generating random sequences
by xu_jianzhen
Hi,galaxy users,
I'am wondering if there is a tool for generating random genome sequence or from a specific region(i.e. all promoter region).I known there is 'random intervals' in 'ENCODE Tools'.But the problem is it seems restricted to generating random sequence from 'ENCODE Regions' while i'd prefer whole genenome region.
By the way, what is the statistical model for generating this random sequence? can i just random generate a series of genome coordinates and then extract the correponding sequences?
If you had read some research articles descripting the random procedure, please suggest for me.
Regards,
Xu Jianzhen
GIBH,CAS
12 years, 5 months
extracting alignments from Multiz with RefSeq annotation
by Vesselin Baev
Dear all,
I'm wondering when I extract a alignments with coorfinates (for
refseqs) from Multiz from genome-wide alignments I can make fasta MAFs
with info-line with coordinates but never looking like this:
>NM_017821.0.1 hg17.chr1 206501580 206501621 - 245522847 mm5.chr4
122200029 122200071 + 154141344 rn3.chr5 143135020 143135060 +
173106704 canFam1.chr15 6850518 6850559 + 67237905
CCTGCCCCTATTGTAAGTCAATTAATA-AAAAGAGCCATCTGG
CTTGCCTCTATGATAAACCAGTTAATATAAAAGTGTCACATGG
CTTGCCTCTGTTATAAGCCACTTAATA--AAAGTGTCACATGG
CCTGCCTCTCATAGGAAGCAAGTAATG-AAAAGAGCCATCTGG
>NM_004070.0.0 hg17.chr1 16105460 16105489 + 245522847 mm5.chr4
14280459 14280491 - 154141344 rn3.chr5 12802003 12802032 - 173106704
canFam1.chr2 5413700 5413729 - 87725193
GCCGGCCCAGCAAGATGAAACAG---GGCACCC
GTCAGCCTGGGGGGGGTCGGCAGCCTGGCACCC
GTCAGCCTGG---GAGTCGGCAGCCTGGCGCCC
GCCAGCCCAGCAAGATGAAACAG---GGTGGCC
How to make this? I have failed trying do this...
Vesko
--
------------------------------------------------
Dr. Vesselin Baev
University of Plovdiv
Dept. Molecular Biology
Bioinformatics Group
Tzar Assen 24
Plovdiv 4000, BULGARIA
032/ 261 (534)
089/ 43 80 945
Skype: vesselin_baev
vebaev(a)gmail.com
baev(a)uni-plovdiv.bg
12 years, 5 months
naming MAF blocks
by Vesselin Baev
Dear all,
I heve done this in steps:
1. Go to genome.ucsc.edu and select the tables link.
2. Select the clade, organism, and assembly that you are interested in.
3. Select Genes and Gene Predictions from the group.
4. Select UCSC genes from track.
5. From region select genome.
-from Paste List I put my needed list of genes.
6. From output format select custom track.
7. Select get output.
8. On that page put in utr3 in the name, and select 3' UTR exons.
9. Select get custom track in table browser.
10. Select Comparative Genomics from group.
11. Select Conservation from track
12. Select 28-multiz from table.
13. Click on the create button in the intersection line.
14. Select Custom Tracks from the group.
15. Select utr3 from the track.
for example I have 100 genes (in Paste List) that I get UTRs from them
and use in intersection line.
I got MAFs that exceed 100 pieces, every MAF have coordinates, but how
to see which MAF blocks are for the first UTR (of some gene)? is there
a way to name the MAF blocks?
Vesko
--
------------------------------------------------
Dr. Vesselin Baev
University of Plovdiv
Dept. Molecular Biology
Bioinformatics Group
Tzar Assen 24
Plovdiv 4000, BULGARIA
032/ 261 (534)
089/ 43 80 945
Skype: vesselin_baev
vebaev(a)gmail.com
baev(a)uni-plovdiv.bg
12 years, 5 months
Anyone install galaxy local mirror successfully under Windows?
by Daofeng Li
Hi, Dear list members,
i am trying to make a local mirror of galaxy under windows
it seems be very difficult
i succeded under a linux machine
the same step can not work on my Windows machine
is that means i need to build the specific egg for windows?
i am using cygwin and install python 2.4.4 in cygwin system,not
activepython in Win system
and use easy_install ti intsall any needed eggs under cygwin
i can also run the run.sh
but when i visit the page
there are so many errors...
error page and log page i had captured and attached with this mail
can anyone give some suggestions?
Best Regards!
--
Daofeng Li,PhD Candidate
China Agricultural University
12 years, 6 months
