<configfile> syntax
by Jesse Erdmann
I'm getting started with deploying tools to a galaxy site and I'm
having a little trouble understanding the appropriate syntax for the
<configfile> contents. I see there are a few examples in tools
currently available within the galaxy distribution, but I'm wondering
if there is a complete set of documentation somewhere?
I'm a little confused as to when to use '#' tags in front of commands
and how to specify what gets written to the config file rather than
the code that is executed to build the config script.
--
Jesse Erdmann
Bioinformatics Analyst
Masonic Cancer Center
University of Minnesota
jerdmann(a)umn.edu
612-626-3123
jesse(a)jesseerdmann.com
Twitter: http://twitter.com/jesseerdmann
10 years, 11 months
Small RNA gene, tRNA genes
by Kluger, Yuval
Hi,
I would appreciate any suggestion how one can use Galaxy to obtain coordinates of human and mouse of all known tRNAs.
Similarly how one can do that for other types such as miRNAs and other small RNAs .
Thanks,
Yuval
------------------------------------------------------------
This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email.
=================================
10 years, 11 months
Fastq manipulation tools in Galaxy
by Jose Huguet
I looked for the Fastq manipulation tools in Galaxy (public web site)
but I could not find them. IS there any specific link in Galaxy
where these new tools are located?
Thanks
JoseCarlos
10 years, 11 months
Re: [galaxy-user] A question regarding sequence retrieval
by Guruprasad Ananda
Hi,
Using the interval file which you used to fetch fasta sequences, you'll be able to fetch human-chimp alignments. Please use "Extract pairwise MAF blocks" tool under "Fetch alignments" and select "hg18,panTro2" as MAF source. If the MAF source field is empty, please make sure that the database build of your input interval file is set to 'hg18'.
Please feel free to email us if you have any further questions.
Thanks,
Guru.
On Mar 18, 2010, at 9:02 AM, pande wrote:
>
>
> Thank you so much for your quick response..........and may I take the liberty of asking you another question ?
> If I have sequences from the human genome and I want to see their alignment with the Chimp genome are there such pre-computed sets available at the UCSC genome browser or Galaxy ?
> People have told me but till now I have not been successful.
>
> Please help me.
>
> warm regards
>
> Amit.
>
>
>
>
>
> Guruprasad Ananda wrote:
>> Hello Amit,
>>
>> The genomic sequences hosted on Galaxy are from UCSC and according to their convention repeats from RepeatMasker and Tandem Repeats Finder (with a period of 12 or less) are shown in lower case and non-repeating sequence is shown in upper case.
>>
>> Hope this answers your question.
>> Thanks for using Galaxy,
>> Guru.
>>
>>
>> On Mar 11, 2010, at 5:02 AM, pande wrote:
>>
>>
>>> Dear Galaxy,
>>> I have the results for the sequence retrieval for Insulator regions in the human genome and I am having difficulty in comprehending the upper and lower case associated with my sequences.I know it for sure that they are regions which do not in any way overlap with exons or introns and are that between any 2 genes.
>>> I am attaching a small part of the sequence file for you to see and help me.
>>>
>>>
>>> warm regards,
>>> Amit.
>>>
>>>> hg19_chr14_100364027_100364047_+
>>>>
>>> AAGGCTTCTAATTTGGGTCT
>>>
>>>> hg19_chr14_100364319_100364339_+
>>>>
>>> TATTTTCCCAGCAGAGGATG
>>>
>>>> hg19_chr2_21174437_21174468_+
>>>>
>>> NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>>>
>>>> hg19_chr19_50965398_50965458_+
>>>>
>>> TGTCTCAAGGGATTTAGTCACTTAAAAAAtttttttaattgatttttgat
>>> tttttttttt
>>>
>>>> hg19_chr19_50965141_50965201_+
>>>>
>>> ATCCTCTCTCCCCAGGAATCACCTTCAAACCGTTCGAGTATAAGGAGCAT
>>> GACTTCCGGA
>>>
>>>> hg19_chr16_23597358_23597397_+
>>>>
>>> acccctcagactcccgagtagctgggattataggcgtgc
>>>
>>>> hg19_chr11_5269210_5269281_+
>>>>
>>> TCTTCCAAAACATCTGTTTCTGAGAAGTCCTGTCCTATAGAGGTCTTTCT
>>> TCCCACCGGATTTCTCCTACA
>>>
>>>> hg19_chr11_5182745_5182816_+
>>>>
>>> ggaggaccgtaagggatataaaggttttactgaatactaagagcctgaaa
>>> aactgcttggctgatttgact
>>>
>>>> hg19_chr11_1947003_1947086_+
>>>>
>>> CCAGGCCCCCTCACAGCCTTCTGCTATGAGACCCTTGAGGTGCACACAGG
>>> CTGGGAGCAGATGGGAGGGCTGGGGTCCCATGC
>>>
>>>> hg19_chr11_1944457_1944540_+
>>>>
>>> GGGCCTCGTCTTTTCCCCGAAGTGTGGCCACATGGTCCTGAGGGGCCTGC
>>> AGGTCAGGCTCTGGGTCCTGTCTCTCTGCTTCT
>>>
>>>> hg19_chr17_38531956_38532012_+
>>>>
>>> cctgggctcccacttcggtggcacttgaggagcccttcagcccaccgctg
>>> cactgt
>>>
>>>> hg19_chr17_38531327_38531376_+
>>>>
>>> gatggtaacttcccggtggttaggttgttgccatggaaaggggcggtaa
>>>
>>>> hg19_chr3_10181494_10181542_+
>>>>
>>> taattctttcattttttatagagacaggacctcgctatgttgcccagg
>>>
>>>> hg19_chrX_23982287_23982341_+
>>>>
>>> ATTAGTGCATTCTTTTTCAGAAATTTTTTCTGTGCAGATATACAATCTGT
>>> ATAC
>>>
>>>> hg19_chrX_23982417_23982470_+
>>>>
>>> TTAATAAACATGTCACTGCtgttgtgggtggggttgcccaggaaacagac
>>> tct
>>>
>>>> hg19_chr11_2112020_2112170_+
>>>>
>>> CACCTTGCAGGGTCCCACCAAGACCACTGCAGCCTGGAATTTCCTGCTGA
>>> CACTGGACGTAGGAGGCCTGGAGGGCCTGCAGGGGTCAGCCAGCGCCTCC
>>> AGGACCCTCACTCAAACCTTGTCCCACGCCTTACCACCTTGCACCTGGTC
>>> _______________________________________________
>>> galaxy-user mailing list
>>> galaxy-user(a)lists.bx.psu.edu
>>> http://lists.bx.psu.edu/listinfo/galaxy-user
>>>
>>
>> Guruprasad Ananda
>> Graduate Student
>> Bioinformatics and Genomics
>> The Pennsylvania State University
>>
>>
>>
>>
>>
>
Guruprasad Ananda
Graduate Student
Bioinformatics and Genomics
The Pennsylvania State University
10 years, 11 months
transfer_datasets.ini ?
by Erick Antezana
Hi,
could you please tell me the purpose of the following file:
transfer_datasets.ini
thanks,
Erick
10 years, 11 months
Galaxy Outage: March 18, 3:30AM-7:30AM EDT
by Nate Coraor
Hello,
Due to a scheduled power outage in our data center, Galaxy (Test and
Main) will be unavailable on Thursday, March 18, 2010 from 3:30AM to
7:30AM EDT (UTC -0400). Jobs still running at 3:30AM Thursday will not
be able to be completed (but can be restarted once Galaxy is up).
--nate
Galaxy Team
10 years, 11 months
A question regarding sequence retrieval
by pande
Dear Galaxy,
I have the results for the sequence retrieval
for Insulator regions in the human genome and I am having difficulty in
comprehending the upper and lower case associated with my sequences.I
know it for sure that they are regions which do not in any way overlap
with exons or introns and are that between any 2 genes.
I am attaching a small part of the sequence file for you to see and help me.
warm regards,
Amit.
>hg19_chr14_100364027_100364047_+
AAGGCTTCTAATTTGGGTCT
>hg19_chr14_100364319_100364339_+
TATTTTCCCAGCAGAGGATG
>hg19_chr2_21174437_21174468_+
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>hg19_chr19_50965398_50965458_+
TGTCTCAAGGGATTTAGTCACTTAAAAAAtttttttaattgatttttgat
tttttttttt
>hg19_chr19_50965141_50965201_+
ATCCTCTCTCCCCAGGAATCACCTTCAAACCGTTCGAGTATAAGGAGCAT
GACTTCCGGA
>hg19_chr16_23597358_23597397_+
acccctcagactcccgagtagctgggattataggcgtgc
>hg19_chr11_5269210_5269281_+
TCTTCCAAAACATCTGTTTCTGAGAAGTCCTGTCCTATAGAGGTCTTTCT
TCCCACCGGATTTCTCCTACA
>hg19_chr11_5182745_5182816_+
ggaggaccgtaagggatataaaggttttactgaatactaagagcctgaaa
aactgcttggctgatttgact
>hg19_chr11_1947003_1947086_+
CCAGGCCCCCTCACAGCCTTCTGCTATGAGACCCTTGAGGTGCACACAGG
CTGGGAGCAGATGGGAGGGCTGGGGTCCCATGC
>hg19_chr11_1944457_1944540_+
GGGCCTCGTCTTTTCCCCGAAGTGTGGCCACATGGTCCTGAGGGGCCTGC
AGGTCAGGCTCTGGGTCCTGTCTCTCTGCTTCT
>hg19_chr17_38531956_38532012_+
cctgggctcccacttcggtggcacttgaggagcccttcagcccaccgctg
cactgt
>hg19_chr17_38531327_38531376_+
gatggtaacttcccggtggttaggttgttgccatggaaaggggcggtaa
>hg19_chr3_10181494_10181542_+
taattctttcattttttatagagacaggacctcgctatgttgcccagg
>hg19_chrX_23982287_23982341_+
ATTAGTGCATTCTTTTTCAGAAATTTTTTCTGTGCAGATATACAATCTGT
ATAC
>hg19_chrX_23982417_23982470_+
TTAATAAACATGTCACTGCtgttgtgggtggggttgcccaggaaacagac
tct
>hg19_chr11_2112020_2112170_+
CACCTTGCAGGGTCCCACCAAGACCACTGCAGCCTGGAATTTCCTGCTGA
CACTGGACGTAGGAGGCCTGGAGGGCCTGCAGGGGTCAGCCAGCGCCTCC
AGGACCCTCACTCAAACCTTGTCCCACGCCTTACCACCTTGCACCTGGTC
10 years, 11 months
Error from Histogram in local galaxy installation : 'x' must be numeric
by Jim Johnson
Using an upload of test-data/2.tabular as test dataset
My local installations (Mac and Linux) of galaxy reports this error
for Histogram:
An error occurred running this job: Error in hist.default(list(68, 71,
62, 75, 58, 60, 67, 68, 71, 69), xlab = "V1", :
'x' must be numeric
This works without error at: http://main.g2.bx.psu.edu/
I looked at the code in tools/plotting/histogram.py and it doesn't
make sense to me.
Why does it create matrix = [] which it seems to use as a 2-Dim array?
R hist() seems to only take an R Vector.
Are there any version changes to R, Rpy, or NumPy that might have
changed how this operates?
I executed some of that code interactively and got the same error message:
$ python
Python 2.6.4 (r264:75706, Mar 9 2010, 10:00:44)
[GCC 4.2.1 (Apple Inc. build 5646) (dot 1)] on darwin
Type "help", "copyright", "credits" or "license" for more information.
>>> import sys
>>> from rpy import *
>>> matrix = []
>>> vals = ["23","14","32","25","12","9","35","18","24"]
>>> for i in vals:
... row = [];row.append(float(i));matrix.append(row)
...
>>> matrix
[[23.0], [14.0], [32.0], [25.0], [12.0], [9.0], [35.0], [18.0], [24.0]]
>>> a = array(matrix)
>>> r.pdf("histtest.pdf", 8, 8)
>>> title = "Histogram Test";xlab="Count";breaks="Sturges"
>>> r.hist( a, probability=True, main=title, xlab=xlab, breaks=breaks )
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
rpy.RPy_RException: Error in hist.default(list(23, 14, 32, 25, 12, 9,
35, 18, 24), xlab = "Count", :
'x' must be numeric
>>> a array([[ 23.],
[ 14.],
[ 32.],
[ 25.],
[ 12.],
[ 9.],
[ 35.],
[ 18.],
[ 24.]])
>>> # Now JJ tries creating just a vector instead of using matrix
...
>>> v = []
>>> for i in vals:
... v.append(float(i))
...
>>> v
[23.0, 14.0, 32.0, 25.0, 12.0, 9.0, 35.0, 18.0, 24.0]
>>> r.hist(v, probability=True, main=title, xlab=xlab, breaks=breaks )
{'density': [0.022222217777778667, 0.044444444444444446,
0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446],
'equidist': True, 'breaks': [5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0],
'intensities': [0.022222217777778667, 0.044444444444444446,
0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446],
'counts': [1, 2, 1, 3, 0, 2], 'xname': 'c(23, 14, 32, 25, 12, 9, 35, 18,
24)', 'mids': [7.5, 12.5, 17.5, 22.5, 27.5, 32.5]}
>>>
>>> a = array(v)
>>> r.hist( a, probability=True, main=title, xlab=xlab, breaks=breaks )
{'density': [0.022222217777778667, 0.044444444444444446,
0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446],
'equidist': True, 'breaks': [5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0],
'intensities': [0.022222217777778667, 0.044444444444444446,
0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446],
'counts': [1, 2, 1, 3, 0, 2], 'xname': 'c(23, 14, 32, 25, 12, 9, 35, 18,
24)', 'mids': [7.5, 12.5, 17.5, 22.5, 27.5, 32.5]}
>>> r.dev_off()
{'null device': 1}
>>>
10 years, 11 months
Output files
by Stein, Olaf
Hi all,
I have a tool setup (a small perl script) and it runs fine, I get the output I would usually see in shell in the history.
The script also generates some output files (at least in a normal run in the shell), where within galaxy can I see those?
Thanks
Olaf
-------------------------
Olaf Stein
DBA
Battelle Center for Mathematical Medicine
Nationwide Children's Hospital, The Research Institute
700 Children's Drive
43205 Columbus, OH
phone: 1-614-355-5685
cell: 1-614-843-0432
email: olaf.stein(a)nationwidechildrens.org
"I consider that the golden rule requires that if I like a program I must share it with other people who like it."
Richard M. Stallman
10 years, 11 months
