The uploaded file contains inappropriate content
by Erick Antezana
Hi,
It seems there is a (serious) bug while "Adding datasets" via the
"Upload directory of files" (with or without copying the data into
Galaxy (3545:2590120aed68), i.e. (un)tick the 'No' box) if the files
are in ZIP format. Actually the files get erased from the filesystem.
In the "information" column, I get:
Job error (click name for more info)
Then, after clicking on the file name:
Information about 2010.fastq.zip
Message:
Uploaded by: erick(a)mydomain.com
Date uploaded: 2010-03-23
Build: ?
Miscellaneous information: The uploaded file contains
inappropriate content
error
We have no problems with adding unzipped files...
thanks,
Erick
12 years, 6 months
setting environment for sge scripts
by Andreas Kuntzagk
Hi,
I followed the advice for multiple installed python versions to set
~galaxy/galaxy-python/python and set the environment for the galaxy user
to have that in the PATH
Problem is, when a job is started on GridEngine, it does not use the
"-V" flag to inherit the environment. So it runs with a different python
version and more important it does not set LD_LIBRARY_PATH and fails for
some tools which need some special lib. (libRblas in this case)
Where can I fix that?
regards, Andreas
12 years, 7 months
Sending data to GBrowse
by Jelle Scholtalbers
Hi,
I would like to be able to send data to my GBrowse2.0 instance. I have
been trying some things based on the Epigraph tool but I can't seem to
get it work. Below is a mail from Lincoln that was send to the GBrowse
mailinglist about how to send data to GBrowse.
If its possible, how should I configure the tool?
Cheers,
Jelle
--------
In version 2.0 it is relatively easy. POST to the GBrowse URL (including the
datasource part of the URL) with the following parameters:
- action="upload_file"
- file=<a multipart/form-encoded file upload>
- upload_id=<any numeric id of your choosing>
- id=<the id of the user that you are uploading to>
Alternatively to providing the "file" argument you can provide a "data"
argument with the uploaded data provided directly.
The "id" argument indicates the id of the user that you are uploading for.
You can get this ID by bookmarking a page -- the "id" parameter records the
info. Alternatively, if you don't provide an ID, GBrowse will generate it
for you and return the ID in the response cookie, in an argument called
"gbrowse_sess".
If you have administrator's mode enabled, then you can provide the ID of the
administrator and the uploaded file will become part of the public set of
tracks.
Lincoln
12 years, 7 months
where are my deleted datasets?
by Erick Antezana
Hi,
I managed to enable the possibility to 'Add datasets' via the 'Upload
directory of files' option for non-admin users. It works fine: I can
import (as admin and non-admin user) specific datasets into my history
(copy and/or no-copy) so that I could launch some tools over them,
etc. However, if I delete a specific dataset (as admin) that was
imported as non-admin and then login again as non-admin, I can still
see the imported datasets in my history pane. Where is actually
located the reference to the (deleted) dataset? I was able to find the
copied files at .../database/files/000/* , these will be cleaned out
(if deleted) by the purge scripts eventually... I am using SQLAlchemy
with mysql for the DB connection.
cheers,
Erick
12 years, 7 months
gz files
by Keith E. Giles
I apologize for the redundancy, I sent the previous email from the wrong
account.
I am trying to figure out why I can't upload the .gz compressed files from
the broad institute into galaxy. any suggestions?
12 years, 8 months
uploading gz files
by Keith Giles
I am unable to load the raw alignment data from the broad institute datasets
available from the ucsc downloads section. the data is in the gz format.
any suggestions on how to get it uploaded?
12 years, 8 months
CASAVA in Galaxy
by Glen Otero
Hello-
I'm about to embark on an effort to try and roll Illumina's CASAVA pipeline software--demultiplex.pl, GERALD.pl, run.pl and other scripts, into a local Galaxy install. I'd prefer not to reinvent the wheel, so I'd like to hear from anyone that's already done part or all of what I'm going to attempt. Any advice is greatly appreciated.
Alternatively, if this is something that other developers are interested in, maybe it could be considered for a coding sprint during the breakout session at the developers' conference or during one of the BEER sessions?
Thanks!
Glen
12 years, 8 months
New feature: reusing datasets / copying datasets to the current history
by Jeremy Goecks
Hi all,
You might know that you can view all your datasets by visiting 'Datasets' under the User menu. There's now a new action that you can take from this view:
You can copy any of your datasets to your current history, either individually or in bulk.
This feature should make it easier for you to reuse datasets and move datasets between histories as you can search for datasets and then copy them.
Let us know if you have questions.
Thanks,
J.
12 years, 8 months
Re: [galaxy-user] A question regarding sequence retrieval
by Guruprasad Ananda
Hi Amit,
I was not able to reproduce the issue reported by you. I downloaded the BED file from the website pointed by you, and fetched sequences successfully. I'm sharing my history with you: http://main.g2.bx.psu.edu/u/guru/h/test-for-amit
Please make sure that you have the correct BED file, and correct metadata settings (chr,start,end columns and genome build).
Also, in future, can you please report your questions/issues to one of our mailing lists: galaxy-user(a)bx.psu.edu, galaxy-bugs(a)bx.psu.edu?
Thanks,
Guru.
On Mar 30, 2010, at 7:43 AM, pande wrote:
> Hello GURU,
> I am having problems with retrieving the FASTA sequences in the genomic interval that I took from
> http://dir.nhlbi.nih.gov/Papers/lmi/epigenomes/hgtcell.aspx for the CTCF binding site.
> The sequence file that I am getting is empty.
>
> Please help.
>
> warm regards,
> Amit.
>
>
> Guruprasad Ananda wrote:
>> Hello Amit,
>>
>> The genomic sequences hosted on Galaxy are from UCSC and according to their convention repeats from RepeatMasker and Tandem Repeats Finder (with a period of 12 or less) are shown in lower case and non-repeating sequence is shown in upper case.
>>
>> Hope this answers your question.
>> Thanks for using Galaxy,
>> Guru.
>>
>>
>> On Mar 11, 2010, at 5:02 AM, pande wrote:
>>
>>
>>> Dear Galaxy,
>>> I have the results for the sequence retrieval for Insulator regions in the human genome and I am having difficulty in comprehending the upper and lower case associated with my sequences.I know it for sure that they are regions which do not in any way overlap with exons or introns and are that between any 2 genes.
>>> I am attaching a small part of the sequence file for you to see and help me.
>>>
>>>
>>> warm regards,
>>> Amit.
>>>
>>>> hg19_chr14_100364027_100364047_+
>>>>
>>> AAGGCTTCTAATTTGGGTCT
>>>
>>>> hg19_chr14_100364319_100364339_+
>>>>
>>> TATTTTCCCAGCAGAGGATG
>>>
>>>> hg19_chr2_21174437_21174468_+
>>>>
>>> NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>>>
>>>> hg19_chr19_50965398_50965458_+
>>>>
>>> TGTCTCAAGGGATTTAGTCACTTAAAAAAtttttttaattgatttttgat
>>> tttttttttt
>>>
>>>> hg19_chr19_50965141_50965201_+
>>>>
>>> ATCCTCTCTCCCCAGGAATCACCTTCAAACCGTTCGAGTATAAGGAGCAT
>>> GACTTCCGGA
>>>
>>>> hg19_chr16_23597358_23597397_+
>>>>
>>> acccctcagactcccgagtagctgggattataggcgtgc
>>>
>>>> hg19_chr11_5269210_5269281_+
>>>>
>>> TCTTCCAAAACATCTGTTTCTGAGAAGTCCTGTCCTATAGAGGTCTTTCT
>>> TCCCACCGGATTTCTCCTACA
>>>
>>>> hg19_chr11_5182745_5182816_+
>>>>
>>> ggaggaccgtaagggatataaaggttttactgaatactaagagcctgaaa
>>> aactgcttggctgatttgact
>>>
>>>> hg19_chr11_1947003_1947086_+
>>>>
>>> CCAGGCCCCCTCACAGCCTTCTGCTATGAGACCCTTGAGGTGCACACAGG
>>> CTGGGAGCAGATGGGAGGGCTGGGGTCCCATGC
>>>
>>>> hg19_chr11_1944457_1944540_+
>>>>
>>> GGGCCTCGTCTTTTCCCCGAAGTGTGGCCACATGGTCCTGAGGGGCCTGC
>>> AGGTCAGGCTCTGGGTCCTGTCTCTCTGCTTCT
>>>
>>>> hg19_chr17_38531956_38532012_+
>>>>
>>> cctgggctcccacttcggtggcacttgaggagcccttcagcccaccgctg
>>> cactgt
>>>
>>>> hg19_chr17_38531327_38531376_+
>>>>
>>> gatggtaacttcccggtggttaggttgttgccatggaaaggggcggtaa
>>>
>>>> hg19_chr3_10181494_10181542_+
>>>>
>>> taattctttcattttttatagagacaggacctcgctatgttgcccagg
>>>
>>>> hg19_chrX_23982287_23982341_+
>>>>
>>> ATTAGTGCATTCTTTTTCAGAAATTTTTTCTGTGCAGATATACAATCTGT
>>> ATAC
>>>
>>>> hg19_chrX_23982417_23982470_+
>>>>
>>> TTAATAAACATGTCACTGCtgttgtgggtggggttgcccaggaaacagac
>>> tct
>>>
>>>> hg19_chr11_2112020_2112170_+
>>>>
>>> CACCTTGCAGGGTCCCACCAAGACCACTGCAGCCTGGAATTTCCTGCTGA
>>> CACTGGACGTAGGAGGCCTGGAGGGCCTGCAGGGGTCAGCCAGCGCCTCC
>>> AGGACCCTCACTCAAACCTTGTCCCACGCCTTACCACCTTGCACCTGGTC
>>> _______________________________________________
>>> galaxy-user mailing list
>>> galaxy-user(a)lists.bx.psu.edu
>>> http://lists.bx.psu.edu/listinfo/galaxy-user
>>>
>>
>> Guruprasad Ananda
>> Graduate Student
>> Bioinformatics and Genomics
>> The Pennsylvania State University
>>
>>
>>
>>
>>
>
Guruprasad Ananda
Graduate Student
Bioinformatics and Genomics
The Pennsylvania State University
12 years, 8 months
