Peep view for history elements broken on IE?
by Peter
Hi all,
I've recently been testing Galaxy on Microsoft Internet Explorer,
IE6 and now IE7. It seems that the "peep" view for history entries
isn't supported. The history elements' names are not links, so
clicking on them does not make them expand to show the info
(e.g. number of sequences of file size, and the start of the data).
This happens both on the public Galaxy instance at Penn State
(http://usegalaxy.org) and our local Galaxy instance.
Is this a known issue?
Peter
10 years, 8 months
Python error when running Bowtie for Illumina
by Weng Khong Lim
Hi all,
I'm new to next-gen sequencing, so please be gentle. I've just received a
pair of Illumina FASTQ files from the sequencing facility and intend to map
them to the hg19 reference genome. I first used the FASTQ Groomer utility to
convert the reads into Sanger reads. However, when running Bowtie for
Illumina on the resulting dataset under default settings, I received the
following error:
An error occurred running this job: *Error aligning sequence. requested
number of bytes is more than a Python string can hold*
*
*
Can someone help point out my mistake? My history is accessible at
http://main.g2.bx.psu.edu/u/wengkhong_lim/h/chip-seq-pilot-batch
Appreciate the help!
Weng Khong, LIM
Department of Genetics
University of Cambridge
E-mail: wkl24(a)cam.ac.uk
Tel: +447503225832
10 years, 8 months
file uploads
by 望月 孝子
Dear galaxy-user,
When we want to use sam files in our local Galaxy server, we can copy the files in our local Galaxy server to "~/galaxy_dist/database/files/000/" to appear in "history" column in Galaxy window by "cp" command written in attempted script. The step, which is recognizing file guess long time.
Could you please tell me if you know the methods, which are the data appear in "history" column faster.
Best regards,
Takako Mochizuki
10 years, 9 months
Order of input files when creating a workflow.
by Victor Ruotti
Hi,
Just wanted to report this to see if there any way to keep the order of the input files when creating a workflow.
When I create a workflow starting with 4 input files. I named then 1,2,3,4 respective in that order from top to bottom.
However when try to run the workflow I get a random order of the files. For example the first time I get from bottom to top 3, 1, 4 ,2.
And the order changes every time I try to re order them in the workflow.
Thank for your feedback.
Victor
10 years, 9 months
Delete data library manually
by Jean-Baptiste Denis
Hello everybody,
i'm a sysadmin in charge of installing a Galaxy server. I'm a totally
beginner regarding this software.
I've installed Galaxy using the documentation on the wiki (with Apache
as a proxy and postgresql as database) and everything went fine.
I've tried to create a new library as a galaxy admin. I've added a
dataset using "Upload files from filesystem paths" without copying
data into galaxy. To test the behaviour of Galaxy in a weird situation
i've added "/" (:D), clicked on "Upload to library" and closed the
navigation tab after one minute.
As a result, the new data library appears under the "Manage data
libraries" page. But, when i click on it, i've got a server error.
Here is the traceback :
--------------------------
....
File
'/home/galaxy/galaxy-dist/database/compiled_templates/library/common/browse_library.mako.py',
line 229 in render_render_content
if not trans.app.security_agent.library_is_public( library,
contents=True ):
File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py',
line 541 in library_is_public
File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py',
line 559 in folder_is_public
File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py',
line 559 in folder_is_public
File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py',
line 559 in folder_is_public
File '/home/sis/jbdenis/galaxy-dist/lib/galaxy/security/__init__.py',
line 562 in folder_is_public
AttributeError: 'NoneType' object has no attribute 'dataset'
--------------------------
My question is : how can i delete this library without messing with the
database consistency?
Any hints ?
10 years, 9 months
add other genomes to galaxy
by Wei,Xintao
Hi,
Is there any chance to add a new genome reference to the Galaxy browser? I am working on the chip-seq data of Trypanosome brucei 927, and the T. brucei genome is not available on the Galaxy browser version.
Thank you!
Xintao
10 years, 9 months
Advanced text manipulations in Galaxy
by Maxim Ivanov
Hello,
Sorry for possibly stupid question. Could you advise me whether there are any ways in Galaxy to perform specific manipulations on DNA sequences like:
"Substitute all Gs to Cs (except for CG dinucleotides)":
Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT
Output: chr1 9078238 9078358 Bait1 ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT
or like:
"Count the number of CG dinucleotides"
Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT
Output: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT 4
using built-in tools (e.g. specific expressions in the "Compute" tool), or this task cannot be done without programming skills?
Thank you in advance!
With respect,
Maxim Ivanov
Dept. of Physiology and Pharmacology
Karolinska Institutet
Stockholm, Sweden
10 years, 9 months
query related to lift over
by vaibhav jain
Hi all,I have data with RGSC 3.4 build, along with the start and end coordinates of genes. I want to use lift-over tool to get the corresponding coordinates of those genes for Rat Nov. 2004 (Baylor 3.4/rn4) Assembly. So how I can do this using lift-over ???Or is there any other method to do this work ???
Thanks in advance
Vaibhav Jain
Research Scholar
@IGIB Delhi, INDIA
10 years, 9 months
Zipping files to download
by Cristian Rojas
I would like to know if it is possible zip files in Galaxy before download to my
computer. How can I do this?
Thnks.
Regards,
Cristian
10 years, 9 months
Error in running Cuffcompare
by vasu punj
I get the error message run Cuff compare with Cufflinks- GTF file and Ensembl file downloaded to Galaxy. To download Ensembl file Is used following procedure:
Get Data --> UCSC Main
select clade/genome/assembly
for group, use 'Genes and Gene Prediction Tracks'
for track, use Ensembl
for table, choose the default (enGene)
region: genome
output format: GTF
The error message is:Error in cuffcompare:
[Errno 2] No such file or directory: '/tmp/9935868.hpc-pbs.usc.edu/tmpGXnESn/input1.tmap'
Begin PBS Prologue Thu Dec 23 16:29:09 PST 2010
Job ID: 9935868.hpc-pbs.usc.edu
Username: ramjan
Group: hsc-ar
Name: 84_cuffcompare_ramjan(a)usc.edu
Queue: laird
Shared Access: yes
Nodes: hpc2712
TMPDIR: /tmp/9935868.hpc-pbs.usc.edu
End PBS Prologue Thu Dec 23 16:29:09 PST 2010
----------------------------------------
Warning: no access to tty (Bad file descriptor).
Thus no job control in this shell.
----------------------------------------
Begin PBS Epilogue Thu Dec 23 16:29:21 PST 2010
Job ID: 9935868.hpc-pbs.usc.edu
Username: ramjan
Group: hsc-ar
Job Name: 84_cuffcompare_ramjan(a)usc.edu
Session: 29712
Limits: neednodes=1:ppn=8,nodes=1:ppn=8,walltime=100:00:00
Resources: cput=00:00:09,mem=62512kb,vmem=288372kb,walltime=00:00:12
Queue: laird
End PBS Epilogue Thu Dec 23 16:29:21 PST 2010
----------------------------------------
10 years, 9 months
