galaxy-user December 2010

galaxy-user@lists.galaxyproject.org

43 participants
49 discussions

Peep view for history elements broken on IE?
by Peter 22 Feb '11

22 Feb '11

Hi all, I've recently been testing Galaxy on Microsoft Internet Explorer, IE6 and now IE7. It seems that the "peep" view for history entries isn't supported. The history elements' names are not links, so clicking on them does not make them expand to show the info (e.g. number of sequences of file size, and the start of the data). This happens both on the public Galaxy instance at Penn State (http://usegalaxy.org) and our local Galaxy instance. Is this a known issue? Peter

3 13

Python error when running Bowtie for Illumina
by Weng Khong Lim 01 Feb '11

01 Feb '11

Hi all, I'm new to next-gen sequencing, so please be gentle. I've just received a pair of Illumina FASTQ files from the sequencing facility and intend to map them to the hg19 reference genome. I first used the FASTQ Groomer utility to convert the reads into Sanger reads. However, when running Bowtie for Illumina on the resulting dataset under default settings, I received the following error: An error occurred running this job: *Error aligning sequence. requested number of bytes is more than a Python string can hold* * * Can someone help point out my mistake? My history is accessible at http://main.g2.bx.psu.edu/u/wengkhong_lim/h/chip-seq-pilot-batch Appreciate the help! Weng Khong, LIM Department of Genetics University of Cambridge E-mail: wkl24(a)cam.ac.uk Tel: +447503225832

4 3

file uploads
by 望月孝子 19 Jan '11

19 Jan '11

Dear galaxy-user, When we want to use sam files in our local Galaxy server, we can copy the files in our local Galaxy server to "~/galaxy_dist/database/files/000/" to appear in "history" column in Galaxy window by "cp" command written in attempted script. The step, which is recognizing file guess long time. Could you please tell me if you know the methods, which are the data appear in "history" column faster. Best regards, Takako Mochizuki

2 2

Order of input files when creating a workflow.
by Victor Ruotti 18 Jan '11

18 Jan '11

Hi, Just wanted to report this to see if there any way to keep the order of the input files when creating a workflow. When I create a workflow starting with 4 input files. I named then 1,2,3,4 respective in that order from top to bottom. However when try to run the workflow I get a random order of the files. For example the first time I get from bottom to top 3, 1, 4 ,2. And the order changes every time I try to re order them in the workflow. Thank for your feedback. Victor

2 1

Delete data library manually
by Jean-Baptiste Denis 18 Jan '11

18 Jan '11

Hello everybody, i'm a sysadmin in charge of installing a Galaxy server. I'm a totally beginner regarding this software. I've installed Galaxy using the documentation on the wiki (with Apache as a proxy and postgresql as database) and everything went fine. I've tried to create a new library as a galaxy admin. I've added a dataset using "Upload files from filesystem paths" without copying data into galaxy. To test the behaviour of Galaxy in a weird situation i've added "/" (:D), clicked on "Upload to library" and closed the navigation tab after one minute. As a result, the new data library appears under the "Manage data libraries" page. But, when i click on it, i've got a server error. Here is the traceback : -------------------------- .... File '/home/galaxy/galaxy-dist/database/compiled_templates/library/common/browse_library.mako.py', line 229 in render_render_content if not trans.app.security_agent.library_is_public( library, contents=True ): File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py', line 541 in library_is_public File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py', line 559 in folder_is_public File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py', line 559 in folder_is_public File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py', line 559 in folder_is_public File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py', line 562 in folder_is_public AttributeError: 'NoneType' object has no attribute 'dataset' -------------------------- My question is : how can i delete this library without messing with the database consistency? Any hints ?

2 2

add other genomes to galaxy
by Wei,Xintao 03 Jan '11

03 Jan '11

Hi, Is there any chance to add a new genome reference to the Galaxy browser? I am working on the chip-seq data of Trypanosome brucei 927, and the T. brucei genome is not available on the Galaxy browser version. Thank you! Xintao

2 1

Advanced text manipulations in Galaxy
by Maxim Ivanov 03 Jan '11

03 Jan '11

Hello, Sorry for possibly stupid question. Could you advise me whether there are any ways in Galaxy to perform specific manipulations on DNA sequences like: "Substitute all Gs to Cs (except for CG dinucleotides)": Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT or like: "Count the number of CG dinucleotides" Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT 4 using built-in tools (e.g. specific expressions in the "Compute" tool), or this task cannot be done without programming skills? Thank you in advance! With respect, Maxim Ivanov Dept. of Physiology and Pharmacology Karolinska Institutet Stockholm, Sweden

2 1

query related to lift over
by vaibhav jain 03 Jan '11

03 Jan '11

Hi all,I have data with RGSC 3.4 build, along with the start and end coordinates of genes. I want to use lift-over tool to get the corresponding coordinates of those genes for Rat Nov. 2004 (Baylor 3.4/rn4) Assembly. So how I can do this using lift-over ???Or is there any other method to do this work ??? Thanks in advance Vaibhav Jain Research Scholar @IGIB Delhi, INDIA

2 1

Zipping files to download
by Cristian Rojas 03 Jan '11

03 Jan '11

I would like to know if it is possible zip files in Galaxy before download to my computer. How can I do this? Thnks. Regards, Cristian

2 1

Error in running Cuffcompare
by vasu punj 03 Jan '11

03 Jan '11

I get the error message run Cuff compare with Cufflinks- GTF file and Ensembl file downloaded to Galaxy. To download Ensembl file Is used following procedure: Get Data --> UCSC Main select clade/genome/assembly for group, use 'Genes and Gene Prediction Tracks' for track, use Ensembl for table, choose the default (enGene) region: genome output format: GTF The error message is:Error in cuffcompare: [Errno 2] No such file or directory: '/tmp/9935868.hpc-pbs.usc.edu/tmpGXnESn/input1.tmap' Begin PBS Prologue Thu Dec 23 16:29:09 PST 2010 Job ID: 9935868.hpc-pbs.usc.edu Username: ramjan Group: hsc-ar Name: 84_cuffcompare_ramjan(a)usc.edu Queue: laird Shared Access: yes Nodes: hpc2712 TMPDIR: /tmp/9935868.hpc-pbs.usc.edu End PBS Prologue Thu Dec 23 16:29:09 PST 2010 ---------------------------------------- Warning: no access to tty (Bad file descriptor). Thus no job control in this shell. ---------------------------------------- Begin PBS Epilogue Thu Dec 23 16:29:21 PST 2010 Job ID: 9935868.hpc-pbs.usc.edu Username: ramjan Group: hsc-ar Job Name: 84_cuffcompare_ramjan(a)usc.edu Session: 29712 Limits: neednodes=1:ppn=8,nodes=1:ppn=8,walltime=100:00:00 Resources: cput=00:00:09,mem=62512kb,vmem=288372kb,walltime=00:00:12 Queue: laird End PBS Epilogue Thu Dec 23 16:29:21 PST 2010 ----------------------------------------

3 2

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user December 2010