October 2010 - galaxy-user - lists.galaxyproject.org

Python error when running Bowtie for Illumina

by Weng Khong Lim

Hi all, I'm new to next-gen sequencing, so please be gentle. I've just received a pair of Illumina FASTQ files from the sequencing facility and intend to map them to the hg19 reference genome. I first used the FASTQ Groomer utility to convert the reads into Sanger reads. However, when running Bowtie for Illumina on the resulting dataset under default settings, I received the following error: An error occurred running this job: *Error aligning sequence. requested number of bytes is more than a Python string can hold* * * Can someone help point out my mistake? My history is accessible at http://main.g2.bx.psu.edu/u/wengkhong_lim/h/chip-seq-pilot-batch Appreciate the help! Weng Khong, LIM Department of Genetics University of Cambridge E-mail: wkl24(a)cam.ac.uk Tel: +447503225832

9 years, 8 months

4
3
0 / 0

problems accessing the sequences through genome browser

by pande

Dear Galaxy, I have some genomic intervals for the human genome and want to extract the same for the mouse.So, I used the MAF pairwise alignment tool. But, interestingly, the associated sequences are not to be found at all through the genome browser, for file that galaxy generated for me. Here are a few first alignments from the sample: ##maf version=1 a score=5002 s hg18.chr1 1820410 11 + 247249719 GGATCCAG-------ATG s mm9.chr4 769022 18 - 155630120 GAAACAAGGTGTTCCATG a score=20688 s hg18.chr1 2077163 10 + 247249719 TTTTCTTTTC s mm9.chr4 969004 10 - 155630120 CTTTCTTACC a score=15289 s hg18.chr1 2316453 90 + 247249719 CTCAGGTGAATTCCTCATGGCATCACAGCAGTGTTGAAA-----TAGGAGCAGATACG-TTACCTCCGC--TTGCCAGATAAGAAACTGGGACGCAGA s mm9.chr4 1172933 98 - 155630120 TTACAGTGAATTCTGCCTGGGATCCGTGCAGCATTGGAAATGGCTAGGGGCAGATAGGGTCACCTTCACAGTTGCTAGATAAGAAACAGGGTCGCGGA a score=20716 s hg18.chr1 2526225 31 + 247249719 CTTCCT-CTGGGCTTGGTCATCCTTCAAAGTC s mm9.chr4 1369046 32 - 155630120 CTTCCTCCTGGTCCCAACCATCTGTCAGATCC I just want the sequences from the mouse genome and extended up to 120 base pairs from the co-ordinate mentioned in the maf file. It only generates NNNNNNNNNNNNN....I was wondering how could Galaxy retrieve it, while I can't see the same in the genome browser. Kindly help. Amit.

9 years, 11 months

3
3
0 / 0

Comparative analysis

by Kevin S Lang

I need to compare genome sequences of several Salmonella enterica serovars. I will be looking for regions of insertions and deletions between the strains. As well as SNPs comparisons in certain genes. Is Galaxy a good tool to use for this? -K -- Kevin Lang Junior Scientist Singer Lab of Epidemiology University of Minnesota Dept of Veterinary BioScience Lab# 612-625-9266 Cell# 612-385-5410

9 years, 11 months

2
1
0 / 0

(no subject)

by CCT Hindmarch, Henry Wellcome Laboratories Integrated Neuroscienc

Hi, I am playing with Galaxy ahead of getting ChipSeq data and it looks brilliant (thanks)... I wonder whether It is possible to input a list of genes from a standard microarray experiment, identify the promotor regions of each gene and then work out which Transcription factor binding sites are contained in this gene list? Maybe a silly question, but this would be very useful information for me... All the best Charlie (chipboy101) ---------------------- Dr CCT Hindmarch Henry Wellcome Laboratories Integrated Neuroscience and Endocrinology

9 years, 11 months

3
4
0 / 0

downloading processed data

by Carlos Infante

Dear Galaxy, I use the web version of Galaxy to process my reads for quality control and then I would like to download the processed reads to run alignments locally or on our cluster. If I click "Save" in the History side panel, the download begins but then fails near completion, possibly because the download times out? Is there a way to compress the reads within Galaxy and then download the compressed file, or is there a more efficient way to retrieve my data off the Galaxy server? Thanks, Carlos

9 years, 11 months

2
1
0 / 0

question regarding "ALL SNPS IN PERSONAL GENOMES"

by Oskar Hallatschek

Hi, could you please tell me how the human/chimp alignment (columns 4 and 5) for the file "All SNPs in personal genomes" was created? Is it possible to download the alignment? many thanks, Oskar -- Oskar Hallatschek MPI for Dynamics and Self-Organization Biological Physics and Evolutionary Dynamics Bunsenstr. 10, D 37073 Goettingen phone: +49-551-5176-670 fax: +49-551-5176-669 e-mail: oskar.hallatschek(a)ds.mpg.de http://www.evo.ds.mpg.de/

9 years, 11 months

1
0
0 / 0

problems accessing the sequences through genome browser

by pande

Dear Galaxy, I have some genomic intervals for the human genome and want to extract the same for the mouse.So, I used the MAF pairwise alignment tool. But, interestingly, the associated sequences are not to be found at all through the genome browser, for file that galaxy generated for me. Here are a few first alignments from the sample: ##maf version=1 a score=5002 s hg18.chr1 1820410 11 + 247249719 GGATCCAG-------ATG s mm9.chr4 769022 18 - 155630120 GAAACAAGGTGTTCCATG a score=20688 s hg18.chr1 2077163 10 + 247249719 TTTTCTTTTC s mm9.chr4 969004 10 - 155630120 CTTTCTTACC a score=15289 s hg18.chr1 2316453 90 + 247249719 CTCAGGTGAATTCCTCATGGCATCACAGCAGTGTTGAAA-----TAGGAGCAGATACG-TTACCTCCGC--TTGCCAGATAAGAAACTGGGACGCAGA s mm9.chr4 1172933 98 - 155630120 TTACAGTGAATTCTGCCTGGGATCCGTGCAGCATTGGAAATGGCTAGGGGCAGATAGGGTCACCTTCACAGTTGCTAGATAAGAAACAGGGTCGCGGA a score=20716 s hg18.chr1 2526225 31 + 247249719 CTTCCT-CTGGGCTTGGTCATCCTTCAAAGTC s mm9.chr4 1369046 32 - 155630120 CTTCCTCCTGGTCCCAACCATCTGTCAGATCC I just want the sequences from the mouse genome and extended up to 120 base pairs from the co-ordinate mentioned in the maf file. It only generates NNNNNNNNNNNNN....I was wondering how could Galaxy retrieve it, while I can't see the same in the genome browser. Kindly help. Amit.

9 years, 11 months

2
1
0 / 0

Bioinformatician position opening at the IMPPC Genomics Unit - Badalona - Spain

by Lauro Sumoy

Dear all, We are accepting aplications for an open bioinformatician position at the IMPPC Genomics Unit to be filled by December 2010. Please read details below. Lauro Lauro Sumoy Genomics Unit IMPPC e-mail: lsumoy(a)imppc.org<mailto:lsumoy@imppc.org> Tel (+34) 93 554-3075 Fax (+34) 93 465-1472 [cid:image001.jpg@01CB750A.E1DF6D70] Institute of Predictive and Personalized Medicine of Cancer Crta Can Ruti, Camí de les Escoles s/n 08916 Badalona, Barcelona, Spain http://www.imppc.org -------------------------------------------------------- Bioinformatician (Genomics Unit) IMPPC Genomics Unit Overview The Genomics Unit at the Institute of Predictive and Personalized Medicine of Cancer (IMPPC) serves as internal core facility addressed at fulfilling the genomics needs from institute researchers and collaborators. It has its own line of research focused on genomics technology development. The IMPPC is a new independent non-profit-making research centre founded by the Generalitat of Catalonia (Autonomous Government). The activities of the IMPPC are directed at the development of the necessary tools to make the concept of Predictive and Personalized Medicine in the field of cancer a reality. Objectives: * To provide bioinformatic support to processing and statistical analysis of genomics data derived from massively parallel sequencing, microarray, genotyping and high throughput qPCR technologies. * To implement and develop bioinformatic tools to identify molecular changes which serve as biomarkers of cancer and other diseases. Main areas of research: 1. Bioinformatics and genomics technology development 2. Cancer genomics and epigenomics 3. Biomarker discovery and predictor development for cancer risk assessment Requirements: * MSc or PhD in Bioinformatics (with relevant experience, degrees in Biology, Biochemistry, Biotechnology, Chemistry, Pharmacy, Medicine, Mathematics, Statistics or Computer Science will be considered) * Programming skills in biocomputing and statistical languages (perl, R or related) * Demonstrated experience in microarray, genotyping or sequence data analysis. * Formal training or experience in molecular biology, epidemiology, oncology, biostatistics, and/or bioinformatics a plus * The candidate should be highly motivated, with excellent communication skills, sufficiency in English, ability to interact with researchers from different fields, and to work as part of a team. Principal Investigator: Lauro Sumoy Conditions offered: * Full time 3 year contract, core funded, with possibility of extension * Competitive salary according to qualifications and experience * Support from a new scientific institution devoted to high quality research in the fields of genetics and epigenetics of cancer * Interaction with other leading cancer research groups * Interaction with other bioinformatics groups within and outside of the institution * Possibility for career advancement and attendance to specialized training courses Applications should be sent to: e-mail: lsumoy(a)imppc.org<mailto:lsumoy@imppc.org> Please include: CV (including contact details) Introductory letter (experience, motivation...) References (names and contact e-mail and phone numbers of at least two referees)

9 years, 11 months

1
0
0 / 0

Data Uploading Time

by saranga wijeratne

Hi, My name Saranga and working for OSU. I just installed a local instant of Galaxy in one of our computers. My question is how long it takes to upload a file of size 4GB from my local disk to local Galaxy? I have been trying to upload this file for 12 hours now.This file is txt file and it contains reads. Any help will be really appreciated. Thank you very much in advance. Saranga

9 years, 11 months

3
3
0 / 0

tool config and fixed output file names

by Bossers, Alex

Hi all, I am probably missing something very obvious. I am struggling to make a tool config file (and/or perl/bash wrapper) that runs some tools that have several input files (no problem) but also several FIXED name output files. I am able to give it some prefix but the extensions (if any) cannot be changed. Any help appreciated how to link/get this in $output. Alex

9 years, 11 months

2
2
0 / 0

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user October 2010