galaxy-user September 2011

galaxy-user@lists.galaxyproject.org

68 participants
65 discussions

Server error
by Karthik R Padmanabhan 29 Sep '11

29 Sep '11

Hello, I am currently experiencing a server error (see below): ------------------------- Server Error An error occurred. See the error logs for more information. (Turn debug on to display exception reports here) ------------------------- Kindly take a look. Thanks. -- Regards, Karthik R. Padmanabhan

2 1

problem mapping 454 reads in fastq format using LASTZ
by Chris.Howard＠csiro.au 29 Sep '11

29 Sep '11

Dear Galaxy Team and users, I have some 454 reads that I would like to map against a contig assembly using LASTZ. I have already mapped the reads uploaded in fasta format against the assembly but, as mapping the reads in fasta ignores the base qualities that would be present in a fastq file, I am concerned that I might need the base quality information that may be crucial in deciding on 'real' SNPs later down the line. So, as LASTZ apparently recognises fastq (*see below), I converted the reads to fastq using the 'Combine fasta and qual' tool in Galaxy and I am now currently trying to map the reads to the assembly. However, Galaxy would not recognise the fastq reads in the LASTZ input page. So I tried to fool it by changing the data type of the fastq to fasta using the 'Edit attributes' function of the history. This kept the fastq info but allowed Galaxy to recognise the file as input for LASTZ. However, this mapping has been running for almost 24 hours now and so I am concerned that there is an error. Is anyone able offer any help with why Galaxy does not recognise the reads in fastq format prior to mapping with LASTZ? Here are what the first two reads look like in fastq format: @GIQ547K01A7QJK length=76 xy=0381_0142 region=1 run=R_2010_06_11_16_16_09_ GCTTCGTGTGCGACGACACTCGTCATCGACAACGCAAGACTGGCGCTATCGCAATTGGACACACAACATGTGACCG + 27 19 17 17 18 19 11 14 14 17 19 17 22 17 17 14 14 14 17 19 17 19 17 17 19 19 25 25 22 17 12 13 14 19 21 21 21 27 21 19 19 17 17 19 17 24 25 22 20 22 22 17 16 16 12 12 12 12 19 22 17 17 17 20 20 22 27 21 25 22 20 20 22 21 16 12 @GIQ547K01AE4BG length=40 xy=0055_0266 region=1 run=R_2010_06_11_16_16_09_ GTGACTAGATACATGCAATCAATTGTCCATGTCATTCGAG + 27 23 23 19 19 19 18 19 21 19 18 19 18 25 27 27 26 26 27 27 27 27 27 19 19 18 19 19 27 27 25 24 25 25 21 21 22 22 22 18 * Input formats (copied from the LASTZ input page in Galaxy) LASTZ accepts reference and reads in FASTA format. However, because Galaxy supports implicit format conversion the tool will recognize fastq and other method specific formats. With thanks, Chris

2 1

Gro-seq! and Galaxy
by Di Nguyen 29 Sep '11

29 Sep '11

Hi all, I have BED and WIG files from Gro-Seq but Galaxy did not recognize these files. WHY is that? Please accept my appreciation Di Nguyen UW, Seattle, WA

2 1

Adding new genomes to Galaxy
by Jennifer Jackson 29 Sep '11

29 Sep '11

Hello James, I'll post this to the galaxy-user list for you. Next time, just send an email to "galaxy-user(a)bx.psu.edu" to post a question/request. GMOD supports a searchable archive, but it is not a forum. You can follow the discussion there or join the mailing list to receive content: http://galaxyproject.org/wiki/News http://galaxyproject.org/wiki/Mailing%20Lists We could add this genome to the working list, but it would likely be some time before the genome would be added. A better method of using new genomes, especially smaller genomes, is to load them into your history and use them from there with Galaxy's tools (most support this option). You can even create your own visualization with the GTB (Galaxy Track Browser) with a custom genome. To load the genome, use FTP as described here: http://galaxyproject.org/wiki/Learn/Upload%20via%20FTP http://galaxyproject.org/wiki/Learn/Screencasts Tool tutorials -> Using FTP And more about the GTB is discussed here: http://galaxyproject.org/wiki/Learn/Visualization Hopefully this helps, Best, Jen Galaxy team On 9/28/11 2:54 PM, jsmart(a)utm.edu wrote: > Dear Ms. Jackson, > > I tried to post this on the discussion board but GMOD won't let me start a new topic? so please accept my apologies for the direct contact. > > I was wondering how hard it would be to add the Rhodobacter capsulatus genome to the drop-down list? > > There's actually two (the chromosome& a large plasmid): > Plasmid: http://www.ncbi.nlm.nih.gov/nuccore/CP001313.1 > Genome: http://www.ncbi.nlm.nih.gov/nuccore/CP001312.1 > > Thanks for your help/advice with this. > > James Smart > jsmart(a)utm.edu -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support

1 0

Manipulate FASTQ question
by graham etherington (TSL) 29 Sep '11

29 Sep '11

Hi, I currently have read names with the format: @N57638:1:64JU0AAXX:1:1:1057:943 1:Y:0: and would like to change them to the format: @N57638:1:64JU0AAXX:1:1:1057:943/1 I use Manipulate FASTQ, on all reads and set 'Manipulate Reads on:' to 'Name/Identifier', ('String Translate' becomes the only option). I then set the 'From:' field to '1:Y:0:' and the 'To:' field to '/1' (without the literal quotes). I get the following error: Traceback (most recent call last): File "/home/home/galaxy/software/galaxy-central/tools/fastq/fastq_manipulation.py", line 37, in main() File "/home/home/galaxy/software/galaxy-central/tools/fastq/fastq_manipulation.py", line 25, in main new_read = fastq_manipulator.match_and_manipulate_read( fastq_read ) File "/home/home/galaxy/software/galaxy-central/database/job_working_directory/942/tmpgp13Qy", line 15, in match_and_manipulate_read new_read = manipulate_read( fastq_read ) File "/home/home/galaxy/software/galaxy-central/database/job_working_directory/942/tmpgp13Qy", line 8, in manipulate_read new_read.identifier = "@%s" % new_read.identifier[1:].translate( maketrans( binascii.unhexlify( "313a593a303a" ), binascii.unhexlify( "2f31" ) ) ) ValueError: maketrans arguments must have same length So, do the From and To fields really need to be the same length? This seems rather strange and unhelpful. Am I doing something wrong? Many thanks, Graham Dr. Graham Etherington Bioinformatics Support Officer, The Sainsbury Laboratory, Norwich Research Park, Norwich NR4 7UH. UK

2 1

Indel analysis
by Golbus, Jessica 28 Sep '11

28 Sep '11

Hi- I am using Galaxy for Indel analysis. Does the Indels from Sam analysis use Dindel to pull variation? Thanks! ********************************************************** Electronic Mail is not secure, may not be read every day, and should not be used for urgent or sensitive issues

2 1

October 2011 Events
by Dave Clements 28 Sep '11

28 Sep '11

Hello all, There are (at least) three Galaxy related events<http://wiki.g2.bx.psu.edu/Events>going on next month that you may want to consider attending. See the Events <http://wiki.g2.bx.psu.edu/Events> page for a full listing of upcoming events. If you have a Galaxy related event please send it to outreach(a)galaxyproject.org and we will help you get the word out. Date Topic/Event Venue/Location Comments Contact October 9-12 *Exploit your Data: Galaxy and the GMOD Tool Suite<http://www.amata.org.au/index.php/2011-conference/workshops> * AMATA 2011 <http://www.amata.org.au/index.php/2011-conference>, Canberra, Australia This workshop will cover both Galaxy and provide an overview of the GMOD<http://gmod.org/wiki/>tool suite. Many thanks to CSIRO and AMATA for sponsoring this workshop Dave Clements <http://wiki.g2.bx.psu.edu/DaveClements> October 12-14 *October 2011 GMOD Meeting and Galaxy Workshop<http://gmod.org/wiki/October_2011_GMOD_Meeting> * Ontario Institute for Cancer Research (OICR), Toronto, Canada Dan will give a Galaxy update at the meeting, and then lead a satellite workshop on Galaxy the day following the meeting. (Or, if you already know all about Galaxy you could attend workshops on BioMart<http://gmod.org/wiki/BioMart>and InterMine <http://gmod.org/wiki/InterMine>, two data sources for Galaxy.) Register now <http://gmod.org/wiki/October_2011_GMOD_Meeting> as the meeting and associated workshop have limited space. Dan Blankenberg October 23-24 *The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool<http://www.biovis.net/papers_abstracts/papers/111.html> * BioVis 2011 <http://www.biovis.net/>, Providence, Rhode Island, United States Learn about Trackster and other biological visualization. This is part of VisWeek 2011 <http://visweek.org/>. Jeremy Goecks Thanks, Dave Clements <http://wiki.g2.bx.psu.edu/DaveClements> -- http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ http://galaxyproject.org/wiki/

1 0

Problem in merging two BAM file in Galaxy. Thanks for help.
by Binbin You 28 Sep '11

28 Sep '11

Hi All, I tried many times to merge two BAM files (3.3 GB and 7.7MB) using different versions of Galaxy. But every time I only got an empty file and it showed some info like this: [Wed Sep 14 08:56:06 EDT 2011] net.sf.picard.sam.MergeSamFiles done. Elapsed time: 0.02 minutes. Runtime.totalMemory()=310116352 Exception in thread "main" java.lang.IllegalArgumentException: Cannot add sequence that already exists in SAMSequenceDictionary: contig00311 at net.sf.samtools.SAMSequenceDictionary.setSequences(SAMSequenceDictionary.java:62) at net.sf.samtools.SAMSequenceDictionary.<init>(SAMSequenceDictionary.java:40) at net.sf.samtools.SAMTextHeaderCodec.decode(SAMTextHeaderCodec.java:106) at net.sf.samtools.BAMFileReader.readHeader(BAMFileReader.java:364) at net.sf.samtools.BAMFileReader.<init>(BAMFileReader.java:118) at net.sf.samtools.BAMFileReader.<init>(BAMFileReader.java:97) at net.sf.samtools.SAMFileReader.init(SAMFileReader.java:504) at net.sf.samtools.SAMFileReader.<init>(SAMFileReader.java:165) at net.sf.samtools.SAMFileReader.<init>(SAMFileReader.java:120) at net.sf.picard.sam.MergeSamFiles.doWork(MergeSamFiles.java:100) at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:175) at net.sf.picard.sam.MergeSamFiles.main(MergeSamFiles.java:84) Does anybody have the similar problem and thanks for any suggestion in handling this issue. Best wishes, Bin

2 1

Galaxy and Ion Torrent
by cuentasecuenciacion 28 Sep '11

28 Sep '11

Hello!! Does anybody know whether Ion Torrent data is supported by Galaxy? Thank you!! Dra. Alicia Barroso del Jesus Unidad de Genómica IPBLN Instituto de Parasitología y Biomedicina "López-Neyra". CSIC Parque Tecnológico de Ciencias de la Salud Avda. del Conocimiento s/n - 18100 Armilla, Granada . España ************************************************* secuenciacion(a)ipb.csic.es Tel.: 958 181 635 **************************************************

3 2

(no subject)
by raghava rao 28 Sep '11

28 Sep '11

-- Y.P.V.S.Raja Raghava Rao Research Scholar Dr.K.Sreenivasulu Lab Dept.of Animal Sciences School of Life Sciences University of Hyderabad ypvsrrr(a)gmail.com 9989733698

1 0

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user September 2011