galaxy-user November 2011

galaxy-user@lists.galaxyproject.org

85 participants
94 discussions

Start a nNew thread

more on varying number of output files in xml
by Nicholas Robinson 09 Nov '11

09 Nov '11

2 1

CEAS in Galaxy
by shamsher jagat 09 Nov '11

09 Nov '11

Is there an option of running CEAS tool in Galaxy I want to annotate selected enriched regions of ChIP seq data with gene names etc? Thanks

3 3

fastq joiner problem
by Matthew Herron 08 Nov '11

08 Nov '11

Hi, I am trying to join two groomed fastq files from a paired-end Illumina read using the fastq joiner tool. The drop-down menus correctly identify the groomed fastq files, but after cranking for a few minutes the tool produces empty output: "FASTQ joiner on data 5 and data 4emptyformat: fastqsanger, database: ?Info: There were 3497909 known sequence reads not utilized.Joined 0 of 3497909 read pairs (0.00%)." The files have the same number of reads (3497909), reads have the same number of bases (102), and the joiner tool doesn't have any options (other than choosing the two files to join). I have tried this with Sanger and with Illumina 1.3+ quality scores, and in both (left-right) orientations. I've pasted the beginnings of the two files below my signature in case this is useful for diagnosing the problem. Can anyone tell me what I'm doing wrong? Thanks, -- Matthew D. Herron, PhD Department of Zoology University of British Columbia X.princeps(a)gmail.com http://www.eebweb.arizona.edu/grads/mherron/ Sample of read 1: @HWI-ST765:83:D091AACXX:1:1101:1202:2130 1:N:0:ACTTGA TTATTCCGTTTACCTTCACGCTGTTATGGCTCTCGGTGTTCGGCAATAGCGCGCTGTATGAAATTATCCACGGCGGCGCGGCATTTGCCGAGGAAGCGATG + CCCFFFFFHHHHHJJJJJJJJJJJJIJIJJJIEHII?FGIIJJJJJJJIJJJHFFDDEEEDEDDDDEDDDDDDDDDDDDDDDDDDD@CCD3<BDD@DDDBD Sample of read 2: @HWI-ST765:83:D091AACXX:1:1101:1202:2130 2:N:0:ACTTGA ATTCCCCAGCACCAGCGCCCCGGAGTCCGCCGAGGTCACATAAAACAGCAGGCCAGTAATGGTGGCGACGGAGGCGCTAAAGGTAAACGCCGGATACTGCG + CCCFFFFFFGHHHJJJJJJJJJIJIFHIIJJJJIG:BEFFFFEEEDDCBDDDDDDD@CDDDCACDDDBDDDDDDBDDDDDDDC>@CCC@@DDDDDDDDEDB

3 2

adaptor trimming
by Soetkin Versteyhe 08 Nov '11

08 Nov '11

Hi! Does anyone know if it is possible to trim sequencing adaptor sequences away in Galaxy? Thanks! Soetkin Versteyhe, PhD PostDoc University of Copenhagen Faculty of Health Sciences The Novo Nordisk Foundation Center for Basic Metabolic Research Integrative Physiology Blegdamsvej 3B 2200 København N Denmark PHONE +45 35337116 soetkin.versteyhe(a)sund.ku.dk http://sund.ku.dk http://metabol.ku.dk<http://metabol.ku.dk/> [cid:image001.gif@01CC9E39.FE2E3F70]

2 1

Data gets deleted from public server
by shamsher jagat 08 Nov '11

08 Nov '11

I uploaded two BAM files and was working with them but when I tried to use them again they are automatically deleted along with all the steps of analysis? Any reason or I am missing something. Shamsher

3 5

Cufflink error
by Lizex Husselmann 08 Nov '11

08 Nov '11

Hi I've started an alignment using the command line (Tophat v1.3.3). I've uploaded the files (accepted.bam) onto Galaxy and upon doing the Cufflinks analysis on the Galaxy interface, it shows an error. I had to look at the options. I've change the options to default and run it again but still the same error. Is the accepted.bam file not compatible with the Galaxy Cufflinks? Is there something I not doing? Kind regards Lizex Disclaimer This message is confidential and may be covered by legal professional privilege. It must not be read, copied, disclosed or used in any other manner by any person other than the addressee(s). Unauthorised use, disclosure or copying is strictly prohibited and may be unlawful. The views expressed in this email are those of the sender, unless otherwise stated. If you have received this email in error, please contact ARC Service Desk immediately. (mailto:Servicedesk@arc.agric.za) To report incidents of fraud and / or corruption in the ARC use our Ethics Hotline by: Phone number : 0800 21 20 56 Fax number : 0800 200 796 Email address : fraud(a)kpmg.co.za For more information on the ARC Ethics Hotline, please visit our website at www.arc.agric.za.

2 1

SNPeff tool?
by Laura Elizabeth Spoor 08 Nov '11

08 Nov '11

Hi, I use the Galaxy server and was wondering how to use SNPeff tool? I have seen that it can be integrating with Galaxy on their website (http://snpeff.sourceforge.net/images/snpEff_galaxy.png) but cannot see it on the server? Is it something that can be run on the server? Best Wishes, Laura -- The University of Edinburgh is a charitable body, registered in Scotland, with registration number SC005336.

4 5

Cuffcompare error
by Alessia D 08 Nov '11

08 Nov '11

Hi, I am trying to run Cuffcompare on a set of 6 Cufflinks-generated datasets (3 replicates of 2 conditions). I am consistently getting the following error: Error running cuffcompare. Warning: Your version of Cufflinks is not up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu). Error: no XLocus created for transcript CUFF.34072.1 (file ./input3) [2, 2], on chrY+:274296-277218 However, if I run Cuffcompare on the 2 conditions separately (3x Cufflinks datasets), everything works fine. Does anyone know why this is? Thanks Alessia

2 1

Uploading Genome from Ensembl
by Scroggins, Sheena 08 Nov '11

08 Nov '11

How do I upload the Zebrafish genome from Ensembl to my user history in Galaxy? I'm trying to map my RNA-Seq data using TopHat and need to map it to the Ensembl version of ZFv9, but Galaxy only has the UCSC version built in. The Ensembl version is slightly different. Thanks, Sheena

3 2

number of concurrent jobs/user
by Petr Novak 08 Nov '11

08 Nov '11

Is it possible to limit number of concurrent jobs when job_runner is pbs? The setting in universe_wsgi.ini is obviously limiting only locally run jobs. Petr

1 0

← Newer
1
2
3
4
5
6
7
8
9
10
Older →

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user November 2011