galaxy-user September 2010

galaxy-user@lists.galaxyproject.org

43 participants
36 discussions

galaxy user PAGES
by Bossers, Alex 27 Sep '10

27 Sep '10

Hi All, Our local instance of galaxy is working fine (galaxy_dist version). I tried enabling PAGES by including enable_pages = True in the universe_wsgi.ini file first in the beta section which gave me problems. Searching the wiki and user forum indicates the enable statement should be in the [app::main] section, so I did. No luck either and same error as below. I do get a SAVED PAGES option (instead of PAGES option as described in the wiki) under USER menu where I can create pages and see them listed. But when I select edit contents I only get an empty box at the top left of the page editor and a script error (below attached) on ie8. Do I miss some prerequisite for PAGES to work correctly? Or is this an ie8 generic problem since I just checked in firefox and it seems to work. IE8 is unfortunate our embedded/default company web browser. Any help appreciated. Alex ---------Script error of the page --------------- Errordetails webpagina Gebruikersagent: Mozilla/4.0 (compatible; MSIE 8.0; Windows NT 6.1; WOW64; Trident/4.0; SLCC2; .NET CLR 2.0.50727; .NET CLR 3.5.30729; .NET CLR 3.0.30729; Media Center PC 6.0; .NET4.0C; InfoPath.3) Tijdstempel: Mon, 27 Sep 2010 08:00:35 UTC Message: Id, string or number expected Line: 100 Char: 5 Code: 0 URI: http://galaxy01:8080/page/edit_content?id=f2db41e1fa331b3e Message: Id, string or number expected Line: 761 Char: 13 Code: 0 URI: http://galaxy01:8080/page/edit_content?id=f2db41e1fa331b3e

2 1

Scaling - what should happen with universe_wsgi.ini
by Jelle Scholtalbers 22 Sep '10

22 Sep '10

Hi, Recently I followed the guide on http://bitbucket.org/galaxy/galaxy-central/wiki/Config/WebApplicationScaling. So I created two ini files, one for the web apps and 1 for the runner. Now is my question, what purpose does the universe_wsgi.ini serve. As I found out yesterday is that this ini is still used by the manage_db.sh script.. I never updated this universe_wgsi.ini file, although I moved to another database. So this script updated the wrong database.. error on my side I guess, but should I really keep 3 universe_wsgi files? And if so, what should be in which, as I now have most of the parameters in all three ini files.. Cheers, Jelle

2 1

Galaxy 'active' users
by Erick Antezana 22 Sep '10

22 Sep '10

Hi, is there a way to check whether my Galaxy instance is being used (logged in/working)? (another way than "tail-ing" the paster.log file). thanks, Erick

2 1

running R in Galaxy
by Bree, Freddy de 21 Sep '10

21 Sep '10

I've been trying to run R in Galaxy. 1. Running it as "R" is a hassle, because Galaxy cannot deal with source and input file and output file using "--args" and "<" (< in xml) and ">" (> in xml). 2. Running it through "perl" is also a hassle, because Galaxy needs to have an input file through the cmd line, whilst "R" needs: - input file (the location of it, not the content) - source file (.R file) - output file BUT you need to pipe -this- input for perl through to R VIA the system() call. Anybody any luck with this? (everything runs without Galaxy btw, but that is not the aim) Freddy

4 3

Re: [galaxy-user] running R in Galaxy
by Bree, Freddy de 21 Sep '10

21 Sep '10

Thanks again! This solves it I think. I re-directed this to galaxy-user, because it is clear that some of you do not know this either. ;) ________________________________________ From: James Taylor [james(a)jamestaylor.org] Sent: 21 September 2010 13:21 To: Bree, Freddy de Subject: Re: [galaxy-user] running R in Galaxy Yes, tools/stats/r_wrapper.sh On Sep 21, 2010, at 7:16 AM, Bree, Freddy de wrote: > Thanks for the tip, but do you mean in Galaxy? > > ________________________________________ > From: James Taylor [james(a)jamestaylor.org] > Sent: 21 September 2010 13:06 > To: Bree, Freddy de > Cc: galaxy-user(a)lists.bx.psu.edu > Subject: Re: [galaxy-user] running R in Galaxy > > On Sep 21, 2010, at 5:30 AM, Bree, Freddy de wrote: > >> 1. Running it as "R" is a hassle, because Galaxy cannot deal with >> source and input file and output file using "--args" and >> "<" (< in xml) and ">" (> in xml). > > We use a small shell script called r_wrapper.sh which is included in > the distribution.

1 0

Re: [galaxy-user] running R in Galaxy
by Bree, Freddy de 21 Sep '10

21 Sep '10

Dear all, In addition tot he previous. I can feed the source file (Rfile) and the data file to the system() call for R, but how do I capture the output back in perl? Freddy

1 0

Galaxy FASTA tool - Bug
by gireesh bogu 19 Sep '10

19 Sep '10

Dear Galaxy I found a bug in extracting FATSA sequence tool in galaxy. I extracted sequence of this location chr10 123229360 123229525 fgfr2 0 - >hg18_chr10_123229360_123229525_- GAATACTTGGACCTCAGCCAACCTCTCGAACAGTATTCACCTAGTTACCC TGACACAAGAAGTTCTTGTTCTTCAGGAGATGATTCTGTTTTTTCTCCAG ACCCCATGCCTTACGAACCATGCCTTCCTCAGTATCCACACATAAACGGC AGTGTTAAAACATGA And I checked back in UCSC browser by pasting the same location. The sequences are completely different (hg18). Could you please help me in this issue Thanx Gireesh

6 8

Re: [galaxy-user] mapping with fasta files
by Kelly Vincent 17 Sep '10

17 Sep '10

> > Hello, > > Yes, you can generate a FASTQ file with dummy quality scores from a > FASTA file. Use the Combine FASTA and QUAL into FASTQ tool under > NGS: QC and manipulation-->ROCHE-454 DATA. For the Quality Score > File, leave it set with the default option ("Selection is > Optional"). The quality value will be ~ for each base > > Regards, > Kelly > > > On Sep 17, 2010, at 4:10 PM, Ada Sedova wrote: > >> Dear galaxy, >> I have some sequence data that is in fasta format, and I would >> really like to run bowtie on it for mapping. The bowtie article >> claims that bowtie can map with fasta files, but galaxy does not >> allow it. Is there anything I can do to fix this? For instance, is >> there a way to add some kind of q values to the file so it will run? >> Thanks >> _______________________________________________ >> galaxy-user mailing list >> galaxy-user(a)lists.bx.psu.edu >> http://lists.bx.psu.edu/listinfo/galaxy-user >

1 0

mapping with fasta files
by Ada Sedova 17 Sep '10

17 Sep '10

Dear galaxy, I have some sequence data that is in fasta format, and I would really like to run bowtie on it for mapping. The bowtie article claims that bowtie can map with fasta files, but galaxy does not allow it. Is there anything I can do to fix this? For instance, is there a way to add some kind of q values to the file so it will run? Thanks

1 0

Solid 2 Fastq
by juan perin 15 Sep '10

15 Sep '10

I'm getting errors in running our solid to fastq conversion tool. I'm not sure why, we have sqlite installed... This is the error. Perhaps i'm overlooking another dependency? Traceback (most recent call last): File "/home/perin/galaxy/galaxy-dist/tools/next_gen_conversion/solid2fastq.py", line 7, in ? import sqlite3 ImportError: No module named sqlite3 Thanks in advance. Juan

2 1

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user September 2010