Fwd: Help with sam to bam
by Austin Paul
Hi Zach,
You should reply to all so people dont keep working on your questions. Glad
to help.
Austin
---------- Forwarded message ----------
From: Zachary A Lewis <zlewis(a)uga.edu>
Date: Tue, Sep 13, 2011 at 3:10 PM
Subject: Re: [galaxy-user] Help with sam to bam
To: Austin Paul <austinpa(a)usc.edu>
Thanks Austin! That did the trick.
Zack
On Sep 13, 2011, at 4:47 PM, Austin Paul wrote:
You could try "fasta width formatter" on your reference fasta. This has
helped me in the past when I received a similar error.
On Tue, Sep 13, 2011 at 11:32 AM, Zachary A Lewis <zlewis(a)uga.edu> wrote:
> Hi,
> I was wondering if someone could help me with an error message I'm getting
> after performing a sam to bam conversion in galaxy. I've used Bowtie to map
> sequence reads to a custom fasta file corresponding to one chromosome in my
> organism. The mapping seems to work fine, but when I attempt a sam to bam
> conversion, I receive the folowing error message:
>
> An error occurred running this job: *Samtools Version: 0.1.12 (r862)*
> *Error creating indexes from reference
> (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core]
> line length exceeds 65535 in sequence 'LGVII'.
> Segmentation fault*
> *
> *
> Any help would be appreciated.
>
> Thanks,
>
> Zack
>
>
>
> ___________________________________________________________
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org. Please keep all replies on the list by
> using "reply all" in your mail client. For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
>
> http://lists.bx.psu.edu/listinfo/galaxy-dev
>
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
>
> http://lists.bx.psu.edu/
>
>
10 years, 11 months
Trinity
by David Joly
I want to run Trinity on the "test" instance of Galaxy, but there seems to
be a problem. The analysis complete very quickly and I've got no assembled
transcripts. In the log file created by Trinity, there is one line:
/var/spool/torque/mom_priv/jobs/1204985.thumper.g2.bx.psu.edu.SC: 11:
Trinity.pl: not found
Any idea?
David
10 years, 11 months
Help with sam to bam (Zachary A Lewis)
by Pandey, Ashutosh
Message: 1
Date: Tue, 13 Sep 2011 18:32:43 +0000
From: Zachary A Lewis <zlewis(a)uga.edu>
To: "galaxy-user(a)lists.bx.psu.edu" <galaxy-user(a)lists.bx.psu.edu>
Subject: [galaxy-user] Help with sam to bam
Message-ID: <AE8E036C-CBD3-46F9-B5A4-0615CD80610D(a)uga.edu>
Content-Type: text/plain; charset="us-ascii"
Hi,
I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message:
An error occurred running this job: Samtools Version: 0.1.12 (r862)
Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'.
Segmentation fault
Any help would be appreciated.
Thanks,
Zack
Hi Zack,
I got a similar problem but I am not sure if you have the same problem. My problem was due to use of different chromosome symbol by reference fasta file and the SAM file. May be you are using "chr2" in SAM file and "2" in reference file or vice-versa. Converting chromosome symbol would be easy for reference fasta file.
Thanks
-Ash
10 years, 11 months
How to clip multiple adapter sequences in Penn State Galaxy? Thank.
by Binbin You
Hi All,
In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip.
In addition, In "What it does" it shows: This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
So how could i do if I have the adapter sequences like this:
5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT
5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
5' GACGGCATACGAGCTCTTCCGATCT
5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much for any response!
Best wishes,
Bin
10 years, 11 months
MACs
by Keith Giles
Does anyone have advice on how to set the fdr threshold when using MACs in
galaxy? Conversely, is there a way to learn what the fdr is for each peak
that is called?
10 years, 11 months
BFAST for SOLID paired end reads
by Candace Seeve
I am new to RNA-Seq and trying to map ABI SOLID paired-end reads. I've read that BFAST + BWA is a good program for this. I have found BFAST on the galaxy test site. Is it possible to map paired end reads using the BFAST version there? Could someone help me with this workflow?
Thanks very much in advance.
10 years, 11 months
Help with sam to bam
by Zachary A Lewis
Hi,
I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message:
An error occurred running this job: Samtools Version: 0.1.12 (r862)
Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'.
Segmentation fault
Any help would be appreciated.
Thanks,
Zack
10 years, 11 months
Downloading large files from galaxy
by David Matthews
Hi,
I seem to be having problems downloading large files from galaxy - the request times out at about 1GB and I'm downloading 2-3GB. Am I doing something wrong?
David
10 years, 11 months
Installing Galaxy on my computer
by Jennifer Jackson
Hi,
I am a new user of Galaxy.
I want to analyze whole human exome data with Galaxy and cannot upload
the files (10 Gb each) to the server.
Should I install Galaxy on a PC, and work in Unix environment, or there
is a more comfortable way?
If I should install it - what should be the computer properties, and
where can I find the instructions for using it? I found the
instructions for installing in Wiki, but didn't find the what computer
is should be (RAM, HD, etc).
Thanks,
Lilach
10 years, 11 months
