galaxy-user March 2012

galaxy-user@lists.galaxyproject.org

82 participants
86 discussions

Metagenomics
by Montoya, Vincent 13 Mar '12

13 Mar '12

Hello I am a relatively new user on Galaxy and I had a question regarding "Fetching Taxonomic Information". It is great that I can retrieve all of the hits for each sequence, but I cannot seem to find an option to also provide how accurate of a match it is to the given taxon. For instance, a percentage match. I can access this information in the original file and programmatically retrieve it but, it would be nice if it came in one package so that I can avoide those false hits that have a low percentage match. Can you please provide me with instructions on how to best to retrieve this information (hopefully in a single file)? Thank you Vincent

5 8

bed to gff
by Robin Mjelle 13 Mar '12

13 Mar '12

Dear Galaxy I have a problem converting Interval to GFF. I used the tool BED-to-GFF<http://main.g2.bx.psu.edu/tool_runner?tool_id=bed2gff1>converter. My Interval file contains 18 coulmns: *chr1 33308998 33309020 + cel-let-7-5p 0 chr1 33308999 255 22M * 0 0 AGAGGAAGAAGGAAGAAAAGAA UGAGGUAGUAGGUUGUAUAGUU XA:i:0 MD:Z:22 NM:i:0* However my GFF output only contains 9, and it has removed the feature "* cel-let-7-5p":* chr1 bed2gff region_0 33308999 33309020 0 + . region_0; Instead of region_0 I want the gene name, in this case the miRNA name. How do I do this? Best Robin

2 1

How to Pass Parameter
by La Chi 13 Mar '12

13 Mar '12

hi galaxy developers , i have developed this parameter in xml file and i am passing "tl" value to a function which is present in my python file , but when i select its type=text , it shows a text field with tl , all i want to know how can i pass kb value without showing text field on galaxy. thanks <param name="site" type="text" label="site for" value="tl" help="Enter tl "/>

2 1

March 12, 2012 Galaxy Development News Brief
by Jennifer Jackson 13 Mar '12

13 Mar '12

Dear Galaxy Community, The *latest Galaxy distribution* has been released: March 12, 2012 Galaxy Development News Brief <http://wiki.g2.bx.psu.edu/DevNewsBriefs/2012_03_12> *Mercurial pull:* new: % hg clone http://www.bx.psu.edu/hg/galaxy galaxy-dist upgrade: % hg pull -u -r 40f1816d6857 *Important Upcoming Changes to Tool Organization: * The _*Emboss tools and Emboss datatypes will be eliminated from the Galaxy distribution in the NEXT release*_. Other tools currently in the Galaxy distribution will be eliminated in following releases. Those hosting local Galaxy instances should read this revised *"Migrating tools"* <http://wiki.g2.bx.psu.edu/Tool%20Shed#Migrating_tools_from_the_Galaxy_distr…> section of the Galaxy tool shed wiki to understand how this process will work: *Migrating tools from the Galaxy distribution to the Galaxy Main tool shed <http://wiki.g2.bx.psu.edu/Tool%20Shed#Migrating_tools_from_the_Galaxy_distr…>* /(Summary)/ In 2012, the Galaxy development team will begin the process of /migrating the tools that are currently available in the Galaxy distribution to the Galaxy Main tool shed/. This will enable those that host local Galaxy instances much more flexibility in choosing to provide only those specific tools in which their users are interested. Read more... <http://wiki.g2.bx.psu.edu/Tool%20Shed#Migrating_tools_from_the_Galaxy_distr…> *Release Highlights: * * *Galaxy tools:* XML configuration <http://wiki.g2.bx.psu.edu/Tool%20Shed#XML_configuration_files_used_to_popul…>, managing tool panel layout <http://wiki.g2.bx.psu.edu/Tool%20Shed#Managing_the_layout_of_your_Galaxy_to…>, and Galaxy tool versions <http://wiki.g2.bx.psu.edu/Tool%20Shed#Galaxy_Tool_Versions> * *RNA-Seq Tools:* Added *CuffMerge* <http://cufflinks.cbcb.umd.edu> version 1.0.0, Updated *TopHat* <http://tophat.cbcb.umd.edu> default parameters * *External Display Apps:* Added RViewer<http://rviewer.lbl.gov/rviewer>, Updated *IGV * <http://www.broadinstitute.org/igv/> * Visualize ENCODE<http://genome.ucsc.edu/ENCODE> "peak" datatype tracks in the Galaxy Track Browser (aka Trackster) * Multiple *Workflow* updates including enhancements to/input dataset options, display modes, and sharing * CloudMan<http://wiki.g2.bx.psu.edu/Admin/Cloud> now offers /preliminary support for OpenNebula cloud type <http://bitbucket.org/galaxy/cloudman/src/tip/cm/clouds/opennebula.py>/ and a larger default tools volume(10GB vs old 2GB) *Need help with a local instance? * * *Installation* and *Admin* Instructions: http://getgalaxy.org * *Search* with our custom google tools: * All Galaxy mailings lists <http://wiki.g2.bx.psu.edu/Mailing%20Lists#Searching>for prior Q & A * Information about deploying, developing, customizing, and administering <http://galaxyproject.org/search/getgalaxy> Galaxy * Information about using <http://galaxyproject.org/search/usegalaxy> Galaxy * *Consider* subscribing to the galaxy-dev <http://wiki.g2.bx.psu.edu/Mailing%20Lists#Subscribing_and_Unsubscribing>mailing list Thanks for using Galaxy, The Galaxy team http://usegalaxy.org http://getgalaxy.org http://galaxyproject.org http://galaxyproject.org/wiki

1 0

March 12, 2012 Galaxy Development News Brief
by Jennifer Jackson 12 Mar '12

12 Mar '12

Dear Galaxy Community, The latest Galaxy distributionhas been released: March 12, 2012 Galaxy Development News Brief <http://wiki.g2.bx.psu.edu/DevNewsBriefs/2012_03_12> *Mercurial pull:* new: % hg clone http://www.bx.psu.edu/hg/galaxy galaxy-dist upgrade: % hg pull -u -r 40f1816d6857 Important Upcoming Changes to Tool Organization: The _*Emboss tools and Emboss datatypes will be eliminated from the Galaxy distribution in the NEXT release*_. Other tools currently in the Galaxy distribution will be eliminated in following releases. Those hosting local Galaxy instances should read this revised *"Migrating tools"* <http://wiki.g2.bx.psu.edu/Tool%20Shed#Migrating_tools_from_the_Galaxy_distr…> section of the Galaxy tool shed wiki to understand how this process will work: Migrating tools from the Galaxy distribution to the Galaxy Main tool shed <http://wiki.g2.bx.psu.edu/Tool%20Shed#Migrating_tools_from_the_Galaxy_distr…> (Summary) In 2012, the Galaxy development team will begin the process of migrating the tools that are currently available in the Galaxy distribution to the Galaxy Main tool shed. This will enable those that host local Galaxy instances much more flexibility in choosing to provide only those specific tools in which their users are interested. Read more... <http://wiki.g2.bx.psu.edu/Tool%20Shed#Migrating_tools_from_the_Galaxy_distr…> Release Highlights: * Galaxy toolsXML configuration <http://wiki.g2.bx.psu.edu/Tool%20Shed#XML_configuration_files_used_to_popul…>, managing tool panel layout <http://wiki.g2.bx.psu.edu/Tool%20Shed#Managing_the_layout_of_your_Galaxy_to…>, and Galaxy tool versions <http://wiki.g2.bx.psu.edu/Tool%20Shed#Galaxy_Tool_Versions>. * RNA-Seq Tools: Added CuffMerge <http://cufflinks.cbcb.umd.edu/>version 1.0.0, Updated TopHat <http://tophat.cbcb.umd.edu/>default parameters * External Display Apps: Added *RViewer* <http://rviewer.lbl.gov/rviewer>, Updated *IGV * <http://www.broadinstitute.org/igv/> * Visualize *ENCODE* <http://genome.ucsc.edu/ENCODE> "peak" datatype tracks in the Galaxy Track Browser(aka Trackster) * Multiple Workflowupdates including enhancements to/input dataset options, display modes, and sharing * *CloudMan* <http://wiki.g2.bx.psu.edu/Admin/Cloud> now offers /preliminary support for OpenNebula cloud type <http://bitbucket.org/galaxy/cloudman/src/tip/cm/clouds/opennebula.py>/ and a larger /default tools volume/ 10GB vs old 2GB). *Need help with a local instance? * Installation and Admin Instructions: http://getgalaxy.org Searchwith our custom google tools: * All Galaxy mailings lists <http://wiki.g2.bx.psu.edu/Mailing%20Lists#Searching>for prior Q & A * Information about deploying, developing, customizing, and administering <http://galaxyproject.org/search/getgalaxy> Galaxy * Information about using <http://galaxyproject.org/search/usegalaxy> Galaxy Consider *subscribing to the galaxy-dev* <http://wiki.g2.bx.psu.edu/Mailing%20Lists#Subscribing_and_Unsubscribing> mailing list Thanks for using Galaxy, The Galaxy team ------- http://usegalaxy.org http://getgalaxy.org http://galaxyproject.org http://galaxyproject.org/wiki

1 0

March 12, 2012 Galaxy Development News Brief
by Jennifer Jackson 12 Mar '12

12 Mar '12

Dear Galaxy Community, The latest *Galaxy distribution* has been released: March 12, 2012 Galaxy Development News Brief <http://wiki.g2.bx.psu.edu/DevNewsBriefs/2012_03_12>. *Mercurial pull:* new: % hg clone http://www.bx.psu.edu/hg/galaxygalaxy-dist upgrade: % hg pull -u -r 40f1816d6857 *Important Upcoming Changes to Tool Organization*: The _*Emboss tools and Emboss datatypes**will be eliminated from the Galaxy distribution in the NEXT release*_. Other tools currently in the Galaxy distribution will be eliminated in following releases. Those hosting local Galaxy instances should read this revised*"Migrating tools" <http://wiki.g2.bx.psu.edu/Tool%20Shed#XML_configuration_files_used_to_popul…>*<http://wiki.g2.bx.psu.edu/Tool%20Shed#XML_configuration_files_used_to_popul…>section of the Galaxy tool shed wiki to understand how this process will work: Migrating tools from the Galaxy distribution to the Galaxy Main tool shed <http://wiki.g2.bx.psu.edu/Tool%20Shed#XML_configuration_files_used_to_popul…> (Summary) In 2012, the Galaxy development team will begin the process of migrating the tools that are currently available in the Galaxy distribution to the Galaxy Main tool shed. This will enable those that host local Galaxy instances much more flexibility in choosing to provide only those specific tools in which their users are interested. Read more... <http://wiki.g2.bx.psu.edu/Tool%20Shed#XML_configuration_files_used_to_popul…> *Release Highlights*: * *Galaxy tools* XML configuration <http://wiki.g2.bx.psu.edu/Tool%20Shed#XML_configuration_files_used_to_popul…>, managing tool panel layout <http://wiki.g2.bx.psu.edu/Tool%20Shed#Managing_the_layout_of_your_Galaxy_to…>, and Galaxy tool versions <http://wiki.g2.bx.psu.edu/Tool%20Shed#Galaxy_Tool_Versions>. * *RNA-Seq Tools*: Added *CuffMerge* <http://cufflinks.cbcb.umd.edu/> version 1.0.0, Updated *TopHat* <http://tophat.cbcb.umd.edu/> default parameters * *External Display Apps*: Added *RViewer <http://rviewer.lbl.gov/rviewer>*, Updated *IGV <http://www.broadinstitute.org/igv/>* * *Visualize *ENCODE <http://genome.ucsc.edu/ENCODE/> "peak" datatype tracks in the *Galaxy Track Browser* (aka Trackster) * Multiple *Workflow* updates including enhancements to/input dataset options, display modes, and sharing/. * *CloudMan <http://wiki.g2.bx.psu.edu/Admin/Cloud>* now offers /preliminary support for OpenNebula cloud type <https://bitbucket.org/galaxy/cloudman/src/tip/cm/clouds/opennebula.py>/ and a /larger default tools volume /(10GB vs old 2GB). *Need help with a local instance? * *Installation and Admin Instructions*: http://getgalaxy.org *Search* with our custom google tools: * All Galaxy mailings lists <http://wiki.g2.bx.psu.edu/Mailing%20Lists#Searching> for prior Q & A * Information about deploying, developing, customizing, and administering Galax <http://galaxyproject.org/search/getgalaxy>y * Information about using Galaxy <http://galaxyproject.org/search/usegalaxy> *Consider****subscribing to the galaxy-dev *mailing list <http://wiki.g2.bx.psu.edu/Mailing%20Lists#Subscribing_and_Unsubscribing> Thanks for using Galaxy, The Galaxy team ------- http://usegalaxy.org http://getgalaxy.org http://galaxyproject.org http://galaxyproject.org/wiki

1 0

Re: [galaxy-user] Advice on disabling SGE queue on galaxy-cloudman
by Enis Afgan 12 Mar '12

12 Mar '12

Hi John, I'm glad you found an alternative solution. Late last night, I realized I had forgotten to email you yesterday as I completed implementing the feature for disabling the master from running jobs within CloudMan ( https://bitbucket.org/galaxy/cloudman/changeset/b21e967d30f9). I have not yet updated the official CloudMan (because there are some other features I'd like to add before doing so) but it is possible to get this code by pulling CloudMan's source from bitbucket, creating cm.tar.gz, and uploading it to your cluster's bucket. Let me know if you'd like to give it a shot and I can point you to a couple of scripts to make that task trivial. I also like the solution you found because it does not necessarily exclude the master from running jobs, just limits it. I'll see about adding that option as well. On Tue, Mar 13, 2012 at 5:36 AM, John Major <john.e.major.jr(a)gmail.com>wrote: > Enis- > > Thanks again for your advice. It led me on a small SGE learning dive and > I actually settled upon a different solution that might be easier to > configure and figured I'd share. > > Using 'qconf -me IP' > I set: > 'complex_variables slots=0' (or 1 if the head node was bigger). > > This seemed to do the trick where the head node did not get overwhelmed > and quickly added nodes if the jobs were not fast to execute. And seems to > persist during auto scaling. > > John > > > On Tue, Mar 6, 2012 at 4:00 PM, Enis Afgan <enis.afgan(a)irb.hr> wrote: > >> Hi John, >> Theoretically, this is a straightforward task but in reality CloudMan >> gets in the way of making it stick. Namely, if you are to manually >> remove the master instance from being an execution host, CloudMan will >> add it back in the next time a node is added or removed from the >> cluster, thus negating your manual modification. >> So, I will add this feature to CloudMan itself but I cannot commit to >> a date right now. It should be soon though. >> >> In the mean time, if you'd like to script this yourself via an add-hoc >> solution that runs periodically, below is the procedure for manually >> removing a node from SGE's execution host list: >> ubuntu@ip-10-204-170-63:~$ sudo -s >> root@ip-10-204-170-63:~# qhost >> HOSTNAME ARCH NCPU LOAD MEMTOT MEMUSE SWAPTO >> SWAPUS >> >> ------------------------------------------------------------------------------- >> global - - - - - - >> - >> ip-10-204-170-63 lx24-amd64 1 1.11 615.2M 161.6M 0.0 >> 0.0 >> # Remove the host from the list of execution hosts >> root@ip-10-204-170-63:~# qconf -de ip-10-204-170-63 >> Host object "ip-10-204-170-63" is still referenced in cluster queue >> "all.q". >> # Edit the configuration of allhosts and remove the host in question. >> If this is the only host in the list, replace it's name with word NONE >> root@ip-10-204-170-63:~# qconf -mhgrp "@allhosts" >> root(a)ip-10-204-170-63.ec2.internal modified "@allhosts" in host group >> list >> # Show configuraiton of group allhosts >> root@ip-10-204-170-63:~# qconf -shgrp "@allhosts" >> group_name @allhosts >> hostlist NONE >> # The hos is now removed from the list of execution hosts >> root@ip-10-204-170-63:~# qstat -f >> root@ip-10-204-170-63:~# >> >> >> >> On Wed, Mar 7, 2012 at 6:23 AM, John Major <john.e.major.jr(a)gmail.com> >> wrote: >> > Hello All- >> > >> > I'd like to launch a galaxy-cloudman head node which does not accept SGE >> > jobs, but as jobs are submitted go to compute nodes (or cause compute >> node >> > to be added when auto-scale is on). >> > Primarily, this is b/c I'd like to have the head node be a cheaper >> instance >> > which can run long term, and only fire up more expensive compute nodes >> as >> > they are actually needed. >> > >> > How would I enable this? >> > >> > Thanks- >> > John >> > >> > ___________________________________________________________ >> > The Galaxy User list should be used for the discussion of >> > Galaxy analysis and other features on the public server >> > at usegalaxy.org. Please keep all replies on the list by >> > using "reply all" in your mail client. For discussion of >> > local Galaxy instances and the Galaxy source code, please >> > use the Galaxy Development list: >> > >> > http://lists.bx.psu.edu/listinfo/galaxy-dev >> > >> > To manage your subscriptions to this and other Galaxy lists, >> > please use the interface at: >> > >> > http://lists.bx.psu.edu/ >> > >

1 0

Re: [galaxy-user] [galaxy-dev] Welcome.html page
by Greg Edwards 12 Mar '12

12 Mar '12

Hi, I've found that I need to be really aggressive with forcing a purge & refresh of the browser when changing things like static/welcome.html and static/images/whatever.png. It might be a function of the nginx light-weight HTML renderer within Galaxy caching things on top of the normal caching. You need to purge all the cache in your browswer totally, eg. in Chrome it's "Preferences / Delete All Browser Data" (or something like that, I'm away from my normal computer). Just forcing a refresah with the usual refresh/reload icon isn't enough. Greg E On Wed, Mar 7, 2012 at 6:52 PM, huayan gao <huayangao(a)gmail.com> wrote: > Hi Nate, > > I got a silly question for you. My galaxy is running now but I'd like > to customize it. > I've changed the welcome.html page but the galaxy mirror site is > showing the old one. Do I need to change some other files or other > configurations? > Also, I add <lable> in tool_conf.xml file but it does not show up > either. Is there another file I need to change too? > > Best, > Huayan > ___________________________________________________________ > Please keep all replies on the list by using "reply all" > in your mail client. To manage your subscriptions to this > and other Galaxy lists, please use the interface at: > > http://lists.bx.psu.edu/ > -- Greg Edwards, Port Jackson Bioinformatics gedwards2(a)gmail.com

3 2

Problems starting Galaxy Cloudman
by Greg Edwards 11 Mar '12

11 Mar '12

Hi, I'm trying to restart my Galaxy Cloudman service, using the same approach that has been successful over the last couple of months .. - launch AMI 861460482541/galaxy-cloudman-2011-03-22 as m1.large - update from Cloudman console - copy in my tools etc etc - restart - away we go, all works However today the update fails, the log says ... /mnt/galaxyTools/galaxy-central/eggs/pysam-0.4.2_kanwei_b10f6e722e9a-py2.6-linux-x86_64-ucs4.egg/pysam/__init__.py:1: RuntimeWarning: __builtin__.file size changed, may indicate binary incompatibility from csamtools import * python path is: /mnt/galaxyTools/galaxy-central/eggs/numpy-1.6.0-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/pysam-0.4.2_kanwei_b10f6e722e9a-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/boto-2.2.2-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/Whoosh-0.3.18-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/pycrypto-2.0.1-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/python_lzo-1.08_2.03_static-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/bx_python-0.7.1_7b95ff194725-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/amqplib-0.6.1-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/pexpect-2.4-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/Babel-0.9.4-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/MarkupSafe-0.12-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/Mako-0.4.1-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/WebHelpers-0.2-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/simplejson-2.1.1-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/wchartype-0.1-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/elementtree-1.2.6_20050316-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/docutils-0.7-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/WebOb-0.8.5-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/Routes-1.12.3-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/Cheetah-2.2.2-py2.6-linux-x86_64-ucs4.egg, /mnt/galaxyTools/galaxy-central/eggs/PasteDeploy-1.3.3-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/PasteScript-1.7.3-py2.6.egg, /mnt/galaxyTools/galaxy-central/eggs/Paste-1.6-py2.6.egg, /mnt/galaxyTools/galaxy-central/lib, /usr/lib/python2.6/, /usr/lib/python2.6/plat-linux2, /usr/lib/python2.6/lib-tk, /usr/lib/python2.6/lib-old, /usr/lib/python2.6/lib-dynload Traceback (most recent call last): File "/mnt/galaxyTools/galaxy-central/lib/galaxy/web/buildapp.py", line 82, in app_factory app = UniverseApplication( global_conf = global_conf, **kwargs ) File "/mnt/galaxyTools/galaxy-central/lib/galaxy/app.py", line 24, in __init__ self.config.check() File "/mnt/galaxyTools/galaxy-central/lib/galaxy/config.py", line 243, in check tree = parse_xml( config_filename ) File "/mnt/galaxyTools/galaxy-central/lib/galaxy/util/__init__.py", line 105, in parse_xml tree = ElementTree.parse(fname) File "/mnt/galaxyTools/galaxy-central/eggs/elementtree-1.2.6_20050316-py2.6.egg/elementtree/ElementTree.py", line 859, in parse tree.parse(source, parser) File "/mnt/galaxyTools/galaxy-central/eggs/elementtree-1.2.6_20050316-py2.6.egg/elementtree/ElementTree.py", line 576, in parse source = open(source, "rb") IOError: [Errno 2] No such file or directory: './migrated_tools_conf.xml' Removing PID file paster.pid While I'm here, I see a new Galaxy Cloudman AMI 072133624695/galaxy-cloudman-2012-02-26. I can't manage to start that, I get an error as below, with all types of instance, (tiny/small/medium/large). Is that a recommended AMI now ? It would be good to have a new updated AMI. [image: Inline image 1] Thanks ! -- Greg Edwards, Port Jackson Bioinformatics gedwards2(a)gmail.com

4 5

Incorrect permissions when uploading files
by James Vincent 10 Mar '12

10 Mar '12

Hello, I think there is a problem with the way permissions are set when uploading files. As admin, when I add new files to a library by file path upload, I select just one specific role which is a group of people (at the bottom of the upload page). There are several different roles available, as well as single users. When I select the single role, it gets highlighted as expected in the drop down list and I click Upload to library. After upload is complete I find that the Access permissions always include me as a single user in addition to the role I actually selected during upload. This causes access to be denied to the role (the group) because there is now a personal role associated with the library. Is this a bug? How can I really get just a single role associated to Access permissions on upload? Thanks, Jim

2 1

← Newer
1
2
3
4
5
6
7
8
9
Older →

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user March 2012