galaxy-user November 2010

galaxy-user@lists.galaxyproject.org

50 participants
51 discussions

Re: [galaxy-user] How to run a pipeline on many data sets ?
by Jennifer Jackson 04 Nov '10

04 Nov '10

Hello again, A Composite Datatype loaded into a history can be an input into a workflow in your instance: https://bitbucket.org/galaxy/galaxy-central/wiki/CompositeDatatypes Hopefully this helps! Thanks, Jen On 11/3/10 2:09 AM, Jean-François Dufayard wrote: > Hello Jennifer, > > Thanks a lot for you quick answer. > > We've already configured our Galaxy server, on an SGE cluster. There is > still work to do if I read well your wiki. > > But, sorry, I'm not sure to understand well your answer: > - So, there is actually no simple solution to run a pipeline on multiple > datasets (for example the whole contain of a directory) ? > - You suggest us to developpe a specific interface to do so ? > > Best regards, > > 2010/11/2 Jennifer Jackson <jen(a)bx.psu.edu <mailto:jen@bx.psu.edu>> > > Hello Jean-Francois, > > The Galaxy wiki describing production set up should help you to > develop a solution, but please let us know if you need more help. > > General: > http://bitbucket.org/galaxy/galaxy-central/wiki/Home -> > For tool developers and labs > > Specific: > http://bitbucket.org/galaxy/galaxy-central/wiki/Config/ProductionServer > > Best! > > Jen > Galaxy team > > > On 11/2/10 1:39 AM, Jean-François Dufayard wrote: > > Dear Galaxy users, > > I would like to do a quite simple operation, in theory: I've > configured > a Galaxy pipeline on a local Galaxy server (installed in a Sun Grid > Engine cluster), and I would like to run it on several datasets > (several > thousands, in a directory) and get result files in another > directory. > > With the web interface, using libraries or not, I didn't found > any solution. > > Does a simple solution exist ? Or anybody have experienced the same > problem ? > > Sincerely yours, > -- > Jean-François Dufayard > Research engineer - ARCAD project > CIRAD - Montpellier - France > > > > _______________________________________________ > galaxy-user mailing list > galaxy-user(a)lists.bx.psu.edu <mailto:galaxy-user@lists.bx.psu.edu> > http://lists.bx.psu.edu/listinfo/galaxy-user > > > -- > Jennifer Jackson > http://usegalaxy.org > > > > > -- > Jean-François Dufayard > Research engineer - ARCAD project > CIRAD - Montpellier - France -- Jennifer Jackson http://usegalaxy.org

3 2

Re: [galaxy-user] Tophat etc
by Jeremy Goecks 04 Nov '10

04 Nov '10

[cc'ing galaxy-user for informational and archival purposes] > > I ran your workflow on my SAM file (generated by BWA alignment). And > worked fine and looks good to my eye. > > But when I try to run Cufflinks on that data it gives the following error: > > "Error running cufflinks. The main output file is empty, there may be > an error with your input file or settings" > > Any thoughts? The problems you're seeing with Cufflinks may be due to your use of BWA and, consequently, a lack of splice junctions. Is there any particular reason that you're using BWA to map your RNA-seq data? BWA isn't appropriate for mapping RNA-seq data unless you make modifications to handle splice junction mapping; it would be difficult to make these modifications in Galaxy. There are mappers designed specifically for RNA-seq data; in Galaxy, you should generally use Tophat to map your RNA-seq data. I encourage you to try mapping your data with Tophat and seeing if that solves your problems. Thanks, J.

1 0

Tophat etc
by David Matthews 03 Nov '10

03 Nov '10

Dear Galaxy, Can you tell me which version of Tophat and Cufflinks is being used and whether the Tophat you have uses a GFF or GTF file to help it find splices (this is an option I believe)? Best Wishes, David __________________________________ Dr David A. Matthews Senior Lecturer in Virology Room E49 Department of Cellular and Molecular Medicine, School of Medical Sciences University Walk, University of Bristol Bristol. BS8 1TD U.K. Tel. +44 117 3312058 D.A.Matthews(a)bristol.ac.uk

3 3

problems accessing the sequences through genome browser
by pande 03 Nov '10

03 Nov '10

Dear Galaxy, I have some genomic intervals for the human genome and want to extract the same for the mouse.So, I used the MAF pairwise alignment tool. But, interestingly, the associated sequences are not to be found at all through the genome browser, for file that galaxy generated for me. Here are a few first alignments from the sample: ##maf version=1 a score=5002 s hg18.chr1 1820410 11 + 247249719 GGATCCAG-------ATG s mm9.chr4 769022 18 - 155630120 GAAACAAGGTGTTCCATG a score=20688 s hg18.chr1 2077163 10 + 247249719 TTTTCTTTTC s mm9.chr4 969004 10 - 155630120 CTTTCTTACC a score=15289 s hg18.chr1 2316453 90 + 247249719 CTCAGGTGAATTCCTCATGGCATCACAGCAGTGTTGAAA-----TAGGAGCAGATACG-TTACCTCCGC--TTGCCAGATAAGAAACTGGGACGCAGA s mm9.chr4 1172933 98 - 155630120 TTACAGTGAATTCTGCCTGGGATCCGTGCAGCATTGGAAATGGCTAGGGGCAGATAGGGTCACCTTCACAGTTGCTAGATAAGAAACAGGGTCGCGGA a score=20716 s hg18.chr1 2526225 31 + 247249719 CTTCCT-CTGGGCTTGGTCATCCTTCAAAGTC s mm9.chr4 1369046 32 - 155630120 CTTCCTCCTGGTCCCAACCATCTGTCAGATCC I just want the sequences from the mouse genome and extended up to 120 base pairs from the co-ordinate mentioned in the maf file. It only generates NNNNNNNNNNNNN....I was wondering how could Galaxy retrieve it, while I can't see the same in the genome browser. Kindly help. Amit.

3 3

installation problem
by Wei,Xintao 03 Nov '10

03 Nov '10

Dear Sir., We are going to install Galaxy local server on our Windows PC. Are there any requirements for the hardware, for example the size of CUP or other things, in order to run Galaxy smoothly? Thank you! Xintao

2 1

Manage Jobs tool Error
by Sonali Thakur 03 Nov '10

03 Nov '10

Hello, We recently pulled the latest changes from the galaxy repository in to our new server Our configuration is we have 1 jobrunner and 3 webservices. While running Manage Jobs tool under Admin I encountered traceback error and fix the same following your changeset 4461:8cc9544dd81d Added 2 lines in controller.py if not trans.app.config.get_bool( "enable_job_running", True ): return trans.show_error_message( 'This Galaxy instance is not configured to run jobs. If using multiple servers, please directly access the job running instance to manage jobs.' ) Now after the change I am getting the error message which you have caught as an exception "This Galaxy instance is not configured to run jobs. If using multiple servers, please directly access the job running instance to manage jobs" Can we use Manage Jobs tool using 1 jobrunner and 3 webservices configuration? Thanks in advance. Regards -Sonali

2 1

installation problem
by Wei,Xintao 03 Nov '10

03 Nov '10

Dear Sir., We are going to install local galaxy server on our Windows PC. Is there any requirement for the hardware, for example the size of the CPU or other things, in order to run Galaxy smoothly? Thank you very much! Xintao

1 0

Re: [galaxy-user] bug
by Jennifer Jackson 02 Nov '10

02 Nov '10

Hello again - The only requirement is that you need Flash. Some things to try/check to troubleshoot the local problem are 1) reboot to clear any old links 2) try an alternate browser 3) double check that flash is not blocked by your institution. For the data, the tools in "NGS: SAM Tools" can create a summary pile-up and perform indel analysis of the lastz mapping results. The genome mapped intervals can also be used as input into many other tools to cluster, obtain overlapping genome annotation, etc. We are not sure exactly what analysis you want to do, but if you have trouble locating a tool for a particular task, please feel free to write back to the galaxy-user(a)bx.psu.edu mailing list. Hopefully this help can get you going! Jen Galaxy team On 11/2/10 4:25 AM, vaibhav jain wrote: > Hi, > Thanks for the prompt reply. Yes I am using the same link which you have > mentioned. Error is something related to stream not found. I can't > copy-paste the exact error, I just tried right now also while writing > out this mail to you and still same problem coming. > One more thing I want to know, after mapping the reads on the reference > sequence using lastz tool, how to retrieve a whole contig sequence or > say a consensus, sequences that I am getting using Lastz are > sub-sequences with different mapping identity, so is there any way to > generate a consensus or contig sequence from those so many sequences. > > Vaibhav Jain > Project Assistant > Bioinformatician @IGIB > Delhi, INDIA > > --- On *Mon, 11/1/10, Jennifer Jackson /<jen(a)bx.psu.edu>/* wrote: > > > From: Jennifer Jackson <jen(a)bx.psu.edu> > Subject: Re: [galaxy-user] bug > To: "vaibhav jain" <write_to_vjain(a)yahoo.com> > Cc: "galaxy-user" <galaxy-user(a)lists.bx.psu.edu> > Date: Monday, November 1, 2010, 11:52 PM > > Hello - > > This is the best screencast for 454 data. Would you have time to send > the exact error message? Also please confirm that you are accessing > from > this location: > http://usegalaxy.org/screencast > > Thanks, > > Jen > Galaxy team > > > On 11/1/10 7:34 AM, Jennifer Jackson wrote: > > > > > > On 10/31/10 11:57 PM, vaibhav jain wrote: > >> Hi all, > >> I want to see the screen cast*Processing and analysis of 454 data in > >> metagenomic studies > >> > <http://screencast.g2.bx.psu.edu/galaxy/flash/mg_screencast_1.html>, but > >> there is a bug in this video as there is some error coming, > every time I > >> play the video. I wanted to see the video as I have a 454 data > and want > >> to do the analysis on it. Also is there any tutorial available > for using > >> Lastz mapping tool, which is meant for 454 data. > >> > >> * > >> Vaibhav Jain > >> Project Assistant > >> Bioinformatician @IGIB > >> Delhi, INDIA > >> > >> > > > > -- > Jennifer Jackson > http://usegalaxy.org > > -- Jennifer Jackson http://usegalaxy.org

1 0

Create workflow with a fixed dataset from data library/history
by Jelle Scholtalbers 02 Nov '10

02 Nov '10

Hi, I was unable to find if this was asked before, but I have the 'problem' that I want to create a workflow for a specific project. This worklow I want to reuse a couple of times but some of the datasets will always be the same and a few have to be set each time the workflow is run. The way I would like to deal with this is to include datasets from a data library, which are already shared and visible to others. This ensures that the workflow is run with the correct main datasets. Instead of a datalibrary dataset this could also be done by linking it to a history item, which might be more flexible. Is this already possible or else already in the feature requests? :) Cheers, Jelle

1 0

Comparative analysis
by Kevin S Lang 01 Nov '10

01 Nov '10

I need to compare genome sequences of several Salmonella enterica serovars. I will be looking for regions of insertions and deletions between the strains. As well as SNPs comparisons in certain genes. Is Galaxy a good tool to use for this? -K -- Kevin Lang Junior Scientist Singer Lab of Epidemiology University of Minnesota Dept of Veterinary BioScience Lab# 612-625-9266 Cell# 612-385-5410

2 1

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user November 2010