galaxy-user September 2011

galaxy-user@lists.galaxyproject.org

68 participants
65 discussions

How to use GATK Unified Genotyper with "A list of genomic intervals over which to operate" option
by Carlos Borroto 14 Sep '11

14 Sep '11

Hi, I would like to run "Unified Genotyper" on a region of a BAM file, I see the advance option "A list of genomic intervals over which to operate" exist and seems to be what I need. The problem is I only get a drop-down menu with the single option "Selection is optional", which I don't understand. Thanks, Carlos

2 1

Fwd: Help with sam to bam
by Austin Paul 14 Sep '11

14 Sep '11

Hi Zach, You should reply to all so people dont keep working on your questions. Glad to help. Austin ---------- Forwarded message ---------- From: Zachary A Lewis <zlewis(a)uga.edu> Date: Tue, Sep 13, 2011 at 3:10 PM Subject: Re: [galaxy-user] Help with sam to bam To: Austin Paul <austinpa(a)usc.edu> Thanks Austin! That did the trick. Zack On Sep 13, 2011, at 4:47 PM, Austin Paul wrote: You could try "fasta width formatter" on your reference fasta. This has helped me in the past when I received a similar error. On Tue, Sep 13, 2011 at 11:32 AM, Zachary A Lewis <zlewis(a)uga.edu> wrote: > Hi, > I was wondering if someone could help me with an error message I'm getting > after performing a sam to bam conversion in galaxy. I've used Bowtie to map > sequence reads to a custom fasta file corresponding to one chromosome in my > organism. The mapping seems to work fine, but when I attempt a sam to bam > conversion, I receive the folowing error message: > > An error occurred running this job: *Samtools Version: 0.1.12 (r862)* > *Error creating indexes from reference > (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] > line length exceeds 65535 in sequence 'LGVII'. > Segmentation fault* > * > * > Any help would be appreciated. > > Thanks, > > Zack > > > > ___________________________________________________________ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > >

2 1

Trinity
by David Joly 14 Sep '11

14 Sep '11

I want to run Trinity on the "test" instance of Galaxy, but there seems to be a problem. The analysis complete very quickly and I've got no assembled transcripts. In the log file created by Trinity, there is one line: /var/spool/torque/mom_priv/jobs/1204985.thumper.g2.bx.psu.edu.SC: 11: Trinity.pl: not found Any idea? David

2 1

Help with sam to bam (Zachary A Lewis)
by Pandey, Ashutosh 14 Sep '11

14 Sep '11

Message: 1 Date: Tue, 13 Sep 2011 18:32:43 +0000 From: Zachary A Lewis <zlewis(a)uga.edu> To: "galaxy-user(a)lists.bx.psu.edu" <galaxy-user(a)lists.bx.psu.edu> Subject: [galaxy-user] Help with sam to bam Message-ID: <AE8E036C-CBD3-46F9-B5A4-0615CD80610D(a)uga.edu> Content-Type: text/plain; charset="us-ascii" Hi, I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message: An error occurred running this job: Samtools Version: 0.1.12 (r862) Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'. Segmentation fault Any help would be appreciated. Thanks, Zack Hi Zack, I got a similar problem but I am not sure if you have the same problem. My problem was due to use of different chromosome symbol by reference fasta file and the SAM file. May be you are using "chr2" in SAM file and "2" in reference file or vice-versa. Converting chromosome symbol would be easy for reference fasta file. Thanks -Ash

2 1

How to clip multiple adapter sequences in Penn State Galaxy? Thank.
by Binbin You 14 Sep '11

14 Sep '11

Hi All, In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip. In addition, In "What it does" it shows: This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. So how could i do if I have the adapter sequences like this: 5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT 5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA 5' GACGGCATACGAGCTCTTCCGATCT 5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much for any response! Best wishes, Bin

2 1

MACs
by Keith Giles 13 Sep '11

13 Sep '11

Does anyone have advice on how to set the fdr threshold when using MACs in galaxy? Conversely, is there a way to learn what the fdr is for each peak that is called?

1 0

BFAST for SOLID paired end reads
by Candace Seeve 13 Sep '11

13 Sep '11

I am new to RNA-Seq and trying to map ABI SOLID paired-end reads. I've read that BFAST + BWA is a good program for this. I have found BFAST on the galaxy test site. Is it possible to map paired end reads using the BFAST version there? Could someone help me with this workflow? Thanks very much in advance.

2 1

Help with sam to bam
by Zachary A Lewis 13 Sep '11

13 Sep '11

Hi, I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message: An error occurred running this job: Samtools Version: 0.1.12 (r862) Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'. Segmentation fault Any help would be appreciated. Thanks, Zack

2 1

Downloading large files from galaxy
by David Matthews 13 Sep '11

13 Sep '11

Hi, I seem to be having problems downloading large files from galaxy - the request times out at about 1GB and I'm downloading 2-3GB. Am I doing something wrong? David

2 1

Installing Galaxy on my computer
by Jennifer Jackson 12 Sep '11

12 Sep '11

Hi, I am a new user of Galaxy. I want to analyze whole human exome data with Galaxy and cannot upload the files (10 Gb each) to the server. Should I install Galaxy on a PC, and work in Unix environment, or there is a more comfortable way? If I should install it - what should be the computer properties, and where can I find the instructions for using it? I found the instructions for installing in Wiki, but didn't find the what computer is should be (RAM, HD, etc). Thanks, Lilach

3 5

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user September 2011