galaxy-user February 2011

galaxy-user@lists.galaxyproject.org

70 participants
85 discussions

CuffDiff gene fpkm tracking file- Sorry! I sent only a part of my email
by Samuele Gherardi 03 Feb '11

03 Feb '11

Hello everybody, I'm quite new in NGS world, I'm trying to analize dome RNA-seq data. I followed the workflow through tophat,cufflink,cuffcompare and cuffdiff I suppose everything work fine but in the Cuffdiff gene fpkm file the column Class_Code is empty and i don't know why? this is an example of my CuffDiff gene fpkm tracking file. tracking_id class_code nearest_ref_id gene_short_name tss_id locus q1_FPKM q1_conf_lo q1_conf_hi q2_FPKM q2_conf_lo q2_conf_hi XLOC_000001 - - MT-ND5 - chrM:0-16571 12484.2 12260.8 12707.7 11447 11233.1 11661 XLOC_000002 - - USP14 TSS1,TSS2,TSS3 chr18:148586-236453 16.7235 9.41244 24.0346 19.437 11.7368 27.1371 XLOC_000003 - - SMCHD1 TSS10,TSS11,TSS12,TSS4,TSS5,TSS6,TSS7,TSS8,TSS9 chr18:2719322-2728540 28.2493 17.5093 38.9892 27.2263 16.6263 37.8262 XLOC_000004 - - EMILIN2 TSS13,TSS14 chr18:2880607-2882469 3.98118 0 7.99721 4.62875 0.278519 8.97899 I this is normal, how can I find the class code of transcript listed in the CuffDiff gene expression file? thank you in advance Samuele.

1 0

have fsatq ... but don't know input format for groomer?
by Johnson, Kory (NIH/NINDS) [C] 02 Feb '11

02 Feb '11

Hello, My account login is: johnsonko(a)ninds.nih.gov<mailto:johnsonko@ninds.nih.gov> I am a first time Galaxy user. I have uploaded my sequences as format "fastq" into Galaxy and would like to next use "Groomer" to output Sanger fastq format so to go on with exploring quality via box plot, deciding on a trim length (if any), and map to genome using bwa or bowtie. However, I am running into a problem using "Groomer". I do not know what format my sequences are per setting the required input parameter. An example of my sequences is as follows: @SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA +SNPSTER6_0679:1:1:1083:939#0/1 BIQQIQQQTP[[[[[VVVVQPPPPPTWWWW[[YYTTTOVV____TWVXRWPTQPQWWWWWTOOVV___V_TROOWTWTWTQWQWTTRWRO ... how to tell if you have: "Sanger", "Solexa", "Illumina 1.3+", etc. I have tried to submit to "Groomer" different times using these options one at a time and none return with results. Need help please. Also, what is the expected time for "Groomer" to return results for a file containing 2.7 million reads. Thank you ... best, Kory -------------------------------------------- Kory R. Johnson, MS, PhD Sr. Bioinformatics Scientist [cid:image001.jpg@01CBC2E0.B2CEC7F0] www.kellygovernmentsolutions.com Providing Contract Services For: Bioinformatics Section, Information Technology & Bioinformatics Program, Division of Intramural Research (DIR), National Institute of Neurological Disorders & Stroke (NINDS), National Institutes of Health (NIH), Bethesda, Maryland Mailing Address: NINDS/NIH Clinical Center (Building 10) Office 5S223 9000 Rockville Pike Bethesda, MD 20892 Contact Information: Phone: 301-402-1956 Fax: 301-480-3563 email: johnsonko(a)ninds.nih.gov P Green Message: Please consider the environment before printing this e-mail. Thank you. Important Message: This electronic message transmission contains information intended for the recipient only. Such that, the information contained herein may be confidential, privaledged, or proprietary. If you are not the intended recipient, be aware that any disclosure, copying, distribution, or use of this information is strictly prohibited. If you have received this electronic information in error, please notify the sender immediately by telephone. Thank you. --------------------------------------------

2 1

Workflows with parameters
by Florent Angly 02 Feb '11

02 Feb '11

Hi, I was talking about the Galaxy workflow with someone recently. He pointed out an "obvious" limitation of the workflows that I never realized before. So I thought I'd ask the team if any work is planned in this direction: In a workflow, the only part that is dynamic and configurable by the workflow user is the input files at the moment. I think it would be nice to allow setting parameters for some specific workflow steps. For example, say that my workflow involves running Megablast, as a workflow designer, I would be able to tick a box that makes the "word size" input be changed by the user when he runs the workflow. What do you think? Does this feature already exist? Are there plans to implement it? Regards, Florent

2 2

Python error when running Bowtie for Illumina
by Weng Khong Lim 01 Feb '11

01 Feb '11

Hi all, I'm new to next-gen sequencing, so please be gentle. I've just received a pair of Illumina FASTQ files from the sequencing facility and intend to map them to the hg19 reference genome. I first used the FASTQ Groomer utility to convert the reads into Sanger reads. However, when running Bowtie for Illumina on the resulting dataset under default settings, I received the following error: An error occurred running this job: *Error aligning sequence. requested number of bytes is more than a Python string can hold* * * Can someone help point out my mistake? My history is accessible at http://main.g2.bx.psu.edu/u/wengkhong_lim/h/chip-seq-pilot-batch Appreciate the help! Weng Khong, LIM Department of Genetics University of Cambridge E-mail: wkl24(a)cam.ac.uk Tel: +447503225832

4 3

March 2011 GMOD Meeting: Registration is open
by Dave Clements 01 Feb '11

01 Feb '11

Hello all, Registration is now open for the March 2011 GMOD Meeting ( http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting). This meeting is part of GMOD Americas 2011, an event that includes a day of Satellite Meetings, a GMOD Course (ialready full), and for the first time, an "Introduction to GMOD" session the night before the meeting for GMOD newcomers. GMOD Americas 2011 events are being held at the US National Evolutionary Synthesis Center (NESCent) in Durham, North Carolina, United States. As with previous GMOD meetings, this meeting will have a mixture of project talks, component talks, and user talks. Our guest speaker is Dr. Eric Stone of North Carolina State University. Dr. Stone will talk about his experience on the "Drosophila Genome Reference Panel," a project that is sequencing 192 lines. See http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda for more. The agenda is driven by attendee suggestions, and you are encouraged to add your suggestions now ( http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda_Proposals). For examples of what happens at a GMOD meeting, see the writeup of the September 2010 GMOD Meeting (http://gmod.oicr.on.ca/wiki/September_2010_GMOD_Meeting), or any previous meeting. GMOD meetings are an excellent way to meet GMOD developers and users and to learn (and affect) what's coming in the project. Registration for the March 2011 GMOD Meeting is $80 on or before February 18 <<<<======= $95 after February 18 Please register early, both to save money, and ensure a spot. You are also strongly encouraged to sign up for (or propose) a Satellite Meeting (more details to come). Details on transportation, suggested lodging, and other logistics are on the GMOD Americas 2011 page. This meeting, and all GMOD Americas 2011 events, are jointly sponsored by NESCent and the Galaxy Project. Dave Clements Galaxy Project -- http://gmod.org/wiki/GMOD_Americas_2011 http://nescent.org http://usegalaxy.org/ http://getgalaxy.org

1 0

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user February 2011