Python error when running Bowtie for Illumina
by Weng Khong Lim
Hi all,
I'm new to next-gen sequencing, so please be gentle. I've just received a
pair of Illumina FASTQ files from the sequencing facility and intend to map
them to the hg19 reference genome. I first used the FASTQ Groomer utility to
convert the reads into Sanger reads. However, when running Bowtie for
Illumina on the resulting dataset under default settings, I received the
following error:
An error occurred running this job: *Error aligning sequence. requested
number of bytes is more than a Python string can hold*
*
*
Can someone help point out my mistake? My history is accessible at
http://main.g2.bx.psu.edu/u/wengkhong_lim/h/chip-seq-pilot-batch
Appreciate the help!
Weng Khong, LIM
Department of Genetics
University of Cambridge
E-mail: wkl24(a)cam.ac.uk
Tel: +447503225832
9 years, 11 months
Advanced text manipulations in Galaxy
by Maxim Ivanov
Hello,
Sorry for possibly stupid question. Could you advise me whether there are any ways in Galaxy to perform specific manipulations on DNA sequences like:
"Substitute all Gs to Cs (except for CG dinucleotides)":
Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT
Output: chr1 9078238 9078358 Bait1 ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT
or like:
"Count the number of CG dinucleotides"
Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT
Output: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT 4
using built-in tools (e.g. specific expressions in the "Compute" tool), or this task cannot be done without programming skills?
Thank you in advance!
With respect,
Maxim Ivanov
Dept. of Physiology and Pharmacology
Karolinska Institutet
Stockholm, Sweden
10 years
MACS problem
by Christopher Scharer
Hi,
I recently mapped some ChIP-seq data to the mm8 version of the mouse
genome with Bowtie to create a SAM file. However, I can not run MACS
on the mapped data because I keep getting the error below. Any
suggestions??
Thanks,
Chris
Messages from MACS:
INFO @ Thu, 11 Nov 2010 10:07:30:
# ARGUMENTS LIST:
# name = MACS_in_Galaxy
# format = SAM
# ChIP-seq file =
/galaxy/home/g2main/galaxy_main/database/files/001/727/dataset_1727796.dat
# control file = None
# effective genome size = 2.70e+09
# tag size = 25
# band width = 300
# model fold = 32
# pvalue cutoff = 1.00e-05
# Ranges for calculating regional lambda are : peak_region,1000,5000,10000
INFO @ Thu, 11 Nov 2010 10:07:30: #1 read tag files...
INFO @ Thu, 11 Nov 2010 10:07:30: #1 read treatment tags...
INFO @ Thu, 11 Nov 2010 10:07:43: 1000000
INFO @ Thu, 11 Nov 2010 10:07:57: 2000000
INFO @ Thu, 11 Nov 2010 10:08:08: 3000000
INFO @ Thu, 11 Nov 2010 10:08:21: 4000000
INFO @ Thu, 11 Nov 2010 10:08:33: 5000000
Traceback (most recent call last):
File "/home/g2main/linux2.6-x86_64/bin/macs", line 273, in
main()
File "/home/g2main/linux2.6-x86_64/bin/macs", line 57, in main
(treat, control) = load_tag_files_options (options)
File "/home/g2main/linux2.6-x86_64/bin/macs", line 252, in
load_tag_files_options
treat = options.build(open2(options.tfile, gzip_flag=options.gzip_flag))
File
"/home/g2main/linux2.6-x86_64/lib/python2.6/MACS/IO/__init__.py", line
1480, in build_fwtrack
(chromosome,fpos,strand) = self.__fw_parse_line(thisline)
File
"/home/g2main/linux2.6-x86_64/lib/python2.6/MACS/IO/__init__.py", line
1500, in __fw_parse_line
bwflag = int(thisfields[1])
ValueError: invalid literal for int() with base 10: 'CTCF:7:185:443:687'
--
Chris Scharer, PhD
Post-doctoral Fellow
Laboratory of Dr. Jeremy Boss
Dept of Immunology and Microbiology
Emory University
Atlanta GA 30322
Ph: 404-727-5959
10 years, 1 month
Fwd: Galaxy on the cloud...
by Enis Afgan
Hi Richard,
These type of questions are best sent to the general Galaxy user mailing
list so it gets the most exposure, so I'm forwarding it.
Enis
---------- Forwarded message ----------
From: Richard Bruskiewich <r.bruskiewich(a)irri.org>
Date: Mon, Nov 29, 2010 at 9:08 PM
Subject: Re: Galaxy on the cloud...
To: Enis Afgan <eafgan(a)emory.edu>
Hi Enis,
Sorry to bother you again but I'm not sure who can answer this particular
question on the Galaxy team.
I've been following the instructions on
http://bitbucket.org/galaxy/galaxy-central/wiki/Config/ProductionServer to
create a new remote server instance for Galaxy using NGINX as the proxy
server (the latter configured using the instructions at
http://bitbucket.org/galaxy/galaxy-central/wiki/Config/nginxProxy).
The instance *almost* works except for the following defect: only Microsoft
IE renders the Galaxy home page correctly from the instance. FireFox and
Chrome do not render the first page correct (see the attached image).
If I run a local Galaxy (developer's) instance, though, it renders fine in
Firefox.
Is there some kind of additional NGINX-specific configuration that needs to
be tweaked for this?
I don't have much experience with NGINX, but decided to try it out since you
folks - Galaxy - are using it on your main web site (so says the production
page...).
Thank you in advance for your kind advice (or redirection of this query to a
member of your team who knows what to do here...).
Cheers
Richard
10 years, 1 month
WS180 genomic sequence not available
by Zhu, Lihua (Julie)
Hi,
I am trying to fetch sequences from WS180 ce5. However, it seems that the
sequences are not currently available for the specified build. Could you
please make it available?
Thanks so much for your help!
Best regards,
Julie
10 years, 1 month
Merge tool and strand orientation
by Eckart Bindewald
Hello:
let me start by saying that I am very impressed by the service the
Galaxy web server provides to the community; it has proven very useful
for my work.
Today I came across a situation that puzzles me. I am trying to merge
exons corresponding to the same gene (but possibly from different
splice variants).
At the bottom of this email I am listing, as an example, the 153 exons
that are related to the different splice variants of FlyBase gene
CG32491 (obtained by the pattern matching (tool "Select lines that
match an expression" and pattern .+CG32491-. ) applied to the data
set of FlyBaseGene exons (110,472 exons, genome assembly dm3). I am
using bed format and the general Galaxy web server.
If I now apply the "Merge" tool to the intervals, I obtain 26
intervals (listed further below). Now applying the "subtract" tool to
the original 153 exons results in 8 "leftover" regions that I did not
expect. Somehow they seem to be missing in the merge result.
I then deactivated the strand information in the interval set of 153
exons. Applying the merge tool now results in 34 intervals (again
listed below). Checking the result via the subtract tool (subtracting
the merge result from the original data set of 153 exons) results, as
expected, in zero intervals.
So my questions are:
- is this the intended functionality of the tools? Maybe one can add
statements regarding these issues in the tool documentation.
- why does the outcome of the merge operation depend on whether the
"strand" column is set or not? The original set of intervals all had
the same negative strand orientation, so it appears to me that the
merge operation should give the same result in both cases.
- subtracting the merged intervals (that do not have strand
information) from the set of 153 intervals results in 8 strands that
now have positive strand orientation (they originally had negative
strand orientation). Why does subtracting a set of intervals without
strand information from a set of intervals with strand information
change the strand orientation of the first set?
Any comments are highly appreciated!
Thanks,
Eckart
Dr. Eckart Bindewald (Contractor)
SAIC-Frederick, Inc.
Center for Cancer Research Nanobiology Program
National Cancer Institute
P.O. Box B
Frederick, MD 21702 USA
Phone: 301-846-5538
Fax: 301-846-5598
E-mail: eckart(a)mail.nih.gov
Here is the result (34 regions) of the merge operation (not using
strand orientation) applied to the 153 exon regions listed further
below ;
chr3R 17177330 17177608
chr3R 17177760 17178959
chr3R 17179070 17179456
chr3R 17179617 17180053
chr3R 17180159 17180416
chr3R 17180695 17181279
chr3R 17181479 17181973
chr3R 17182071 17182426
chr3R 17182532 17182690
chr3R 17182776 17183086
chr3R 17183242 17183480
chr3R 17183726 17183926
chr3R 17184011 17184791
chr3R 17186111 17186276
chr3R 17186349 17187009
chr3R 17187119 17187332
chr3R 17187391 17187860
chr3R 17187909 17188590
chr3R 17188688 17189606
chr3R 17189739 17190097
chr3R 17190173 17190367
chr3R 17190435 17190714
chr3R 17191725 17192060
chr3R 17192171 17192466
chr3R 17193631 17193960
chr3R 17194101 17194784
chr3R 17195183 17196364
chr3R 17196654 17196949
chr3R 17197044 17197789
chr3R 17197884 17198802
chr3R 17200781 17201634
chr3R 17202323 17202463
chr3R 17202540 17202798
chr3R 17203009 17203121
Here is the result (26 regions) of the merge operation (using strand
orientation) applied to the 153 exon regions listed further below ;
chr3R 17177330 17177608
chr3R 17177760 17178959
chr3R 17179070 17179456
chr3R 17179617 17180053
chr3R 17180159 17180416
chr3R 17180695 17181279
chr3R 17181479 17181973
chr3R 17182071 17182426
chr3R 17182532 17182690
chr3R 17182776 17183086
chr3R 17183242 17183480
chr3R 17183726 17183926
chr3R 17184011 17184791
chr3R 17187909 17188590
chr3R 17188688 17189606
chr3R 17189739 17190097
chr3R 17190173 17190367
chr3R 17190435 17190714
chr3R 17195821 17196364
chr3R 17196654 17196949
chr3R 17197044 17197789
chr3R 17197884 17198802
chr3R 17200781 17201634
chr3R 17202323 17202463
chr3R 17202540 17202798
chr3R 17203009 17203121
Here are the 8 "leftover" regions from the original 153 exons that do
not intersect with the result of the 26 merged regions (result of
subtract tool of 153 exons that do not overlap with 26 merged exons;
note the change strand orientation):
chr3R 17186111 17186276 CG32491-RT_exon_0_0_chr3R_17186112_f 0 +
chr3R 17186349 17187009 CG32491-RT_exon_1_0_chr3R_17186350_f 0 +
chr3R 17187119 17187332 CG32491-RZ_exon_0_0_chr3R_17187120_f 0 +
chr3R 17187391 17187860 CG32491-RZ_exon_1_0_chr3R_17187392_f 0 +
chr3R 17191725 17192060 CG32491-RY_exon_0_0_chr3R_17191726_f 0 +
chr3R 17192171 17192466 CG32491-RX_exon_0_0_chr3R_17192172_f 0 +
chr3R 17193631 17193960 CG32491-RW_exon_0_0_chr3R_17193632_f 0 +
chr3R 17194101 17194784 CG32491-RV_exon_0_0_chr3R_17194102_f 0 +
Here are the 153 exons related to FlyBase gene CG32491 obtained by the
pattern matching (tool "Select lines that match an expression" and
pattern .+CG32491-. ) applied to the data set of FlyBaseGene exons
(110,472 exons):
chr3R 17177330 17177608 CG32491-RR_exon_0_0_chr3R_17177331_r 0 -
chr3R 17200781 17201634 CG32491-RR_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RR_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RR_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RR_exon_4_0_chr3R_17203010_r 0 -
chr3R 17177760 17178358 CG32491-RA_exon_0_0_chr3R_17177761_r 0 -
chr3R 17200781 17201634 CG32491-RA_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RA_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RA_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RA_exon_4_0_chr3R_17203010_r 0 -
chr3R 17178092 17178959 CG32491-RF_exon_0_0_chr3R_17178093_r 0 -
chr3R 17200781 17201634 CG32491-RF_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RF_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RF_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RF_exon_4_0_chr3R_17203010_r 0 -
chr3R 17179070 17179456 CG32491-RD_exon_0_0_chr3R_17179071_r 0 -
chr3R 17200781 17201634 CG32491-RD_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RD_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RD_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RD_exon_4_0_chr3R_17203010_r 0 -
chr3R 17179617 17180053 CG32491-RAC_exon_0_0_chr3R_17179618_r 0 -
chr3R 17200781 17201634 CG32491-RAC_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RAC_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RAC_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RAC_exon_4_0_chr3R_17203010_r 0 -
chr3R 17180159 17180416 CG32491-RG_exon_0_0_chr3R_17180160_r 0 -
chr3R 17180695 17180811 CG32491-RG_exon_1_0_chr3R_17180696_r 0 -
chr3R 17200781 17201634 CG32491-RG_exon_2_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RG_exon_3_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RG_exon_4_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RG_exon_5_0_chr3R_17203010_r 0 -
chr3R 17180159 17180416 CG32491-RH_exon_0_0_chr3R_17180160_r 0 -
chr3R 17180695 17181279 CG32491-RH_exon_1_0_chr3R_17180696_r 0 -
chr3R 17200781 17201634 CG32491-RH_exon_2_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RH_exon_3_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RH_exon_4_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RH_exon_5_0_chr3R_17203010_r 0 -
chr3R 17180159 17180416 CG32491-RQ_exon_0_0_chr3R_17180160_r 0 -
chr3R 17200781 17201634 CG32491-RQ_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RQ_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RQ_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RQ_exon_4_0_chr3R_17203010_r 0 -
chr3R 17180941 17181279 CG32491-RB_exon_0_0_chr3R_17180942_r 0 -
chr3R 17181479 17181973 CG32491-RB_exon_1_0_chr3R_17181480_r 0 -
chr3R 17200781 17201634 CG32491-RB_exon_2_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RB_exon_3_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RB_exon_4_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RB_exon_5_0_chr3R_17203010_r 0 -
chr3R 17182071 17182426 CG32491-RI_exon_0_0_chr3R_17182072_r 0 -
chr3R 17182532 17182690 CG32491-RI_exon_1_0_chr3R_17182533_r 0 -
chr3R 17200781 17201634 CG32491-RI_exon_2_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RI_exon_3_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RI_exon_4_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RI_exon_5_0_chr3R_17203010_r 0 -
chr3R 17182776 17183086 CG32491-RJ_exon_0_0_chr3R_17182777_r 0 -
chr3R 17200781 17201634 CG32491-RJ_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RJ_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RJ_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RJ_exon_4_0_chr3R_17203010_r 0 -
chr3R 17183242 17183480 CG32491-RP_exon_0_0_chr3R_17183243_r 0 -
chr3R 17183726 17183926 CG32491-RP_exon_1_0_chr3R_17183727_r 0 -
chr3R 17200781 17201634 CG32491-RP_exon_2_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RP_exon_3_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RP_exon_4_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RP_exon_5_0_chr3R_17203010_r 0 -
chr3R 17184011 17184791 CG32491-RK_exon_0_0_chr3R_17184012_r 0 -
chr3R 17200781 17201634 CG32491-RK_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RK_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RK_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RK_exon_4_0_chr3R_17203010_r 0 -
chr3R 17184021 17184318 CG32491-RL_exon_0_0_chr3R_17184022_r 0 -
chr3R 17200781 17201634 CG32491-RL_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RL_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RL_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RL_exon_4_0_chr3R_17203010_r 0 -
chr3R 17186111 17186276 CG32491-RT_exon_0_0_chr3R_17186112_f 0 .
chr3R 17186349 17187009 CG32491-RT_exon_1_0_chr3R_17186350_f 0 .
chr3R 17200781 17201634 CG32491-RT_exon_2_0_chr3R_17200782_f 0 .
chr3R 17202323 17202463 CG32491-RT_exon_3_0_chr3R_17202324_f 0 .
chr3R 17202540 17202798 CG32491-RT_exon_4_0_chr3R_17202541_f 0 .
chr3R 17203009 17203121 CG32491-RT_exon_5_0_chr3R_17203010_f 0 .
chr3R 17187119 17187332 CG32491-RZ_exon_0_0_chr3R_17187120_f 0 .
chr3R 17187391 17187860 CG32491-RZ_exon_1_0_chr3R_17187392_f 0 .
chr3R 17200781 17201634 CG32491-RZ_exon_2_0_chr3R_17200782_f 0 .
chr3R 17202323 17202463 CG32491-RZ_exon_3_0_chr3R_17202324_f 0 .
chr3R 17202540 17202798 CG32491-RZ_exon_4_0_chr3R_17202541_f 0 .
chr3R 17203009 17203121 CG32491-RZ_exon_5_0_chr3R_17203010_f 0 .
chr3R 17187909 17188590 CG32491-RM_exon_0_0_chr3R_17187910_r 0 -
chr3R 17200781 17201634 CG32491-RM_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RM_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RM_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RM_exon_4_0_chr3R_17203010_r 0 -
chr3R 17188688 17189606 CG32491-RE_exon_0_0_chr3R_17188689_r 0 -
chr3R 17200781 17201634 CG32491-RE_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RE_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RE_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RE_exon_4_0_chr3R_17203010_r 0 -
chr3R 17189739 17190097 CG32491-RAB_exon_0_0_chr3R_17189740_r 0 -
chr3R 17200781 17201634 CG32491-RAB_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RAB_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RAB_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RAB_exon_4_0_chr3R_17203010_r 0 -
chr3R 17190173 17190367 CG32491-RC_exon_0_0_chr3R_17190174_r 0 -
chr3R 17190435 17190714 CG32491-RC_exon_1_0_chr3R_17190436_r 0 -
chr3R 17200781 17201634 CG32491-RC_exon_2_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RC_exon_3_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RC_exon_4_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RC_exon_5_0_chr3R_17203010_r 0 -
chr3R 17191725 17192060 CG32491-RY_exon_0_0_chr3R_17191726_f 0 .
chr3R 17200781 17201634 CG32491-RY_exon_1_0_chr3R_17200782_f 0 .
chr3R 17202323 17202463 CG32491-RY_exon_2_0_chr3R_17202324_f 0 .
chr3R 17202540 17202798 CG32491-RY_exon_3_0_chr3R_17202541_f 0 .
chr3R 17203009 17203121 CG32491-RY_exon_4_0_chr3R_17203010_f 0 .
chr3R 17192171 17192466 CG32491-RX_exon_0_0_chr3R_17192172_f 0 .
chr3R 17200781 17201634 CG32491-RX_exon_1_0_chr3R_17200782_f 0 .
chr3R 17202323 17202463 CG32491-RX_exon_2_0_chr3R_17202324_f 0 .
chr3R 17202540 17202798 CG32491-RX_exon_3_0_chr3R_17202541_f 0 .
chr3R 17203009 17203121 CG32491-RX_exon_4_0_chr3R_17203010_f 0 .
chr3R 17193631 17193960 CG32491-RW_exon_0_0_chr3R_17193632_f 0 .
chr3R 17200781 17201634 CG32491-RW_exon_1_0_chr3R_17200782_f 0 .
chr3R 17202323 17202463 CG32491-RW_exon_2_0_chr3R_17202324_f 0 .
chr3R 17202540 17202798 CG32491-RW_exon_3_0_chr3R_17202541_f 0 .
chr3R 17203009 17203121 CG32491-RW_exon_4_0_chr3R_17203010_f 0 .
chr3R 17194101 17194784 CG32491-RV_exon_0_0_chr3R_17194102_f 0 .
chr3R 17200781 17201634 CG32491-RV_exon_1_0_chr3R_17200782_f 0 .
chr3R 17202323 17202463 CG32491-RV_exon_2_0_chr3R_17202324_f 0 .
chr3R 17202540 17202798 CG32491-RV_exon_3_0_chr3R_17202541_f 0 .
chr3R 17203009 17203121 CG32491-RV_exon_4_0_chr3R_17203010_f 0 .
chr3R 17195183 17195967 CG32491-RU_exon_0_0_chr3R_17195184_f 0 .
chr3R 17200781 17201634 CG32491-RU_exon_1_0_chr3R_17200782_f 0 .
chr3R 17202323 17202463 CG32491-RU_exon_2_0_chr3R_17202324_f 0 .
chr3R 17202540 17202798 CG32491-RU_exon_3_0_chr3R_17202541_f 0 .
chr3R 17203009 17203121 CG32491-RU_exon_4_0_chr3R_17203010_f 0 .
chr3R 17195821 17196364 CG32491-RS_exon_0_0_chr3R_17195822_r 0 -
chr3R 17200781 17201634 CG32491-RS_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RS_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RS_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RS_exon_4_0_chr3R_17203010_r 0 -
chr3R 17196654 17196949 CG32491-RAA_exon_0_0_chr3R_17196655_r 0 -
chr3R 17200781 17201634 CG32491-RAA_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RAA_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RAA_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RAA_exon_4_0_chr3R_17203010_r 0 -
chr3R 17197044 17197789 CG32491-RO_exon_0_0_chr3R_17197045_r 0 -
chr3R 17200781 17201634 CG32491-RO_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RO_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RO_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RO_exon_4_0_chr3R_17203010_r 0 -
chr3R 17197884 17198802 CG32491-RN_exon_0_0_chr3R_17197885_r 0 -
chr3R 17200781 17201634 CG32491-RN_exon_1_0_chr3R_17200782_r 0 -
chr3R 17202323 17202463 CG32491-RN_exon_2_0_chr3R_17202324_r 0 -
chr3R 17202540 17202798 CG32491-RN_exon_3_0_chr3R_17202541_r 0 -
chr3R 17203009 17203121 CG32491-RN_exon_4_0_chr3R_17203010_r 0 -
10 years, 1 month
MAF alignments
by pande
Hi Galaxy,
Can you please enlighten me on the concept of MAF
alignments ? Are they the same as BLASTZ searches ????
Thanks .
Amit.
10 years, 1 month
Lift over function for ce5 (WS180) to ce6
by Zhu, Lihua (Julie)
Hi,
I tried to lift over a list of chromosome mapped to WS180 (ce5) to ce6, but
it seems that galaxy does not support ce5.
Could you please help? Thank you very much!
Best regards,
Julie
10 years, 1 month
Editing a workflow - hiding intermediate datasets
by Peter
Hi all,
I am quite quite puzzled about how hiding datasets is
intended to work when editing a workflow.
When editing a workflow, on the output of any tool (in the main
part of the screen) next to the grab point for linking tools there
is a "snowflake". This is either greyed out (which means hide
the output when the tool is run) or yellow (which means the
output is kept in the user's history), and you click on it to toggle
this.
Additionally, on the right hand side in the "Edit Step Actions"
there can be a "Hide Dataset" action.
My impression is the two UI mechanisms are intended to
control the same thing - but toggling one does not affect the
out (at least, not directly).
For example, toggling the "snowflake" does seem to alter
the right hand side (add/remove the "Hide Dataset"), but
only after you save, close, and reload the workflow.
Is this a bug? If so, the simplest way to solve this (from a
UI perspective) might be to remove the "Hide Dataset"
action from the right hand side.
------
On a related point, if I extract a workflow from my history,
all the steps have their "snowflakes" greyed out - even the
final step in the history. Yet despite this, when I run the
new workflow all the output is kept (nothing is hidden).
After a little experimenting, my guess is that you have a
special case: if all the outputs have greyed out snowflakes,
rather than running the tools and hidding all the output, you
hide nothing.
I would expect a new workflow extracted from the history
to have all the output kept (yellow snowflakes), or perhaps
intermediate output hidden (greyed out snowflakes) with
the output from the final history step shown (yellow).
Regards,
Peter
10 years, 1 month
Data Library Import "tool error"
by Sridhar A Malkaram
Hi,
I used the "Upload files from filesystem paths" option to upload a
directory path into Galaxy Data library. I used the option NO for
"Copy data into Galaxy?" as I don't want a duplicate copy of the data.
I selected the hg19 for Genome. After the upload process is finished,
I can see the directory tree structure, but in the "information"
column for files, it reports "Job error (click name for more info)".
When I click a file, for example for "macs_test_1_out.bed", which
is a bed filetype, it says "failure running job tool error" under
"Miscellaneous information". I am pasting below the whlole information.
This happens for all the data files that are uploaded. What is this
error? and which tool it is complaining about?
My another question is, can we upload files/directories with
compressed format files (.tar, .gz, .bz. etc) and binary files like
.doc, .xls ? If so, what additional plugins we need to have in place?
Thanks in advance for your suggestions.
================================ Message:
Galaxy Test-data Uploaded by: Date uploaded: 2010-11-29 File
size: 52.2 Kb Data type: data Build: hg19 Miscellaneous
information: failure running job tool error Database/Build: hg19
Peek:
Disk file:
/mnt/bioinfo/LINKS/Biotin/data/work/galaxy-dist/test-data/peakcalling_macs/macs_test_1_out.bed
================================
--
With Regards,
Sridhar
Postdoctoral Research Associate
Nutrition and Health Sciences
University of Nebraska-Lincoln
10 years, 1 month
