November 2010 - galaxy-user - lists.galaxyproject.org

Python error when running Bowtie for Illumina
by Weng Khong Lim 01 Feb '11

01 Feb '11

Hi all, I'm new to next-gen sequencing, so please be gentle. I've just received a pair of Illumina FASTQ files from the sequencing facility and intend to map them to the hg19 reference genome. I first used the FASTQ Groomer utility to convert the reads into Sanger reads. However, when running Bowtie for Illumina on the resulting dataset under default settings, I received the following error: An error occurred running this job: *Error aligning sequence. requested number of bytes is more than a Python string can hold* * * Can someone help point out my mistake? My history is accessible at http://main.g2.bx.psu.edu/u/wengkhong_lim/h/chip-seq-pilot-batch Appreciate the help! Weng Khong, LIM Department of Genetics University of Cambridge E-mail: wkl24(a)cam.ac.uk Tel: +447503225832

4 3

Advanced text manipulations in Galaxy
by Maxim Ivanov 03 Jan '11

03 Jan '11

Hello, Sorry for possibly stupid question. Could you advise me whether there are any ways in Galaxy to perform specific manipulations on DNA sequences like: "Substitute all Gs to Cs (except for CG dinucleotides)": Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT or like: "Count the number of CG dinucleotides" Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT 4 using built-in tools (e.g. specific expressions in the "Compute" tool), or this task cannot be done without programming skills? Thank you in advance! With respect, Maxim Ivanov Dept. of Physiology and Pharmacology Karolinska Institutet Stockholm, Sweden

2 1

MACS problem
by Christopher Scharer 13 Dec '10

13 Dec '10

Hi, I recently mapped some ChIP-seq data to the mm8 version of the mouse genome with Bowtie to create a SAM file. However, I can not run MACS on the mapped data because I keep getting the error below. Any suggestions?? Thanks, Chris Messages from MACS: INFO @ Thu, 11 Nov 2010 10:07:30: # ARGUMENTS LIST: # name = MACS_in_Galaxy # format = SAM # ChIP-seq file = /galaxy/home/g2main/galaxy_main/database/files/001/727/dataset_1727796.dat # control file = None # effective genome size = 2.70e+09 # tag size = 25 # band width = 300 # model fold = 32 # pvalue cutoff = 1.00e-05 # Ranges for calculating regional lambda are : peak_region,1000,5000,10000 INFO @ Thu, 11 Nov 2010 10:07:30: #1 read tag files... INFO @ Thu, 11 Nov 2010 10:07:30: #1 read treatment tags... INFO @ Thu, 11 Nov 2010 10:07:43: 1000000 INFO @ Thu, 11 Nov 2010 10:07:57: 2000000 INFO @ Thu, 11 Nov 2010 10:08:08: 3000000 INFO @ Thu, 11 Nov 2010 10:08:21: 4000000 INFO @ Thu, 11 Nov 2010 10:08:33: 5000000 Traceback (most recent call last): File "/home/g2main/linux2.6-x86_64/bin/macs", line 273, in main() File "/home/g2main/linux2.6-x86_64/bin/macs", line 57, in main (treat, control) = load_tag_files_options (options) File "/home/g2main/linux2.6-x86_64/bin/macs", line 252, in load_tag_files_options treat = options.build(open2(options.tfile, gzip_flag=options.gzip_flag)) File "/home/g2main/linux2.6-x86_64/lib/python2.6/MACS/IO/__init__.py", line 1480, in build_fwtrack (chromosome,fpos,strand) = self.__fw_parse_line(thisline) File "/home/g2main/linux2.6-x86_64/lib/python2.6/MACS/IO/__init__.py", line 1500, in __fw_parse_line bwflag = int(thisfields[1]) ValueError: invalid literal for int() with base 10: 'CTCF:7:185:443:687' -- Chris Scharer, PhD Post-doctoral Fellow Laboratory of Dr. Jeremy Boss Dept of Immunology and Microbiology Emory University Atlanta GA 30322 Ph: 404-727-5959

3 3

Fwd: Galaxy on the cloud...
by Enis Afgan 08 Dec '10

08 Dec '10

Hi Richard, These type of questions are best sent to the general Galaxy user mailing list so it gets the most exposure, so I'm forwarding it. Enis ---------- Forwarded message ---------- From: Richard Bruskiewich <r.bruskiewich(a)irri.org> Date: Mon, Nov 29, 2010 at 9:08 PM Subject: Re: Galaxy on the cloud... To: Enis Afgan <eafgan(a)emory.edu> Hi Enis, Sorry to bother you again but I'm not sure who can answer this particular question on the Galaxy team. I've been following the instructions on http://bitbucket.org/galaxy/galaxy-central/wiki/Config/ProductionServer to create a new remote server instance for Galaxy using NGINX as the proxy server (the latter configured using the instructions at http://bitbucket.org/galaxy/galaxy-central/wiki/Config/nginxProxy) The instance *almost* works except for the following defect: only Microsoft IE renders the Galaxy home page correctly from the instance. FireFox and Chrome do not render the first page correct (see the attached image). If I run a local Galaxy (developer's) instance, though, it renders fine in Firefox. Is there some kind of additional NGINX-specific configuration that needs to be tweaked for this? I don't have much experience with NGINX, but decided to try it out since you folks - Galaxy - are using it on your main web site (so says the production page...). Thank you in advance for your kind advice (or redirection of this query to a member of your team who knows what to do here...). Cheers Richard

2 1

WS180 genomic sequence not available
by Zhu, Lihua (Julie) 07 Dec '10

07 Dec '10

Hi, I am trying to fetch sequences from WS180 ce5. However, it seems that the sequences are not currently available for the specified build. Could you please make it available? Thanks so much for your help! Best regards, Julie

2 1

Merge tool and strand orientation
by Eckart Bindewald 03 Dec '10

03 Dec '10

Hello: let me start by saying that I am very impressed by the service the Galaxy web server provides to the community; it has proven very useful for my work. Today I came across a situation that puzzles me. I am trying to merge exons corresponding to the same gene (but possibly from different splice variants). At the bottom of this email I am listing, as an example, the 153 exons that are related to the different splice variants of FlyBase gene CG32491 (obtained by the pattern matching (tool "Select lines that match an expression" and pattern .+CG32491-. ) applied to the data set of FlyBaseGene exons (110,472 exons, genome assembly dm3). I am using bed format and the general Galaxy web server. If I now apply the "Merge" tool to the intervals, I obtain 26 intervals (listed further below). Now applying the "subtract" tool to the original 153 exons results in 8 "leftover" regions that I did not expect. Somehow they seem to be missing in the merge result. I then deactivated the strand information in the interval set of 153 exons. Applying the merge tool now results in 34 intervals (again listed below). Checking the result via the subtract tool (subtracting the merge result from the original data set of 153 exons) results, as expected, in zero intervals. So my questions are: - is this the intended functionality of the tools? Maybe one can add statements regarding these issues in the tool documentation. - why does the outcome of the merge operation depend on whether the "strand" column is set or not? The original set of intervals all had the same negative strand orientation, so it appears to me that the merge operation should give the same result in both cases. - subtracting the merged intervals (that do not have strand information) from the set of 153 intervals results in 8 strands that now have positive strand orientation (they originally had negative strand orientation). Why does subtracting a set of intervals without strand information from a set of intervals with strand information change the strand orientation of the first set? Any comments are highly appreciated! Thanks, Eckart Dr. Eckart Bindewald (Contractor) SAIC-Frederick, Inc. Center for Cancer Research Nanobiology Program National Cancer Institute P.O. Box B Frederick, MD 21702 USA Phone: 301-846-5538 Fax: 301-846-5598 E-mail: eckart(a)mail.nih.gov Here is the result (34 regions) of the merge operation (not using strand orientation) applied to the 153 exon regions listed further below ; chr3R 17177330 17177608 chr3R 17177760 17178959 chr3R 17179070 17179456 chr3R 17179617 17180053 chr3R 17180159 17180416 chr3R 17180695 17181279 chr3R 17181479 17181973 chr3R 17182071 17182426 chr3R 17182532 17182690 chr3R 17182776 17183086 chr3R 17183242 17183480 chr3R 17183726 17183926 chr3R 17184011 17184791 chr3R 17186111 17186276 chr3R 17186349 17187009 chr3R 17187119 17187332 chr3R 17187391 17187860 chr3R 17187909 17188590 chr3R 17188688 17189606 chr3R 17189739 17190097 chr3R 17190173 17190367 chr3R 17190435 17190714 chr3R 17191725 17192060 chr3R 17192171 17192466 chr3R 17193631 17193960 chr3R 17194101 17194784 chr3R 17195183 17196364 chr3R 17196654 17196949 chr3R 17197044 17197789 chr3R 17197884 17198802 chr3R 17200781 17201634 chr3R 17202323 17202463 chr3R 17202540 17202798 chr3R 17203009 17203121 Here is the result (26 regions) of the merge operation (using strand orientation) applied to the 153 exon regions listed further below ; chr3R 17177330 17177608 chr3R 17177760 17178959 chr3R 17179070 17179456 chr3R 17179617 17180053 chr3R 17180159 17180416 chr3R 17180695 17181279 chr3R 17181479 17181973 chr3R 17182071 17182426 chr3R 17182532 17182690 chr3R 17182776 17183086 chr3R 17183242 17183480 chr3R 17183726 17183926 chr3R 17184011 17184791 chr3R 17187909 17188590 chr3R 17188688 17189606 chr3R 17189739 17190097 chr3R 17190173 17190367 chr3R 17190435 17190714 chr3R 17195821 17196364 chr3R 17196654 17196949 chr3R 17197044 17197789 chr3R 17197884 17198802 chr3R 17200781 17201634 chr3R 17202323 17202463 chr3R 17202540 17202798 chr3R 17203009 17203121 Here are the 8 "leftover" regions from the original 153 exons that do not intersect with the result of the 26 merged regions (result of subtract tool of 153 exons that do not overlap with 26 merged exons; note the change strand orientation): chr3R 17186111 17186276 CG32491-RT_exon_0_0_chr3R_17186112_f 0 + chr3R 17186349 17187009 CG32491-RT_exon_1_0_chr3R_17186350_f 0 + chr3R 17187119 17187332 CG32491-RZ_exon_0_0_chr3R_17187120_f 0 + chr3R 17187391 17187860 CG32491-RZ_exon_1_0_chr3R_17187392_f 0 + chr3R 17191725 17192060 CG32491-RY_exon_0_0_chr3R_17191726_f 0 + chr3R 17192171 17192466 CG32491-RX_exon_0_0_chr3R_17192172_f 0 + chr3R 17193631 17193960 CG32491-RW_exon_0_0_chr3R_17193632_f 0 + chr3R 17194101 17194784 CG32491-RV_exon_0_0_chr3R_17194102_f 0 + Here are the 153 exons related to FlyBase gene CG32491 obtained by the pattern matching (tool "Select lines that match an expression" and pattern .+CG32491-. ) applied to the data set of FlyBaseGene exons (110,472 exons): chr3R 17177330 17177608 CG32491-RR_exon_0_0_chr3R_17177331_r 0 - chr3R 17200781 17201634 CG32491-RR_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RR_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RR_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RR_exon_4_0_chr3R_17203010_r 0 - chr3R 17177760 17178358 CG32491-RA_exon_0_0_chr3R_17177761_r 0 - chr3R 17200781 17201634 CG32491-RA_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RA_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RA_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RA_exon_4_0_chr3R_17203010_r 0 - chr3R 17178092 17178959 CG32491-RF_exon_0_0_chr3R_17178093_r 0 - chr3R 17200781 17201634 CG32491-RF_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RF_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RF_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RF_exon_4_0_chr3R_17203010_r 0 - chr3R 17179070 17179456 CG32491-RD_exon_0_0_chr3R_17179071_r 0 - chr3R 17200781 17201634 CG32491-RD_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RD_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RD_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RD_exon_4_0_chr3R_17203010_r 0 - chr3R 17179617 17180053 CG32491-RAC_exon_0_0_chr3R_17179618_r 0 - chr3R 17200781 17201634 CG32491-RAC_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RAC_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RAC_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RAC_exon_4_0_chr3R_17203010_r 0 - chr3R 17180159 17180416 CG32491-RG_exon_0_0_chr3R_17180160_r 0 - chr3R 17180695 17180811 CG32491-RG_exon_1_0_chr3R_17180696_r 0 - chr3R 17200781 17201634 CG32491-RG_exon_2_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RG_exon_3_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RG_exon_4_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RG_exon_5_0_chr3R_17203010_r 0 - chr3R 17180159 17180416 CG32491-RH_exon_0_0_chr3R_17180160_r 0 - chr3R 17180695 17181279 CG32491-RH_exon_1_0_chr3R_17180696_r 0 - chr3R 17200781 17201634 CG32491-RH_exon_2_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RH_exon_3_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RH_exon_4_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RH_exon_5_0_chr3R_17203010_r 0 - chr3R 17180159 17180416 CG32491-RQ_exon_0_0_chr3R_17180160_r 0 - chr3R 17200781 17201634 CG32491-RQ_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RQ_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RQ_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RQ_exon_4_0_chr3R_17203010_r 0 - chr3R 17180941 17181279 CG32491-RB_exon_0_0_chr3R_17180942_r 0 - chr3R 17181479 17181973 CG32491-RB_exon_1_0_chr3R_17181480_r 0 - chr3R 17200781 17201634 CG32491-RB_exon_2_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RB_exon_3_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RB_exon_4_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RB_exon_5_0_chr3R_17203010_r 0 - chr3R 17182071 17182426 CG32491-RI_exon_0_0_chr3R_17182072_r 0 - chr3R 17182532 17182690 CG32491-RI_exon_1_0_chr3R_17182533_r 0 - chr3R 17200781 17201634 CG32491-RI_exon_2_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RI_exon_3_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RI_exon_4_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RI_exon_5_0_chr3R_17203010_r 0 - chr3R 17182776 17183086 CG32491-RJ_exon_0_0_chr3R_17182777_r 0 - chr3R 17200781 17201634 CG32491-RJ_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RJ_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RJ_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RJ_exon_4_0_chr3R_17203010_r 0 - chr3R 17183242 17183480 CG32491-RP_exon_0_0_chr3R_17183243_r 0 - chr3R 17183726 17183926 CG32491-RP_exon_1_0_chr3R_17183727_r 0 - chr3R 17200781 17201634 CG32491-RP_exon_2_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RP_exon_3_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RP_exon_4_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RP_exon_5_0_chr3R_17203010_r 0 - chr3R 17184011 17184791 CG32491-RK_exon_0_0_chr3R_17184012_r 0 - chr3R 17200781 17201634 CG32491-RK_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RK_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RK_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RK_exon_4_0_chr3R_17203010_r 0 - chr3R 17184021 17184318 CG32491-RL_exon_0_0_chr3R_17184022_r 0 - chr3R 17200781 17201634 CG32491-RL_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RL_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RL_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RL_exon_4_0_chr3R_17203010_r 0 - chr3R 17186111 17186276 CG32491-RT_exon_0_0_chr3R_17186112_f 0 . chr3R 17186349 17187009 CG32491-RT_exon_1_0_chr3R_17186350_f 0 . chr3R 17200781 17201634 CG32491-RT_exon_2_0_chr3R_17200782_f 0 . chr3R 17202323 17202463 CG32491-RT_exon_3_0_chr3R_17202324_f 0 . chr3R 17202540 17202798 CG32491-RT_exon_4_0_chr3R_17202541_f 0 . chr3R 17203009 17203121 CG32491-RT_exon_5_0_chr3R_17203010_f 0 . chr3R 17187119 17187332 CG32491-RZ_exon_0_0_chr3R_17187120_f 0 . chr3R 17187391 17187860 CG32491-RZ_exon_1_0_chr3R_17187392_f 0 . chr3R 17200781 17201634 CG32491-RZ_exon_2_0_chr3R_17200782_f 0 . chr3R 17202323 17202463 CG32491-RZ_exon_3_0_chr3R_17202324_f 0 . chr3R 17202540 17202798 CG32491-RZ_exon_4_0_chr3R_17202541_f 0 . chr3R 17203009 17203121 CG32491-RZ_exon_5_0_chr3R_17203010_f 0 . chr3R 17187909 17188590 CG32491-RM_exon_0_0_chr3R_17187910_r 0 - chr3R 17200781 17201634 CG32491-RM_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RM_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RM_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RM_exon_4_0_chr3R_17203010_r 0 - chr3R 17188688 17189606 CG32491-RE_exon_0_0_chr3R_17188689_r 0 - chr3R 17200781 17201634 CG32491-RE_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RE_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RE_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RE_exon_4_0_chr3R_17203010_r 0 - chr3R 17189739 17190097 CG32491-RAB_exon_0_0_chr3R_17189740_r 0 - chr3R 17200781 17201634 CG32491-RAB_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RAB_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RAB_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RAB_exon_4_0_chr3R_17203010_r 0 - chr3R 17190173 17190367 CG32491-RC_exon_0_0_chr3R_17190174_r 0 - chr3R 17190435 17190714 CG32491-RC_exon_1_0_chr3R_17190436_r 0 - chr3R 17200781 17201634 CG32491-RC_exon_2_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RC_exon_3_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RC_exon_4_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RC_exon_5_0_chr3R_17203010_r 0 - chr3R 17191725 17192060 CG32491-RY_exon_0_0_chr3R_17191726_f 0 . chr3R 17200781 17201634 CG32491-RY_exon_1_0_chr3R_17200782_f 0 . chr3R 17202323 17202463 CG32491-RY_exon_2_0_chr3R_17202324_f 0 . chr3R 17202540 17202798 CG32491-RY_exon_3_0_chr3R_17202541_f 0 . chr3R 17203009 17203121 CG32491-RY_exon_4_0_chr3R_17203010_f 0 . chr3R 17192171 17192466 CG32491-RX_exon_0_0_chr3R_17192172_f 0 . chr3R 17200781 17201634 CG32491-RX_exon_1_0_chr3R_17200782_f 0 . chr3R 17202323 17202463 CG32491-RX_exon_2_0_chr3R_17202324_f 0 . chr3R 17202540 17202798 CG32491-RX_exon_3_0_chr3R_17202541_f 0 . chr3R 17203009 17203121 CG32491-RX_exon_4_0_chr3R_17203010_f 0 . chr3R 17193631 17193960 CG32491-RW_exon_0_0_chr3R_17193632_f 0 . chr3R 17200781 17201634 CG32491-RW_exon_1_0_chr3R_17200782_f 0 . chr3R 17202323 17202463 CG32491-RW_exon_2_0_chr3R_17202324_f 0 . chr3R 17202540 17202798 CG32491-RW_exon_3_0_chr3R_17202541_f 0 . chr3R 17203009 17203121 CG32491-RW_exon_4_0_chr3R_17203010_f 0 . chr3R 17194101 17194784 CG32491-RV_exon_0_0_chr3R_17194102_f 0 . chr3R 17200781 17201634 CG32491-RV_exon_1_0_chr3R_17200782_f 0 . chr3R 17202323 17202463 CG32491-RV_exon_2_0_chr3R_17202324_f 0 . chr3R 17202540 17202798 CG32491-RV_exon_3_0_chr3R_17202541_f 0 . chr3R 17203009 17203121 CG32491-RV_exon_4_0_chr3R_17203010_f 0 . chr3R 17195183 17195967 CG32491-RU_exon_0_0_chr3R_17195184_f 0 . chr3R 17200781 17201634 CG32491-RU_exon_1_0_chr3R_17200782_f 0 . chr3R 17202323 17202463 CG32491-RU_exon_2_0_chr3R_17202324_f 0 . chr3R 17202540 17202798 CG32491-RU_exon_3_0_chr3R_17202541_f 0 . chr3R 17203009 17203121 CG32491-RU_exon_4_0_chr3R_17203010_f 0 . chr3R 17195821 17196364 CG32491-RS_exon_0_0_chr3R_17195822_r 0 - chr3R 17200781 17201634 CG32491-RS_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RS_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RS_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RS_exon_4_0_chr3R_17203010_r 0 - chr3R 17196654 17196949 CG32491-RAA_exon_0_0_chr3R_17196655_r 0 - chr3R 17200781 17201634 CG32491-RAA_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RAA_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RAA_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RAA_exon_4_0_chr3R_17203010_r 0 - chr3R 17197044 17197789 CG32491-RO_exon_0_0_chr3R_17197045_r 0 - chr3R 17200781 17201634 CG32491-RO_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RO_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RO_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RO_exon_4_0_chr3R_17203010_r 0 - chr3R 17197884 17198802 CG32491-RN_exon_0_0_chr3R_17197885_r 0 - chr3R 17200781 17201634 CG32491-RN_exon_1_0_chr3R_17200782_r 0 - chr3R 17202323 17202463 CG32491-RN_exon_2_0_chr3R_17202324_r 0 - chr3R 17202540 17202798 CG32491-RN_exon_3_0_chr3R_17202541_r 0 - chr3R 17203009 17203121 CG32491-RN_exon_4_0_chr3R_17203010_r 0 -

3 5

MAF alignments
by pande 01 Dec '10

01 Dec '10

Hi Galaxy, Can you please enlighten me on the concept of MAF alignments ? Are they the same as BLASTZ searches ???? Thanks . Amit.

5 6

Lift over function for ce5 (WS180) to ce6
by Zhu, Lihua (Julie) 30 Nov '10

30 Nov '10

Hi, I tried to lift over a list of chromosome mapped to WS180 (ce5) to ce6, but it seems that galaxy does not support ce5. Could you please help? Thank you very much! Best regards, Julie

2 2

Editing a workflow - hiding intermediate datasets
by Peter 29 Nov '10

29 Nov '10

Hi all, I am quite quite puzzled about how hiding datasets is intended to work when editing a workflow. When editing a workflow, on the output of any tool (in the main part of the screen) next to the grab point for linking tools there is a "snowflake". This is either greyed out (which means hide the output when the tool is run) or yellow (which means the output is kept in the user's history), and you click on it to toggle this. Additionally, on the right hand side in the "Edit Step Actions" there can be a "Hide Dataset" action. My impression is the two UI mechanisms are intended to control the same thing - but toggling one does not affect the out (at least, not directly). For example, toggling the "snowflake" does seem to alter the right hand side (add/remove the "Hide Dataset"), but only after you save, close, and reload the workflow. Is this a bug? If so, the simplest way to solve this (from a UI perspective) might be to remove the "Hide Dataset" action from the right hand side. ------ On a related point, if I extract a workflow from my history, all the steps have their "snowflakes" greyed out - even the final step in the history. Yet despite this, when I run the new workflow all the output is kept (nothing is hidden). After a little experimenting, my guess is that you have a special case: if all the outputs have greyed out snowflakes, rather than running the tools and hidding all the output, you hide nothing. I would expect a new workflow extracted from the history to have all the output kept (yellow snowflakes), or perhaps intermediate output hidden (greyed out snowflakes) with the output from the final history step shown (yellow). Regards, Peter

2 3

Data Library Import "tool error"
by Sridhar A Malkaram 29 Nov '10

29 Nov '10

Hi, I used the "Upload files from filesystem paths" option to upload a directory path into Galaxy Data library. I used the option NO for "Copy data into Galaxy?" as I don't want a duplicate copy of the data. I selected the hg19 for Genome. After the upload process is finished, I can see the directory tree structure, but in the "information" column for files, it reports "Job error (click name for more info)". When I click a file, for example for "macs_test_1_out.bed", which is a bed filetype, it says "failure running job tool error" under "Miscellaneous information". I am pasting below the whlole information. This happens for all the data files that are uploaded. What is this error? and which tool it is complaining about? My another question is, can we upload files/directories with compressed format files (.tar, .gz, .bz. etc) and binary files like .doc, .xls ? If so, what additional plugins we need to have in place? Thanks in advance for your suggestions. ================================ Message: Galaxy Test-data Uploaded by: Date uploaded: 2010-11-29 File size: 52.2 Kb Data type: data Build: hg19 Miscellaneous information: failure running job tool error Database/Build: hg19 Peek: Disk file: /mnt/bioinfo/LINKS/Biotin/data/work/galaxy-dist/test-data/peakcalling_macs/macs_test_1_out.bed ================================ -- With Regards, Sridhar Postdoctoral Research Associate Nutrition and Health Sciences University of Nebraska-Lincoln

1 0