.50555"; transcript_id "CUFF.50555.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9584154 9584180 1000 . . gene_id "CUFF.50558"; transcript_id "CUFF.50558.1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks exon 9584154 9584180 1000 . . gene_id "CUFF.50558"; transcript_id "CUFF.50558.1"; exon_number "1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks transcript 9583821 9583888 1000 . . gene_id "CUFF.50557"; transcript_id "CUFF.50557.1"; FPKM "12.4253734705"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.997505"; cov "0.794118";
+chr13 Cufflinks exon 9583821 9583888 1000 . . gene_id "CUFF.50557"; transcript_id "CUFF.50557.1"; exon_number "1"; FPKM "12.4253734705"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.997505"; cov "0.794118";
+chr13 Cufflinks transcript 9585768 9585937 1000 . . gene_id "CUFF.50561"; transcript_id "CUFF.50561.1"; FPKM "9.9402987764"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.880598"; cov "0.635294";
+chr13 Cufflinks exon 9585768 9585937 1000 . . gene_id "CUFF.50561"; transcript_id "CUFF.50561.1"; exon_number "1"; FPKM "9.9402987764"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.880598"; cov "0.635294";
+chr13 Cufflinks transcript 9586173 9593034 1000 - . gene_id "CUFF.50563"; transcript_id "CUFF.50563.1"; FPKM "10.3039682439"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.875980"; cov "0.658537";
+chr13 Cufflinks exon 9586173 9586218 1000 - . gene_id "CUFF.50563"; transcript_id "CUFF.50563.1"; exon_number "1"; FPKM "10.3039682439"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.875980"; cov "0.658537";
+chr13 Cufflinks exon 9592999 9593034 1000 - . gene_id "CUFF.50563"; transcript_id "CUFF.50563.1"; exon_number "2"; FPKM "10.3039682439"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.875980"; cov "0.658537";
+chr13 Cufflinks transcript 9609217 9609243 1000 . . gene_id "CUFF.50566"; transcript_id "CUFF.50566.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9609217 9609243 1000 . . gene_id "CUFF.50566"; transcript_id "CUFF.50566.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9607682 9607717 1000 . . gene_id "CUFF.50565"; transcript_id "CUFF.50565.1"; FPKM "23.4701498888"; frac "1.000000"; conf_lo "0.000000"; conf_hi "56.661954"; cov "1.500000";
+chr13 Cufflinks exon 9607682 9607717 1000 . . gene_id "CUFF.50565"; transcript_id "CUFF.50565.1"; exon_number "1"; FPKM "23.4701498888"; frac "1.000000"; conf_lo "0.000000"; conf_hi "56.661954"; cov "1.500000";
+chr13 Cufflinks transcript 9678669 9678695 1000 . . gene_id "CUFF.50569"; transcript_id "CUFF.50569.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9678669 9678695 1000 . . gene_id "CUFF.50569"; transcript_id "CUFF.50569.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9667710 9667736 1000 . . gene_id "CUFF.50571"; transcript_id "CUFF.50571.1"; FPKM "140.7837465978"; frac "1.000000"; conf_lo "46.915532"; conf_hi "234.651961"; cov "8.997626";
+chr13 Cufflinks exon 9667710 9667736 1000 . . gene_id "CUFF.50571"; transcript_id "CUFF.50571.1"; exon_number "1"; FPKM "140.7837465978"; frac "1.000000"; conf_lo "46.915532"; conf_hi "234.651961"; cov "8.997626";
+chr13 Cufflinks transcript 9667815 9668061 1000 . . gene_id "CUFF.50573"; transcript_id "CUFF.50573.1"; FPKM "87.1763440808"; frac "1.000000"; conf_lo "62.754693"; conf_hi "111.597996"; cov "5.571525";
+chr13 Cufflinks exon 9667815 9668061 1000 . . gene_id "CUFF.50573"; transcript_id "CUFF.50573.1"; exon_number "1"; FPKM "87.1763440808"; frac "1.000000"; conf_lo "62.754693"; conf_hi "111.597996"; cov "5.571525";
+chr13 Cufflinks transcript 9668143 9668170 1000 . . gene_id "CUFF.50575"; transcript_id "CUFF.50575.1"; FPKM "82.8583537693"; frac "1.000000"; conf_lo "12.143066"; conf_hi "153.573642"; cov "5.295558";
+chr13 Cufflinks exon 9668143 9668170 1000 . . gene_id "CUFF.50575"; transcript_id "CUFF.50575.1"; exon_number "1"; FPKM "82.8583537693"; frac "1.000000"; conf_lo "12.143066"; conf_hi "153.573642"; cov "5.295558";
+chr13 Cufflinks transcript 9688931 9688970 1000 . . gene_id "CUFF.50577"; transcript_id "CUFF.50577.1"; FPKM "21.1231348999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.995759"; cov "1.350000";
+chr13 Cufflinks exon 9688931 9688970 1000 . . gene_id "CUFF.50577"; transcript_id "CUFF.50577.1"; exon_number "1"; FPKM "21.1231348999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.995759"; cov "1.350000";
+chr13 Cufflinks transcript 9684078 9685570 1000 . . gene_id "CUFF.50579"; transcript_id "CUFF.50579.1"; FPKM "107.1082431700"; frac "1.000000"; conf_lo "96.097777"; conf_hi "118.118710"; cov "6.845392";
+chr13 Cufflinks exon 9684078 9685570 1000 . . gene_id "CUFF.50579"; transcript_id "CUFF.50579.1"; exon_number "1"; FPKM "107.1082431700"; frac "1.000000"; conf_lo "96.097777"; conf_hi "118.118710"; cov "6.845392";
+chr13 Cufflinks transcript 9690151 9690234 1000 . . gene_id "CUFF.50581"; transcript_id "CUFF.50581.1"; FPKM "10.0586356666"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.283695"; cov "0.642857";
+chr13 Cufflinks exon 9690151 9690234 1000 . . gene_id "CUFF.50581"; transcript_id "CUFF.50581.1"; exon_number "1"; FPKM "10.0586356666"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.283695"; cov "0.642857";
+chr13 Cufflinks transcript 9694461 9694537 1000 . . gene_id "CUFF.50583"; transcript_id "CUFF.50583.1"; FPKM "16.4595856363"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.465478"; cov "1.051948";
+chr13 Cufflinks exon 9694461 9694537 1000 . . gene_id "CUFF.50583"; transcript_id "CUFF.50583.1"; exon_number "1"; FPKM "16.4595856363"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.465478"; cov "1.051948";
+chr13 Cufflinks transcript 9696900 9696976 1000 . . gene_id "CUFF.50585"; transcript_id "CUFF.50585.1"; FPKM "10.9730570909"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.491303"; cov "0.701299";
+chr13 Cufflinks exon 9696900 9696976 1000 . . gene_id "CUFF.50585"; transcript_id "CUFF.50585.1"; exon_number "1"; FPKM "10.9730570909"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.491303"; cov "0.701299";
+chr13 Cufflinks transcript 9725686 9725787 1000 . . gene_id "CUFF.50587"; transcript_id "CUFF.50587.1"; FPKM "12.4253734705"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.772959"; cov "0.794118";
+chr13 Cufflinks exon 9725686 9725787 1000 . . gene_id "CUFF.50587"; transcript_id "CUFF.50587.1"; exon_number "1"; FPKM "12.4253734705"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.772959"; cov "0.794118";
+chr13 Cufflinks transcript 9725935 9726047 1000 . . gene_id "CUFF.50589"; transcript_id "CUFF.50589.1"; FPKM "11.2158238407"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.166742"; cov "0.716814";
+chr13 Cufflinks exon 9725935 9726047 1000 . . gene_id "CUFF.50589"; transcript_id "CUFF.50589.1"; exon_number "1"; FPKM "11.2158238407"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.166742"; cov "0.716814";
+chr13 Cufflinks transcript 9739796 9739868 1000 . . gene_id "CUFF.50591"; transcript_id "CUFF.50591.1"; FPKM "11.5743204931"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.942882"; cov "0.739726";
+chr13 Cufflinks exon 9739796 9739868 1000 . . gene_id "CUFF.50591"; transcript_id "CUFF.50591.1"; exon_number "1"; FPKM "11.5743204931"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.942882"; cov "0.739726";
+chr13 Cufflinks transcript 9740164 9740202 1000 . . gene_id "CUFF.50593"; transcript_id "CUFF.50593.1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
+chr13 Cufflinks exon 9740164 9740202 1000 . . gene_id "CUFF.50593"; transcript_id "CUFF.50593.1"; exon_number "1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
+chr13 Cufflinks transcript 9740296 9740330 1000 . . gene_id "CUFF.50595"; transcript_id "CUFF.50595.1"; FPKM "48.2814511998"; frac "1.000000"; conf_lo "0.000000"; conf_hi "96.562902"; cov "3.085714";
+chr13 Cufflinks exon 9740296 9740330 1000 . . gene_id "CUFF.50595"; transcript_id "CUFF.50595.1"; exon_number "1"; FPKM "48.2814511998"; frac "1.000000"; conf_lo "0.000000"; conf_hi "96.562902"; cov "3.085714";
+chr13 Cufflinks transcript 9741046 9741127 1000 . . gene_id "CUFF.50597"; transcript_id "CUFF.50597.1"; FPKM "10.3039682439"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.875980"; cov "0.658537";
+chr13 Cufflinks exon 9741046 9741127 1000 . . gene_id "CUFF.50597"; transcript_id "CUFF.50597.1"; exon_number "1"; FPKM "10.3039682439"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.875980"; cov "0.658537";
+chr13 Cufflinks transcript 9741590 9741694 1000 . . gene_id "CUFF.50599"; transcript_id "CUFF.50599.1"; FPKM "12.0703627999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.008017"; cov "0.771429";
+chr13 Cufflinks exon 9741590 9741694 1000 . . gene_id "CUFF.50599"; transcript_id "CUFF.50599.1"; exon_number "1"; FPKM "12.0703627999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "26.008017"; cov "0.771429";
+chr13 Cufflinks transcript 9741399 9741517 1000 . . gene_id "CUFF.50601"; transcript_id "CUFF.50601.1"; FPKM "24.8507469411"; frac "1.000000"; conf_lo "6.065348"; conf_hi "43.636146"; cov "1.588235";
+chr13 Cufflinks exon 9741399 9741517 1000 . . gene_id "CUFF.50601"; transcript_id "CUFF.50601.1"; exon_number "1"; FPKM "24.8507469411"; frac "1.000000"; conf_lo "6.065348"; conf_hi "43.636146"; cov "1.588235";
+chr13 Cufflinks transcript 9868979 9869072 1000 . . gene_id "CUFF.50603"; transcript_id "CUFF.50603.1"; FPKM "13.4828520638"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.051509"; cov "0.861702";
+chr13 Cufflinks exon 9868979 9869072 1000 . . gene_id "CUFF.50603"; transcript_id "CUFF.50603.1"; exon_number "1"; FPKM "13.4828520638"; frac "1.000000"; conf_lo "0.000000"; conf_hi "29.051509"; cov "0.861702";
+chr13 Cufflinks transcript 9872853 9872934 1000 . . gene_id "CUFF.50605"; transcript_id "CUFF.50605.1"; FPKM "15.4559523658"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.302949"; cov "0.987805";
+chr13 Cufflinks exon 9872853 9872934 1000 . . gene_id "CUFF.50605"; transcript_id "CUFF.50605.1"; exon_number "1"; FPKM "15.4559523658"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.302949"; cov "0.987805";
+chr13 Cufflinks transcript 9874731 9874997 1000 . . gene_id "CUFF.50607"; transcript_id "CUFF.50607.1"; FPKM "12.6580583670"; frac "1.000000"; conf_lo "3.707459"; conf_hi "21.608657"; cov "0.808989";
+chr13 Cufflinks exon 9874731 9874997 1000 . . gene_id "CUFF.50607"; transcript_id "CUFF.50607.1"; exon_number "1"; FPKM "12.6580583670"; frac "1.000000"; conf_lo "3.707459"; conf_hi "21.608657"; cov "0.808989";
+chr13 Cufflinks transcript 9875128 9875201 1000 . . gene_id "CUFF.50609"; transcript_id "CUFF.50609.1"; FPKM "22.8358215134"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.671643"; cov "1.459459";
+chr13 Cufflinks exon 9875128 9875201 1000 . . gene_id "CUFF.50609"; transcript_id "CUFF.50609.1"; exon_number "1"; FPKM "22.8358215134"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.671643"; cov "1.459459";
+chr13 Cufflinks transcript 9875323 9875349 1000 . . gene_id "CUFF.50611"; transcript_id "CUFF.50611.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 9875323 9875349 1000 . . gene_id "CUFF.50611"; transcript_id "CUFF.50611.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 9875425 9875480 1000 . . gene_id "CUFF.50613"; transcript_id "CUFF.50613.1"; FPKM "15.0879534999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.425542"; cov "0.964286";
+chr13 Cufflinks exon 9875425 9875480 1000 . . gene_id "CUFF.50613"; transcript_id "CUFF.50613.1"; exon_number "1"; FPKM "15.0879534999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "36.425542"; cov "0.964286";
+chr13 Cufflinks transcript 9876121 9876172 1000 . . gene_id "CUFF.50615"; transcript_id "CUFF.50615.1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.227507"; cov "1.038462";
+chr13 Cufflinks exon 9876121 9876172 1000 . . gene_id "CUFF.50615"; transcript_id "CUFF.50615.1"; exon_number "1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.227507"; cov "1.038462";
+chr13 Cufflinks transcript 9969155 9969237 1000 . . gene_id "CUFF.50617"; transcript_id "CUFF.50617.1"; FPKM "8.6756763125"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.966038"; cov "0.554471";
+chr13 Cufflinks exon 9969155 9969237 1000 . . gene_id "CUFF.50617"; transcript_id "CUFF.50617.1"; exon_number "1"; FPKM "8.6756763125"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.966038"; cov "0.554471";
+chr13 Cufflinks transcript 9986765 9986791 1000 . . gene_id "CUFF.50619"; transcript_id "CUFF.50619.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 9986765 9986791 1000 . . gene_id "CUFF.50619"; transcript_id "CUFF.50619.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 9987242 9987567 1000 . . gene_id "CUFF.50621"; transcript_id "CUFF.50621.1"; FPKM "10.3671827730"; frac "1.000000"; conf_lo "3.036478"; conf_hi "17.697888"; cov "0.662577";
+chr13 Cufflinks exon 9987242 9987567 1000 . . gene_id "CUFF.50621"; transcript_id "CUFF.50621.1"; exon_number "1"; FPKM "10.3671827730"; frac "1.000000"; conf_lo "3.036478"; conf_hi "17.697888"; cov "0.662577";
+chr13 Cufflinks transcript 10010160 10010265 1000 . . gene_id "CUFF.50623"; transcript_id "CUFF.50623.1"; FPKM "11.9564914528"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.762659"; cov "0.764151";
+chr13 Cufflinks exon 10010160 10010265 1000 . . gene_id "CUFF.50623"; transcript_id "CUFF.50623.1"; exon_number "1"; FPKM "11.9564914528"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.762659"; cov "0.764151";
+chr13 Cufflinks transcript 10010497 10010523 1000 . . gene_id "CUFF.50625"; transcript_id "CUFF.50625.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 10010497 10010523 1000 . . gene_id "CUFF.50625"; transcript_id "CUFF.50625.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 10012021 10012167 1000 . . gene_id "CUFF.50627"; transcript_id "CUFF.50627.1"; FPKM "11.4955836190"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.991167"; cov "0.734694";
+chr13 Cufflinks exon 10012021 10012167 1000 . . gene_id "CUFF.50627"; transcript_id "CUFF.50627.1"; exon_number "1"; FPKM "11.4955836190"; frac "1.000000"; conf_lo "0.000000"; conf_hi "22.991167"; cov "0.734694";
+chr13 Cufflinks transcript 10019657 10019683 1000 . . gene_id "CUFF.50629"; transcript_id "CUFF.50629.1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks exon 10019657 10019683 1000 . . gene_id "CUFF.50629"; transcript_id "CUFF.50629.1"; exon_number "1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks transcript 10024965 10025028 1000 . . gene_id "CUFF.50631"; transcript_id "CUFF.50631.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750";
+chr13 Cufflinks exon 10024965 10025028 1000 . . gene_id "CUFF.50631"; transcript_id "CUFF.50631.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750";
+chr13 Cufflinks transcript 10082104 10082206 1000 . . gene_id "CUFF.50633"; transcript_id "CUFF.50633.1"; FPKM "8.2031591844"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.804178"; cov "0.524272";
+chr13 Cufflinks exon 10082104 10082206 1000 . . gene_id "CUFF.50633"; transcript_id "CUFF.50633.1"; exon_number "1"; FPKM "8.2031591844"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.804178"; cov "0.524272";
+chr13 Cufflinks transcript 10086419 10086446 1000 . . gene_id "CUFF.50635"; transcript_id "CUFF.50635.1"; FPKM "60.3518139997"; frac "1.000000"; conf_lo "0.000000"; conf_hi "120.703628"; cov "3.857143";
+chr13 Cufflinks exon 10086419 10086446 1000 . . gene_id "CUFF.50635"; transcript_id "CUFF.50635.1"; exon_number "1"; FPKM "60.3518139997"; frac "1.000000"; conf_lo "0.000000"; conf_hi "120.703628"; cov "3.857143";
+chr13 Cufflinks transcript 10086886 10086930 1000 . . gene_id "CUFF.50637"; transcript_id "CUFF.50637.1"; FPKM "18.7761199110"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.329563"; cov "1.200000";
+chr13 Cufflinks exon 10086886 10086930 1000 . . gene_id "CUFF.50637"; transcript_id "CUFF.50637.1"; exon_number "1"; FPKM "18.7761199110"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.329563"; cov "1.200000";
+chr13 Cufflinks transcript 10096818 10096844 1000 . . gene_id "CUFF.50639"; transcript_id "CUFF.50639.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 10096818 10096844 1000 . . gene_id "CUFF.50639"; transcript_id "CUFF.50639.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 10111271 10111358 1000 . . gene_id "CUFF.50641"; transcript_id "CUFF.50641.1"; FPKM "9.6014249545"; frac "1.000000"; conf_lo "0.000000"; conf_hi "23.179890"; cov "0.613636";
+chr13 Cufflinks exon 10111271 10111358 1000 . . gene_id "CUFF.50641"; transcript_id "CUFF.50641.1"; exon_number "1"; FPKM "9.6014249545"; frac "1.000000"; conf_lo "0.000000"; conf_hi "23.179890"; cov "0.613636";
+chr13 Cufflinks transcript 10182192 10182228 1000 . . gene_id "CUFF.50643"; transcript_id "CUFF.50643.1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189";
+chr13 Cufflinks exon 10182192 10182228 1000 . . gene_id "CUFF.50643"; transcript_id "CUFF.50643.1"; exon_number "1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189";
+chr13 Cufflinks transcript 10189009 10189035 1000 . . gene_id "CUFF.50645"; transcript_id "CUFF.50645.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 10189009 10189035 1000 . . gene_id "CUFF.50645"; transcript_id "CUFF.50645.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 10197772 10197798 1000 . . gene_id "CUFF.50647"; transcript_id "CUFF.50647.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 10197772 10197798 1000 . . gene_id "CUFF.50647"; transcript_id "CUFF.50647.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 10200086 10200124 1000 . . gene_id "CUFF.50649"; transcript_id "CUFF.50649.1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
+chr13 Cufflinks exon 10200086 10200124 1000 . . gene_id "CUFF.50649"; transcript_id "CUFF.50649.1"; exon_number "1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
+chr13 Cufflinks transcript 10213412 10213536 1000 . . gene_id "CUFF.50651"; transcript_id "CUFF.50651.1"; FPKM "13.5188063359"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.037613"; cov "0.864000";
+chr13 Cufflinks exon 10213412 10213536 1000 . . gene_id "CUFF.50651"; transcript_id "CUFF.50651.1"; exon_number "1"; FPKM "13.5188063359"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.037613"; cov "0.864000";
+chr13 Cufflinks transcript 10223893 10223941 1000 . . gene_id "CUFF.50653"; transcript_id "CUFF.50653.1"; FPKM "17.2433754285"; frac "1.000000"; conf_lo "0.000000"; conf_hi "41.629191"; cov "1.102041";
+chr13 Cufflinks exon 10223893 10223941 1000 . . gene_id "CUFF.50653"; transcript_id "CUFF.50653.1"; exon_number "1"; FPKM "17.2433754285"; frac "1.000000"; conf_lo "0.000000"; conf_hi "41.629191"; cov "1.102041";
+chr13 Cufflinks transcript 10289392 10289437 1000 . . gene_id "CUFF.50655"; transcript_id "CUFF.50655.1"; FPKM "18.3679433912"; frac "1.000000"; conf_lo "0.000000"; conf_hi "44.344138"; cov "1.173913";
+chr13 Cufflinks exon 10289392 10289437 1000 . . gene_id "CUFF.50655"; transcript_id "CUFF.50655.1"; exon_number "1"; FPKM "18.3679433912"; frac "1.000000"; conf_lo "0.000000"; conf_hi "44.344138"; cov "1.173913";
+chr13 Cufflinks transcript 10326745 10326771 1000 . . gene_id "CUFF.50657"; transcript_id "CUFF.50657.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 10326745 10326771 1000 . . gene_id "CUFF.50657"; transcript_id "CUFF.50657.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 10346675 10346701 1000 . . gene_id "CUFF.50659"; transcript_id "CUFF.50659.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks exon 10346675 10346701 1000 . . gene_id "CUFF.50659"; transcript_id "CUFF.50659.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr13 Cufflinks transcript 10337071 10337097 1000 . . gene_id "CUFF.50661"; transcript_id "CUFF.50661.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 10337071 10337097 1000 . . gene_id "CUFF.50661"; transcript_id "CUFF.50661.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 10337141 10337167 1000 . . gene_id "CUFF.50663"; transcript_id "CUFF.50663.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 10337141 10337167 1000 . . gene_id "CUFF.50663"; transcript_id "CUFF.50663.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 10344376 10344402 1000 . . gene_id "CUFF.50665"; transcript_id "CUFF.50665.1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks exon 10344376 10344402 1000 . . gene_id "CUFF.50665"; transcript_id "CUFF.50665.1"; exon_number "1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
+chr13 Cufflinks transcript 10344976 10345002 1000 . . gene_id "CUFF.50667"; transcript_id "CUFF.50667.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 10344976 10345002 1000 . . gene_id "CUFF.50667"; transcript_id "CUFF.50667.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 10345008 10345034 1000 . . gene_id "CUFF.50669"; transcript_id "CUFF.50669.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 10345008 10345034 1000 . . gene_id "CUFF.50669"; transcript_id "CUFF.50669.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 10345484 10345510 1000 . . gene_id "CUFF.50671"; transcript_id "CUFF.50671.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 10345484 10345510 1000 . . gene_id "CUFF.50671"; transcript_id "CUFF.50671.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks transcript 10345538 10345564 1000 . . gene_id "CUFF.50673"; transcript_id "CUFF.50673.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
+chr13 Cufflinks exon 10345538 10345564 1000 . . gene_id "CUFF.50673"; transcript_id "CUFF.50673.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
--- a/lib/galaxy/datatypes/registry.py
+++ b/lib/galaxy/datatypes/registry.py
@@ -158,6 +158,7 @@ class Registry( object ):
'fasta' : sequence.Fasta(),
'fastq' : sequence.Fastq(),
'fastqsanger' : sequence.FastqSanger(),
+ 'gtf' : interval.Gtf(),
'gff' : interval.Gff(),
'gff3' : interval.Gff3(),
'genetrack' : tracks.GeneTrack(),
@@ -190,6 +191,7 @@ class Registry( object ):
'fasta' : 'text/plain',
'fastq' : 'text/plain',
'fastqsanger' : 'text/plain',
+ 'gtf' : 'text/plain',
'gff' : 'text/plain',
'gff3' : 'text/plain',
'interval' : 'text/plain',
@@ -228,6 +230,7 @@ class Registry( object ):
sequence.Axt(),
interval.Bed(),
interval.CustomTrack(),
+ interval.Gtf(),
interval.Gff(),
interval.Gff3(),
tabular.Pileup(),
1
0
galaxy-dist commit d666e89f178e: Fixed a bug in column_join where it failed when only two files were being joined
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Kelly Vincent <kpvincent(a)bx.psu.edu>
# Date 1277488422 14400
# Node ID d666e89f178eddb4175c388e81d8758096de72df
# Parent 7c27ca4b9431ae6eda0c4e9835b195876a2bd159
Fixed a bug in column_join where it failed when only two files were being joined
--- a/tools/new_operations/column_join.py
+++ b/tools/new_operations/column_join.py
@@ -157,11 +157,8 @@ def __main__():
inputs = [ options.input1, options.input2 ]
if options.fill_options_file == "None":
inputs.extend( args )
- else:
- try:
- col = int( args[0] )
- except ValueError:
- inputs.extend( args )
+ elif len( args ) > 0:
+ inputs.extend( args )
fill_options = None
if options.fill_options_file != "None" and options.fill_options_file is not None:
try:
1
0
galaxy-dist commit 7c27ca4b9431: Bug fix for importing a history when not logged in.
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Dan Blankenberg <dan(a)bx.psu.edu>
# Date 1277485525 14400
# Node ID 7c27ca4b9431ae6eda0c4e9835b195876a2bd159
# Parent 4dd860651b7e46b24f9942e06bfacdbf6ab3b28e
Bug fix for importing a history when not logged in.
--- a/lib/galaxy/web/controllers/history.py
+++ b/lib/galaxy/web/controllers/history.py
@@ -724,6 +724,7 @@ class HistoryController( BaseController,
"""Import another user's history via a shared URL"""
msg = ""
user = trans.get_user()
+ user_history = trans.get_history()
# Set referer message
if 'referer' in kwd:
referer = kwd['referer']
1
0
galaxy-dist commit 8adc2157e02a: Removed extra cloud clause left from earlier code cleanup. Resoves issue #350
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Enis Afgan <afgane(a)gmail.com>
# Date 1277351003 14400
# Node ID 8adc2157e02a8b144697147b5e5a64833f0d1964
# Parent 150c8db8dec1f36d42baea62c895f52d983d9e60
Removed extra cloud clause left from earlier code cleanup. Resoves issue #350
--- a/lib/galaxy/app.py
+++ b/lib/galaxy/app.py
@@ -1,6 +1,6 @@
import sys, os, atexit
-from galaxy import config, jobs, util, tools, web, cloud
+from galaxy import config, jobs, util, tools, web
import galaxy.tools.search
from galaxy.web import security
import galaxy.model
1
0
galaxy-dist commit 150c8db8dec1: Remove obsolete binseq.zip and txtseq.zip formats, and allow for uploading single files in a zip archive. Adapted from a patch from Pablo Cingolani.
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Nate Coraor <nate(a)bx.psu.edu>
# Date 1277326093 14400
# Node ID 150c8db8dec1f36d42baea62c895f52d983d9e60
# Parent 5cde0b6269e320c2bd769222cbd40f2e8956b7c5
Remove obsolete binseq.zip and txtseq.zip formats, and allow for uploading single files in a zip archive. Adapted from a patch from Pablo Cingolani.
--- a/tools/metag_tools/short_reads_trim_seq.xml
+++ b/tools/metag_tools/short_reads_trim_seq.xml
@@ -6,8 +6,8 @@
</command><inputs><page>
- <param name="input1" type="data" format="fasta,txtseq.zip" label="Reads" />
- <param name="input2" type="data" format="qualsolexa,qual454,txtseq.zip" label="Quality scores" />
+ <param name="input1" type="data" format="fasta" label="Reads" />
+ <param name="input2" type="data" format="qualsolexa,qual454" label="Quality scores" /><param name="trim" type="integer" size="5" value="20" label="Minimal quality score" help="bases scoring below this value will trigger splitting"/><param name="length" type="integer" size="5" value="100" label="Minimal length of contiguous segment" help="report all high quality segments above this length. Setting this option to '0' will cause the program to return a single longest run of high quality bases per read" /><conditional name="sequencing_method_choice">
--- a/tools/metag_tools/short_reads_trim_seq.py
+++ b/tools/metag_tools/short_reads_trim_seq.py
@@ -5,7 +5,7 @@ input: read file and quality score file
output: trimmed read file
"""
-import os, sys, math, tempfile, zipfile, re
+import os, sys, math, tempfile, re
assert sys.version_info[:2] >= ( 2, 4 )
@@ -13,14 +13,6 @@ def stop_err( msg ):
sys.stderr.write( "%s\n" % msg )
sys.exit()
-def unzip( filename ):
- zip_file = zipfile.ZipFile( filename, 'r' )
- tmpfilename = tempfile.NamedTemporaryFile().name
- for name in zip_file.namelist():
- file( tmpfilename, 'a' ).write( zip_file.read( name ) )
- zip_file.close()
- return tmpfilename
-
def append_to_outfile( outfile_name, seq_title, segments ):
segments = segments.split( ',' )
if len( segments ) > 1:
@@ -91,16 +83,8 @@ def __main__():
infile_score_name = sys.argv[5].strip()
arg = sys.argv[6].strip()
- infile_seq_is_zipped = False
- if zipfile.is_zipfile( infile_seq_name ):
- infile_seq_is_zipped = True
- seq_infile_name = unzip( infile_seq_name )
- else: seq_infile_name = infile_seq_name
- infile_score_is_zipped = False
- if zipfile.is_zipfile( infile_score_name ):
- infile_score_is_zipped = True
- score_infile_name = unzip(infile_score_name)
- else: score_infile_name = infile_score_name
+ seq_infile_name = infile_seq_name
+ score_infile_name = infile_score_name
# Determine quailty score format: tabular or fasta format within the first 100 lines
@@ -247,10 +231,4 @@ def __main__():
else:
stop_err( "Cannot locate sequence file '%s'or score file '%s'." % ( seq_infile_name, score_infile_name ) )
- # Need to delete temporary files created when we unzipped the input file archives
- if infile_seq_is_zipped and os.path.exists( seq_infile_name ):
- os.remove( seq_infile_name )
- if infile_score_is_zipped and os.path.exists( score_infile_name ):
- os.remove( score_infile_name )
-
if __name__ == "__main__": __main__()
--- a/datatypes_conf.xml.sample
+++ b/datatypes_conf.xml.sample
@@ -25,7 +25,6 @@
<converter file="bed_to_genetrack_converter.xml" target_datatype="genetrack"/></datatype><datatype extension="bed12" type="galaxy.datatypes.interval:Bed12" />
- <datatype extension="binseq.zip" type="galaxy.datatypes.binary:Binseq" mimetype="application/zip" display_in_upload="true"/><datatype extension="len" type="galaxy.datatypes.chrominfo:ChromInfo" display_in_upload="true"><!-- no converters yet --></datatype>
@@ -97,7 +96,6 @@
<datatype extension="tabular" type="galaxy.datatypes.tabular:Tabular" display_in_upload="true"/><datatype extension="txt" type="galaxy.datatypes.data:Text" display_in_upload="true"/><datatype extension="blastxml" type="galaxy.datatypes.xml:BlastXml" display_in_upload="true"/>
- <datatype extension="txtseq.zip" type="galaxy.datatypes.data:Txtseq" mimetype="application/zip" display_in_upload="true"/><datatype extension="velvet" type="galaxy.datatypes.assembly:Velvet" display_in_upload="false"/><datatype extension="wig" type="galaxy.datatypes.interval:Wiggle" display_in_upload="true"><converter file="wiggle_to_array_tree_converter.xml" target_datatype="array_tree"/>
--- a/tools/metag_tools/short_reads_figure_score.xml
+++ b/tools/metag_tools/short_reads_figure_score.xml
@@ -5,7 +5,7 @@
<inputs><page>
- <param name="input1" type="data" format="qualsolexa, qual454, txtseq.zip" label="Quality score file" help="No dataset? Read tip below"/>
+ <param name="input1" type="data" format="qualsolexa, qual454" label="Quality score file" help="No dataset? Read tip below"/></page></inputs>
--- a/tools/data_source/upload.xml
+++ b/tools/data_source/upload.xml
@@ -63,12 +63,6 @@ A binary file compressed in the BGZF for
-----
-**Binseq.zip**
-
-A zipped archive consisting of binary sequence files in either 'ab1' or 'scf' format. All files in this archive must have the same file extension which is one of '.ab1' or '.scf'. You must manually select this 'File Format' when uploading the file.
-
------
-
**Bed**
* Tab delimited format (tabular)
@@ -199,12 +193,6 @@ Any data in tab delimited format (tabula
-----
-**Txtseq.zip**
-
-A zipped archive consisting of flat text sequence files. All files in this archive must have the same file extension of '.txt'. You must manually select this 'File Format' when uploading the file.
-
------
-
**Wig**
The wiggle format is line-oriented. Wiggle data is preceded by a track definition line, which adds a number of options for controlling the default display of this track.
--- a/tools/metag_tools/megablast_xml_parser.xml
+++ b/tools/metag_tools/megablast_xml_parser.xml
@@ -18,12 +18,6 @@
</tests><help>
-.. class:: warningmark
-
-Blast XML output **must** be uploaded to Galaxy in zipped form.
-
------
-
**What it does**
This tool processes the XML output of any NCBI blast tool (if you run your own blast jobs, the XML output can be generated with **-m 7** option).
--- a/tools/metag_tools/short_reads_figure_score.py
+++ b/tools/metag_tools/short_reads_figure_score.py
@@ -8,7 +8,7 @@ boxplot:
- The smallest/largest value that is not an outlier is connected to the box by with a horizontal line.
"""
-import os, sys, math, tempfile, zipfile, re
+import os, sys, math, tempfile, re
from rpy import *
assert sys.version_info[:2] >= ( 2, 4 )
@@ -17,14 +17,6 @@ def stop_err( msg ):
sys.stderr.write( "%s\n" % msg )
sys.exit()
-def unzip( filename ):
- zip_file = zipfile.ZipFile( filename, 'r' )
- tmpfilename = tempfile.NamedTemporaryFile().name
- for name in zip_file.namelist():
- file( tmpfilename, 'a' ).write( zip_file.read( name ) )
- zip_file.close()
- return tmpfilename
-
def merge_to_20_datapoints( score ):
number_of_points = 20
read_length = len( score )
@@ -68,12 +60,7 @@ def __main__():
infile_score_name = sys.argv[1].strip()
outfile_R_name = sys.argv[2].strip()
- infile_is_zipped = False
- if zipfile.is_zipfile( infile_score_name ):
- infile_is_zipped = True
- infile_name = unzip( infile_score_name )
- else:
- infile_name = infile_score_name
+ infile_name = infile_score_name
# Determine tabular or fasta format within the first 100 lines
seq_method = None
@@ -249,10 +236,6 @@ def __main__():
r.axis( 1, x_old_range, x_new_range )
r.dev_off()
- if infile_is_zipped and os.path.exists( infile_name ):
- # Need to delete temporary file created when we unzipped the infile archive
- os.remove( infile_name )
-
if invalid_scores > 0:
print 'Skipped %d invalid scores. ' % invalid_scores
if invalid_lines > 0:
--- a/tools/data_source/upload.py
+++ b/tools/data_source/upload.py
@@ -114,24 +114,9 @@ def check_gzip( temp_name ):
return ( True, False )
return ( True, True )
def check_zip( temp_name ):
- if not zipfile.is_zipfile( temp_name ):
- return ( False, False, None )
- zip_file = zipfile.ZipFile( temp_name, "r" )
- # Make sure the archive consists of valid files. The current rules are:
- # 1. Archives can only include .ab1, .scf or .txt files
- # 2. All file extensions within an archive must be the same
- name = zip_file.namelist()[0]
- try:
- test_ext = name.split( "." )[1].strip().lower()
- except:
- return ( True, False, None )
- if not ( test_ext in unsniffable_binary_formats or test_ext == 'txt' ):
- return ( True, False, test_ext )
- for name in zip_file.namelist():
- ext = name.split( "." )[1].strip().lower()
- if ext != test_ext:
- return ( True, False, test_ext )
- return ( True, True, test_ext )
+ if zipfile.is_zipfile( temp_name ):
+ return True
+ return False
def parse_outputs( args ):
rval = {}
for arg in args:
@@ -142,6 +127,7 @@ def add_file( dataset, json_file, output
data_type = None
line_count = None
converted_path = None
+ stdout = None
if dataset.type == 'url':
try:
@@ -204,24 +190,29 @@ def add_file( dataset, json_file, output
data_type = 'gzip'
if not data_type:
# See if we have a zip archive
- is_zipped, is_valid, test_ext = check_zip( dataset.path )
- if is_zipped and not is_valid:
- file_err( 'The zipped uploaded file contains inappropriate content', dataset, json_file )
- return
- elif is_zipped and is_valid:
- # Currently, we force specific tools to handle this case. We also require the user
- # to manually set the incoming file_type
- if ( test_ext in unsniffable_binary_formats ) and dataset.file_type != 'binseq.zip':
- file_err( "Invalid 'File Format' for archive consisting of binary files - use 'Binseq.zip'", dataset, json_file )
- return
- elif test_ext == 'txt' and dataset.file_type != 'txtseq.zip':
- file_err( "Invalid 'File Format' for archive consisting of text files - use 'Txtseq.zip'", dataset, json_file )
- return
- if not ( dataset.file_type == 'binseq.zip' or dataset.file_type == 'txtseq.zip' ):
- file_err( "You must manually set the 'File Format' to either 'Binseq.zip' or 'Txtseq.zip' when uploading zip files", dataset, json_file )
- return
- data_type = 'zip'
- ext = dataset.file_type
+ is_zipped = check_zip( dataset.path )
+ if is_zipped:
+ unzipped = False
+ z = zipfile.ZipFile( dataset.path )
+ for name in z.namelist():
+ if name.endswith('/'):
+ continue
+ if unzipped:
+ stdout = 'ZIP file contained more than one file, only the first file was added to Galaxy.'
+ break
+ fd, uncompressed = tempfile.mkstemp( prefix='data_id_%s_upload_zip_' % dataset.dataset_id, dir=os.path.dirname( dataset.path ), text=False )
+ try:
+ outfile = open( uncompressed, 'wb' )
+ outfile.write( z.read( name ) )
+ outfile.close()
+ shutil.move( uncompressed, dataset.path )
+ dataset.name = name
+ unzipped = True
+ except IOError:
+ os.close( fd )
+ os.remove( uncompressed )
+ file_err( 'Problem decompressing zipped data', dataset, json_file )
+ return
if not data_type:
if check_binary( dataset.path ):
# We have a binary dataset, but it is not Bam or Sff
@@ -242,7 +233,7 @@ def add_file( dataset, json_file, output
if check_html( dataset.path ):
file_err( 'The uploaded file contains inappropriate HTML content', dataset, json_file )
return
- if data_type != 'binary' and data_type != 'zip':
+ if data_type != 'binary':
# don't convert newlines on data we're only going to symlink
if not dataset.get( 'link_data_only', False ):
in_place = True
@@ -278,10 +269,11 @@ def add_file( dataset, json_file, output
else:
shutil.move( dataset.path, output_path )
# Write the job info
+ stdout = stdout or 'uploaded %s file' % data_type
info = dict( type = 'dataset',
dataset_id = dataset.dataset_id,
ext = ext,
- stdout = 'uploaded %s file' % data_type,
+ stdout = stdout,
name = dataset.name,
line_count = line_count )
json_file.write( to_json_string( info ) + "\n" )
--- a/tools/solid_tools/solid_qual_stats.xml
+++ b/tools/solid_tools/solid_qual_stats.xml
@@ -3,7 +3,7 @@
<command interpreter="python">solid_qual_stats.py $input $output1</command><inputs>
- <param format="qualsolid, txtseq.zip" name="input" type="data" label="SOLiD qual file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" />
+ <param format="qualsolid" name="input" type="data" label="SOLiD qual file" help="If your dataset doesn't show up in the menu, click the pencil icon next to your dataset and set the datatype to 'qualsolid'" /></inputs><outputs><data format="txt" name="output1" metadata_source="input" />
1
0
galaxy-dist commit 5cde0b6269e3: API: Add library creation functionality. Note that no roles can be associated with libraries via the API at this time.
by commits-noreply@bitbucket.org 29 Jun '10
by commits-noreply@bitbucket.org 29 Jun '10
29 Jun '10
# HG changeset patch -- Bitbucket.org
# Project galaxy-dist
# URL http://bitbucket.org/galaxy/galaxy-dist/overview
# User Nate Coraor <nate(a)bx.psu.edu>
# Date 1277318677 14400
# Node ID 5cde0b6269e320c2bd769222cbd40f2e8956b7c5
# Parent e177f00679e9f8106c346251c1f8bdc0ece127d5
API: Add library creation functionality. Note that no roles can be associated with libraries via the API at this time.
--- a/lib/galaxy/model/__init__.py
+++ b/lib/galaxy/model/__init__.py
@@ -830,7 +830,7 @@ class HistoryDatasetAssociationDisplayAt
class Library( object ):
permitted_actions = get_permitted_actions( filter='LIBRARY' )
api_collection_visible_keys = ( 'id', 'name' )
- api_element_visible_keys = ( 'name', 'description', 'synopsys' )
+ api_element_visible_keys = ( 'name', 'description', 'synopsis' )
def __init__( self, name=None, description=None, synopsis=None, root_folder=None ):
self.name = name or "Unnamed library"
self.description = description
--- a/scripts/api/README
+++ b/scripts/api/README
@@ -13,9 +13,20 @@ subdirectories.
In Galaxy, create an account that matches the address you put in 'admin_users',
then browse to that user's preferences and generate a new API Key. Copy the
-key to your clipboard. Create a new library (doing this via the API is not yet
-implemented). Then take your API Key and use the scripts in scripts/api/ to do
-things:
+key to your clipboard and then use these scripts:
+
+% ./display.py my_key http://localhost:4096/api/libraries
+Collection Members
+------------------
+
+0 elements in collection
+
+% ./library_create_library.py my_key http://localhost:4096/api/libraries api_test 'API Test Library'
+Response
+--------
+/api/libraries/f3f73e481f432006
+ name: api_test
+ id: f3f73e481f432006
% ./display.py my_key http://localhost:4096/api/libraries
Collection Members
@@ -27,7 +38,7 @@ Collection Members
% ./display.py my_key http://localhost:4096/api/libraries/f3f73e481f432006
Member Information
------------------
-synopsys: None
+synopsis: None
contents_url: /api/libraries/f3f73e481f432006/contents
description: API Test Library
name: api_test
--- /dev/null
+++ b/scripts/api/library_create_library.py
@@ -0,0 +1,19 @@
+#!/usr/bin/python
+
+import os, sys
+sys.path.insert( 0, os.path.dirname( __file__ ) )
+from common import submit
+
+try:
+ data = {}
+ data[ 'name' ] = sys.argv[3]
+except IndexError:
+ print 'usage: %s key url name [description] [synopsys]' % os.path.basename( sys.argv[0] )
+ sys.exit( 1 )
+try:
+ data[ 'description' ] = sys.argv[4]
+ data[ 'synopsis' ] = sys.argv[5]
+except IndexError:
+ pass
+
+submit( sys.argv[1], sys.argv[2], data )
--- a/lib/galaxy/web/api/libraries.py
+++ b/lib/galaxy/web/api/libraries.py
@@ -60,3 +60,33 @@ class LibrariesController( BaseControlle
item = library.get_api_value( view='element' )
item['contents_url'] = url_for( 'contents', library_id=library_id )
return item
+
+ @web.expose_api
+ def create( self, trans, payload, **kwd ):
+ """
+ POST /api/libraries
+ Creates a new library.
+ """
+ if not trans.user_is_admin():
+ trans.response.status = 403
+ return "You are not authorized to create a new library."
+ params = util.Params( payload )
+ name = util.restore_text( params.get( 'name', None ) )
+ if not name:
+ trans.response.status = 400
+ return "Missing required parameter 'name'."
+ description = util.restore_text( params.get( 'description', '' ) )
+ synopsis = util.restore_text( params.get( 'synopsis', '' ) )
+ if synopsis in [ 'None', None ]:
+ synopsis = ''
+ library = trans.app.model.Library( name=name, description=description, synopsis=synopsis )
+ root_folder = trans.app.model.LibraryFolder( name=name, description='' )
+ library.root_folder = root_folder
+ trans.sa_session.add_all( ( library, root_folder ) )
+ trans.sa_session.flush()
+ encoded_id = trans.security.encode_id( library.id )
+ rval = {}
+ rval['url'] = url_for( 'libraries', id=encoded_id )
+ rval['name'] = name
+ rval['id'] = encoded_id
+ return [ rval ]
1
0