Thanks for the quick reply. But yes, the groomer output was marked as fastqsanger. I changed to generic fastq and back and it didn't work either way. I only get the fasta files from my history as possible input files. However, using the local installation via command line seemed to work (fastx_clipper -a TGGAATTCTCGGGTGCCAAGG -l 15 -n -v -i s_1_sequence.txt -o s_1_sequence_clipped.txt)
--
Dr. Michael Walter
MFT Services
University of Tübingen
Calwerstr. 7
72076 Tübingen
Tel.: +49 7071 29 83210
Fax. + 49 7071 29 5228
web: www.mft-services.de
Confidentiality Note:
This message is intended only for the use of the named recipient(s) and may
contain confidential and/or proprietary information. If you are not the intended
recipient, please contact the sender and delete the message. Any unauthorized
use of the information contained in this message is prohibited.
-----Ursprüngliche Nachricht-----
Von: "Peter Cock"
p.j.a.cock@googlemail.com
Gesendet: 17.02.2011 11:44:01
An: "Michael Walter"
michael.walter@med.uni-tuebingen.de
Betreff: Re: [galaxy-user] FastX Clipper on FastQ data
>On Thu, Feb 17, 2011 at 10:06 AM, Michael Walter
>
michael.walter@med.uni-tuebingen.de wrote:
>>
>> Hi List,
>>
>> I have a couple of miRNA-Seq files (Illumina GAIIx, 29nt read length). These
>> reads contain differing amounts of 3' adapter sequences and therefore map
>> really badly to the human genome (with eland v2). Therefore, I'd like to use
>> the FastX clipper tool, which states that "This tool clips adapters from the
>> 3'-end of the sequences in a FASTA/FASTQ file." However, After uploading
>> my fastq files and converting it to Sanger format, the clipper does not accept
>> the fastq file as input. After converting it to fasta it works fine. However, the
>> mapping tools will only accept fastq files. So my question is, is there a way
>> to clip the adapter directly in the fastq file (we have a local installation of
>> galaxy, so I may also use command line options)?
>>
>> Thank you very much for your input,
>>
>> Mike
>
>Hi Mike,
>
>Is your input FASTQ file definitely marked as type fastqsanger (not just fastq)?
>
>The fasta_clipper.xml says it will take
>fasta,fastqsanger,fastqsolexa,fastqillumina and is
>(now) aware that it should use the -Q 33 switch on Sanger FASTQ, see:
>
https://bitbucket.org/galaxy/galaxy-central/src/default/tools/fastx_toolkit/...
>
>Notice however that it does not accept the generic "fastq" Galaxy
>format (which I think
>would also include color-space FASTQ).
>
>Peter