galaxy-user January 2012

galaxy-user@lists.galaxyproject.org

58 participants
76 discussions

Galaxy Cufflinks update?
by Scroggins, Sheena 12 Jan '12

12 Jan '12

Hi, I've been running some RNA seq data through the Cufflinks tools on Galaxy this week. I noticed today that some of my post processing didn't work right. After digging deeper, I see that some of my samples ran through cufflinks 1.0.3 and others say 1.3.0. Did Cufflinks get updated this week? Is there a place to see when these updates take place? The twitter feed mentions other tools and the Wiki doesn't list these as being updated. Thanks, Sheena

2 1

CloudMan - Galaxy - Sharing Confusion
by mailing list 12 Jan '12

12 Jan '12

Hi guys, I've asked some questions about sharing an instance but it doesn't seem to be working the way I'm expecting (Unfortunately I'm also new to Amazon EC2/S3 so that may be part of my difficulty). I'm thinking maybe if I can explain what I'm trying to do, you guys could tell me the best way to do it: My End Goal: So I want to install a bioinformatics program* (and it's dependencies e.g., R, samtools, biopython, etc) that will use SGE provided by CloudMan. Then once everything is configured and installed, I want to share it with other researchers. I'm envisioning them launching Cloudman via http://biocloudcentral.herokuapp.com, having some method to get at my customizations, loading their own data via SCP and then running it. What I've Tried So Far: I created an instance of CloudMan, I chose the data cluster option on the first dialog. Then I ssh'd in and installed stuff on /mnt/galaxyData Then I clicked the share icon on the cloudman front page. (But when I look in S3 I don't think I'm seeing the programs I installed, and I'm not sure how my /mnt/galaxyData volume can be shared with the sharestring.) Let me know your thoughts. Thanks again for the help, -Greg * I'm also hoping for an easy way to update the program while keeping it shared.

4 7

CloudMan - Persist changes to file system is not a hyperlink / clickable
by mailing list 12 Jan '12

12 Jan '12

I'm following the instructions here: http://wiki.g2.bx.psu.edu/Admin/Cloud/Customize%20Galaxy%20Cloud I ssh'd in and just made this change: cd /mnt/galaxyData sudo git clone git://github.com/JaneliaSciComp/msg.git Now I want to persist it, but as my subject line says, I don't seem to have the option in the admin. Thanks, Greg

3 5

CloudMan - Startup Options - Galaxy Cluster vs Data Cluster
by mailing list 12 Jan '12

12 Jan '12

Hi guys, When I first go to my cloudman page at <public dns>/cloud I get a dialog asking for some settings. What does the Galaxy Cluster choice do? What does the Data Cluster choice do? Why can't I choose both? How much space should I allocate? Thanks, Greg Text of dialog: Galaxy Cluster: Galaxy application, available tools, reference datasets, SGE job manager, and a data volume. Specify the initial storage size (in Gigabytes): GBOK Share-an-Instance Cluster: derive your cluster form someone else's cluster. Specify the provided cluster share-string (for example, cm-0011923649e9271f17c4f83ba6846db0/shared/2011-08-19--21-00): Cluster share-string Data Cluster: a persistent data volume and SGE. Specify the initial storage size (in Gigabytes): GB Test Cluster: SGE only. No persistent storage is created.

2 7

Hi
by bbyan 12 Jan '12

12 Jan '12

Hi, I will not receive the mail everyday. Can you help me ? Thanks 2012-01-11 bbyan

3 2

DIAL
by Jeremy Andersen 12 Jan '12

12 Jan '12

Hi, I was wondering if anyone had any experience using the program DIAL to call snps without a reference genome. Cheers, Jeremy Jeremy C. Andersen Doctoral Candidate Department of Environmental Science, Policy & Management Office: Room 310 Wellman Hall Phone: 510-643-6481

1 0

transformation fastq files
by Florian Peschke 12 Jan '12

12 Jan '12

Hi there, I am not quite sure if Galaxy can help me but I am looking for way to transform a fastq file into Unique Seuqence tags. Is this possible uising Galaxy? Greets Florian

2 1

Merge FASTQ Databases
by Edward Turk 11 Jan '12

11 Jan '12

Hi Galaxy Users, Can FASTQ Databases be merged using Galaxy? Thanks, Edward

4 4

CloudMan Launch Page - Hanging
by mailing list 10 Jan '12

10 Jan '12

Hi guys, Is the launch page down today? https://biocloudcentral.herokuapp.com/launch It seems to just hang for me and not load. Let me know if there's anything I can do Thanks Greg

2 6

Clip adapter sequences
by Fransisc Raul Kantor 10 Jan '12

10 Jan '12

Hi We're a bit confused about exactly how the adaptor clipping tool works. Is there some documentation that describes how it does the clipping? In the clipping example given on the Galaxy page for "Clip adapter sequences" (the adaptor is CTGTAGGCACCATCATTATTTATATAA ): * How large a substring of the sequence must the adaptor be in order for it to be clipped? E.g., if the sequence is ATGGACTCTG, it seems to clip the terminal CTG, but it doesn't clip if CTG appears somewhere in the middle of a sequence. * Does it clip if, say, the middle part of the adaptor appears somewhere in the middle of a sequence, and if so, how long must it be before it clips? Thank you, Francisc Raul Kantor

2 1

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user January 2012