galaxy-user April 2008

galaxy-user@lists.galaxyproject.org

7 participants
7 discussions

generating random sequences
by xu_jianzhen 16 Apr '08

16 Apr '08

Hi,galaxy users, I'am wondering if there is a tool for generating random genome sequence or from a specific region(i.e. all promoter region).I known there is 'random intervals' in 'ENCODE Tools'.But the problem is it seems restricted to generating random sequence from 'ENCODE Regions' while i'd prefer whole genenome region. By the way, what is the statistical model for generating this random sequence? can i just random generate a series of genome coordinates and then extract the correponding sequences? If you had read some research articles descripting the random procedure, please suggest for me. Regards, Xu Jianzhen GIBH,CAS

2 1

extracting alignments from Multiz with RefSeq annotation
by Vesselin Baev 16 Apr '08

16 Apr '08

Dear all, I'm wondering when I extract a alignments with coorfinates (for refseqs) from Multiz from genome-wide alignments I can make fasta MAFs with info-line with coordinates but never looking like this: >NM_017821.0.1 hg17.chr1 206501580 206501621 - 245522847 mm5.chr4 122200029 122200071 + 154141344 rn3.chr5 143135020 143135060 + 173106704 canFam1.chr15 6850518 6850559 + 67237905 CCTGCCCCTATTGTAAGTCAATTAATA-AAAAGAGCCATCTGG CTTGCCTCTATGATAAACCAGTTAATATAAAAGTGTCACATGG CTTGCCTCTGTTATAAGCCACTTAATA--AAAGTGTCACATGG CCTGCCTCTCATAGGAAGCAAGTAATG-AAAAGAGCCATCTGG >NM_004070.0.0 hg17.chr1 16105460 16105489 + 245522847 mm5.chr4 14280459 14280491 - 154141344 rn3.chr5 12802003 12802032 - 173106704 canFam1.chr2 5413700 5413729 - 87725193 GCCGGCCCAGCAAGATGAAACAG---GGCACCC GTCAGCCTGGGGGGGGTCGGCAGCCTGGCACCC GTCAGCCTGG---GAGTCGGCAGCCTGGCGCCC GCCAGCCCAGCAAGATGAAACAG---GGTGGCC How to make this? I have failed trying do this... Vesko -- ------------------------------------------------ Dr. Vesselin Baev University of Plovdiv Dept. Molecular Biology Bioinformatics Group Tzar Assen 24 Plovdiv 4000, BULGARIA 032/ 261 (534) 089/ 43 80 945 Skype: vesselin_baev vebaev(a)gmail.com baev(a)uni-plovdiv.bg

3 2

naming MAF blocks
by Vesselin Baev 16 Apr '08

16 Apr '08

Dear all, I heve done this in steps: 1. Go to genome.ucsc.edu and select the tables link. 2. Select the clade, organism, and assembly that you are interested in. 3. Select Genes and Gene Predictions from the group. 4. Select UCSC genes from track. 5. From region select genome. -from Paste List I put my needed list of genes. 6. From output format select custom track. 7. Select get output. 8. On that page put in utr3 in the name, and select 3' UTR exons. 9. Select get custom track in table browser. 10. Select Comparative Genomics from group. 11. Select Conservation from track 12. Select 28-multiz from table. 13. Click on the create button in the intersection line. 14. Select Custom Tracks from the group. 15. Select utr3 from the track. for example I have 100 genes (in Paste List) that I get UTRs from them and use in intersection line. I got MAFs that exceed 100 pieces, every MAF have coordinates, but how to see which MAF blocks are for the first UTR (of some gene)? is there a way to name the MAF blocks? Vesko -- ------------------------------------------------ Dr. Vesselin Baev University of Plovdiv Dept. Molecular Biology Bioinformatics Group Tzar Assen 24 Plovdiv 4000, BULGARIA 032/ 261 (534) 089/ 43 80 945 Skype: vesselin_baev vebaev(a)gmail.com baev(a)uni-plovdiv.bg

2 1

use with local browser mirror
by Keith Lamont 04 Apr '08

04 Apr '08

Hi all, Is it possible to customize Galaxy to use a mirror of the genome browser? Thanks, Keith Lamont

2 2

SVN Access not working?
by Jacob Biesinger 04 Apr '08

04 Apr '08

Hi. I've had Galaxy in my sights for some time now and I've finally found some time to sit down with it. I'm a Senior in Bioinformatics at BYU and have done a lot of the work that Galaxy is designed to do by hand in Python. I'm very interested in developing more tools for Galaxy, but as I sat down to check out the source, I'm getting the following error: $ svn co http://www.bx.psu.edu/svn/universe/galaxy/trunk galaxy svn: REPORT request failed on '/svn/universe/!svn/vcc/default' svn: REPORT of '/svn/universe/!svn/vcc/default': Could not read status line: connection was closed by server. (http://www.bx.psu.edu) There is nothing wrong with my svn client. I'm able to check out and update other projects as usual. I'd love to get started ASAP. Thanks for your time and the excellent product! -Jake Biesinger

2 1

[Bug] Errors with Cheetah on Intel Mac?
by Jacob Biesinger 04 Apr '08

04 Apr '08

Hi. I just checked out the latest version of galaxy and went through installation. I'm writing to note the issues I've encountered thus far. A number of eggs were missing for my platform (Intel Mac OS 10.4, python 2.5) and I had to scramble a number of eggs. These included the following: pycrypto lzo_python Cheetah pysqlite bx_python Scrambling my own eggs worked fine except for with pysqlite. I grabbed version 3.5.4 of sqlite3.c file and built a static pysqlite egg file. When I first ran run.sh, the web server loaded just fine. But on attempting to upload a file, I got the following dump, which says to me that galaxy is using a local install of Cheetah rather than the egg that I scrambled: URL: http://localhost:8080/tool_runner?tool_id=upload1 File '/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/WebError-0.8a-py2.5.egg/weberror/evalexception/middleware.py', line 364 in respond File '/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/Paste-1.5.1-py2.5.egg/paste/debug/prints.py', line 98 in __call__ File '/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/Paste-1.5.1-py2.5.egg/paste/wsgilib.py', line 539 in intercept_output File '/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/Beaker-0.5-py2.5.egg/beaker/session.py', line 103 in __call__ File '/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/Paste-1.5.1-py2.5.egg/paste/recursive.py', line 80 in __call__ File '/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/Paste-1.5.1-py2.5.egg/paste/httpexceptions.py', line 632 in __call__ File '/Users/wjb/Projects/galaxy/lib/galaxy/web/framework/base.py', line 123 in __call__ body = method( trans, **kwargs ) File '/Users/wjb/Projects/galaxy/lib/galaxy/web/controllers/tool_runner.py', line 42 in index return trans.fill_template( template, history=history, toolbox=toolbox, tool=tool, util=util, **vars ) File '/Users/wjb/Projects/galaxy/lib/galaxy/web/framework/__init__.py', line 356 in fill_template searchList=[kwargs, self.template_context, dict(caller=self, t=self, h=webhelpers, util=util, request=self.request, response=self.response, app=self.app)] ) File '/opt/local/lib/python2.5/site-packages/Cheetah-2.0.1-py2.5-macosx-10.3-i386.egg/Cheetah/Template.py', line 1192 in __init__ self._compile(source, file, compilerSettings=compilerSettings) File '/opt/local/lib/python2.5/site-packages/Cheetah-2.0.1-py2.5-macosx-10.3-i386.egg/Cheetah/Template.py', line 1480 in _compile keepRefToGeneratedCode=True) File '/opt/local/lib/python2.5/site-packages/Cheetah-2.0.1-py2.5-macosx-10.3-i386.egg/Cheetah/Template.py', line 777 in compile raise e IndentationError: expected an indented block (_Users_wjb_Projects_galaxy_templates_tool_form_tmpl.py, line 226) I removed my /opt/local installation of Cheetah (and a few other dependencies in /opt/local that I thought might affect building). I then started again on installation by removing the eggs directory and running setup.sh again. The above listed dependencies were not found again. I scrambled them (including pysqlite as static) and tried to run run.sh once again. Now I am getting the following error: Using eggs in py2.5-noplatform Using eggs in py2.5-macosx-10.3-i386-ucs2 Checking Galaxy eggs All eggs are up to date for this revision of Galaxy python path: /Users/wjb/Projects/galaxy/lib:/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform:/Users/wjb/Projects/galaxy/eggs/py2.5-macosx-10.3-i386-ucs2 path: /opt/local/bin:/opt/local/sbin:/usr/local/bin:/bin:/sbin:/usr/bin:/usr/sbin:/usr/local/bin:/usr/texbin:/Library/Frameworks/Python.framework/Versions/Current/bin:/usr/local/mysql/bin:/opt/local/lib/postgresql82/bin:/depot/apps/i386/bin:/home/universe/darwin-i386/EMBOSS-5.0.0/bin:/home/universe/darwin-i386/ImageMagick/bin:/home/universe/darwin-i386/PAML/paml3.15/bin Traceback (most recent call last): File "./scripts/paster.py", line 11, in <module> command.run() File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteScript-1.3.6-py2.5.egg/paste/script/command.py", line 78, in run File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteScript-1.3.6-py2.5.egg/paste/script/command.py", line 117, in invoke File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteScript-1.3.6-py2.5.egg/paste/script/command.py", line 212, in run File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteScript-1.3.6-py2.5.egg/paste/script/serve.py", line 227, in command File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteScript-1.3.6-py2.5.egg/paste/script/serve.py", line 250, in loadapp File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteDeploy-1.3.1-py2.5.egg/paste/deploy/loadwsgi.py", line 193, in loadapp File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteDeploy-1.3.1-py2.5.egg/paste/deploy/loadwsgi.py", line 213, in loadobj File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteDeploy-1.3.1-py2.5.egg/paste/deploy/loadwsgi.py", line 237, in loadcontext File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteDeploy-1.3.1-py2.5.egg/paste/deploy/loadwsgi.py", line 267, in _loadconfig File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteDeploy-1.3.1-py2.5.egg/paste/deploy/loadwsgi.py", line 397, in get_context File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteDeploy-1.3.1-py2.5.egg/paste/deploy/loadwsgi.py", line 439, in _context_from_explicit File "/Users/wjb/Projects/galaxy/eggs/py2.5-noplatform/PasteDeploy-1.3.1-py2.5.egg/paste/deploy/loadwsgi.py", line 18, in import_string File "/Users/wjb/Projects/galaxy/lib/pkg_resources.py", line 1912, in load try: File "/Users/wjb/Projects/galaxy/lib/galaxy/web/__init__.py", line 5, in <module> from framework import expose, json, url_for, error, FormBuilder File "/Users/wjb/Projects/galaxy/lib/galaxy/web/framework/__init__.py", line 9, in <module> from Cheetah.Template import Template File "build/bdist.macosx-10.3-i386/egg/Cheetah/Template.py", line 47, in <module> File "build/bdist.macosx-10.3-i386/egg/Cheetah/ErrorCatchers.py", line 16, in <module> File "/Users/wjb/Projects/galaxy/eggs/py2.5-macosx-10.3-i386-ucs2/Cheetah-1.0-py2.5-macosx-10.3-i386.egg/Cheetah/NameMapper.py", line 146 SyntaxError: from __future__ imports must occur at the beginning of the file I am still a bit concerned by my path and python_path variables, but it doesn't look like this error is related to them. Any ideas? I'm afraid I've spent too much time on this alrady and if I can't find a decent solution, I will have to bag this pathwayfor a few more months. Thanks for your time! -Jake Biesinger

2 1

Moderated posts?
by Jacob Biesinger 04 Apr '08

04 Apr '08

I signed up for an account with this email address, but the two messages I've sent to the list are awaiting moderator authorization. Is that normal?

2 1

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user April 2008