December 2012 - galaxy-user - lists.galaxyproject.org

How to display data at UCSC main?
by Anna Vilborg 21 Dec '12

21 Dec '12

Dear mailing list, I am new to Galaxy and am going through the tutorials, starting with Galaxy 101. Under point 2.5. "Recovering exon info and displaying data in genome browsers" in the tutorial, there is the option to display data at UCSC. However, I don't have this option, although my history looks otherwise identical to the tutorial one (I am using hg19 as does the tutorial). I can display my data at Ensembl. Does anyone now why I don't get the UCSC option? Best Regards Anna Vilborg

3 2

Galaxy December 20, 2012 Distribution & News Brief
by Jennifer Jackson 20 Dec '12

20 Dec '12

*Galaxy Dec 20, 2012 Distribution & News Brief <http://wiki.galaxyproject.org/News/2012_12_20_DistributionNewsBrief>* *Complete News Brief <http://wiki.galaxyproject.org/DevNewsBriefs/2012_12_20>* *Highlights:* * *Required Metadata Reset* for instances running *Tool Shed <http://wiki.galaxyproject.org/Tool%20Shed>* repositories. Be sure to *learn how <http://wiki.galaxyproject.org/ResettingMetadataForInstalledRepositories>*. * *Simplified tool config*: all tools (including tool shed repos) can now have handlers and runners assigned based on their "short id". * *New* GFF <http://wiki.galaxyproject.org/Learn/Datatypes#GFF>/GFF3 <http://wiki.galaxyproject.org/Learn/Datatypes#GFF3> annotation support for *Cuffcompare/merge/diff <http://cufflinks.cbcb.umd.edu/manual.html>*. * *More Updated* tools: *TopHat2 <http://tophat.cbcb.umd.edu/manual.html>*, *Bowtie2 <http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml>*. * *Multiple pull-requests* contributed by community (thanks!): *#83 <https://bitbucket.org/galaxy/galaxy-central/pull-request/83/allow-a-datatyp…>*, *#85 <https://bitbucket.org/galaxy/galaxy-central/pull-request/85/another-round-o…>*, *#90 <https://bitbucket.org/galaxy/galaxy-central/pull-request/90/patch-to-make-e…>*, *#91* <https://bitbucket.org/galaxy/galaxy-central/pull-request/91/fixing-missing-…>. * *Issue tracking help* is now covered in detailed in our new wiki: *Using the Galaxy Issue Board <http://wiki.galaxyproject.org/Issues>* * *GCC2013 Training Day Topic Nominations <http://wiki.galaxyproject.org/Events/GCC2013/TrainingDay> are now open* through /*January 11th*/ <http://wiki.galaxyproject.org/Events/GCC2013/KeyDates> * *Plus* more *Tool Shed <http://wiki.galaxyproject.org/Tool%20Shed>* updates, *Bug Fixes*, and improvements to *Trackster, UI, Libraries, and Histories*. * getgalaxy.org <http://getgalaxy.org>* *bitbucket.org/galaxy/galaxy-dist <http://bitbucket.org/galaxy/galaxy-dist>* *galaxy-dist.readthedocs.org <http://galaxy-dist.readthedocs.org> * new: $ hg clone http://www.bx.psu.edu/hg/galaxy galaxy-dist upgrade: $ hg pull -u -r 36ad8aa7b922 *Best wishes for a safe and happy holiday*, /*The Galaxy Team <http://wiki.galaxyproject.org/Galaxy%20Team>*/ -- Jennifer Jackson http://galaxyproject.org

1 0

galaxy cloudman login and aws instance
by Sun, Wenping [USA] 20 Dec '12

20 Dec '12

Dear galaxy members, I have question on galaxy running on cloud with the issue of authorization matter. I have launched aws galaxy cloudman instances to work with, shutting down the cluster afterwards. Then the 2nd time here are the steps that I did- 1. Launch the galaxy at cloudlaunch site 2. Register and then log in 3. Worked with data uploading and processing (the login information can see from pull-down menu), as well as the data history [cid:image001.jpg@01CDDEAF.44EBA770] 4. Go to aws console to check, find the instance is running 5. Copy the dns site followed by /cloud to check the cluster nodes, click "access galaxy" button there 6. On the galaxy window choose user login 7. And here is the window I have - I cannot login and no history data there. [cid:image002.jpg@01CDDEAF.44EBA770] My question: it seems that the two galaxy access is not the same. I rather to use the site from cloudlaunch site if it is preferred. However, I still have to go to the instance DNS site for shutting down the instance/cluster to avoid aws unnecessary charge. And, if I need to add cluster nodes, I still need to go to the DNS site. What is the appropriate procedure I need to follow to retain the data history and log in between two accesses, especially while shutting down and restart? I really appreciate your inputs and helps! Kind regards, Kathryn

2 9

upload workflow on cloudman
by Sun, Wenping [USA] 19 Dec '12

19 Dec '12

Dear galaxy users, I tried to follow the instruction to see how the workflow worked by using the one on the support site Galaxy-Workflow-mt_analysis_0.01_strand-specific_(fastq_double).ga However, it takes very very long time and remains the following state for several hours. Is this normal? I set up 100gb for cluster and added 4 nodes same as the demo. [cid:image001.jpg@01CDDDF2.58691C00] Thank you very much! Kathryn

1 0

add publicly available genomes?
by Camilla Nesbo 19 Dec '12

19 Dec '12

Heia, Would it be possible to add the genome of Kosmotoga olearia (NC_012785) and Mesotoga prima (NC_017934) to the genomes availabe in galaxy database? Thanks, Camilla -- Camilla L. Nesbø University of Alberta Biological Sciences 116 street and 85 Avenue Edmonton, Alberta T6G2R3 +1 780 604 3080 and CEES, Dept. of Biology, University of Oslo P.O. Box 1066 Blindern NO-0316 Oslo Norway

2 1

question on galaxy reference genome window
by Sun, Wenping [USA] 19 Dec '12

19 Dec '12

Dear Galaxy members, I am new to galaxy and just installed galaxy on aws cloud. I am testing how it works and have the following question below: 1. I tried to test bowtie2 with the dataset I uploaded, however, the window for reference genome is very narrow and nothing from pull-down menu can be selected. When I omit that option to execute bowtie2, galaxy give error message for requesting reference genome. I am using hg19, should I upload myself? If so, how? 2. Same error happen for me to run fastqc --- the reference genome selection window is way too narrow and nothing can be selected Thank you very much for your inputs and helps! Kind regards, Kathryn

2 3

Error in TopHat
by Sachit Adhikari 19 Dec '12

19 Dec '12

This is the error I am getting while running Tophat. What's causing this? I have the default hg19 index files. Error in tophat: [Tue Dec 18 10:08:33 2012] Beginning TopHat run (v1.3.3) ----------------------------------------------- [Tue Dec 18 10:08:33 2012] Preparing output location ./tophat_out/ [Tue Dec 18 10:08:33 2012] Checking for Bowtie index files Error: Could not find Bowtie index files /opt/galaxyprod/galaxy-dist/data/hg19/hg19,/data/bowtie2-2.0.2/hg19.* TopHat v1.3.3 TopHat v1.3.3 tophat -p 4 /opt/galaxyprod/galaxy-dist/data/hg19/hg19,/data/bowtie2-2.0.2/hg19 /opt/galaxyprod/galaxy-dist/database/files/000/dataset_45.dat

1 1

How to Provide .gtf file to tophat2
by greg 18 Dec '12

18 Dec '12

I'm trying to translate this command line run into the Galaxy GUI but I'm not seeing a place to specify the .gtf file. Does anyone know? tophat2 -p 8 -G /groups/bowtie2_index/mRNA.gtf -o /groups/hp_1 /groups/genome /groups/reads.fastq thanks, Greg

2 2

Re: [galaxy-user] cufflinks analysis using .bam files generated by LifeScope (ABI 5500 Sequencer)
by Jennifer Jackson 18 Dec '12

18 Dec '12

Hello Davide, If the data does represent alignments (not just sequence), then there is one more item to check for. Another team member reminded me that Cufflinks requires an "XS" custom tag in an input SAM file (or any compressed BAM file that represents it). Details are here from the Cufflinks manual: http://cufflinks.cbcb.umd.edu/manual.html#cufflinks_input : -- Cufflinks takes a text file of SAM alignments, or a binary SAM (BAM) file as input. For more details on the SAM format, see the specification <http://samtools.sourceforge.net/SAM1.pdf>. The RNA-Seq read mapper TopHat <http://tophat.cbcb.umd.edu/> produces output in this format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here's an example of an alignment Cufflinks will accept: s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \ CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:- Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it *must* be present for all spliced alignment records (those with a 'N' operation in the CIGAR string). This should be fairly easy to check for now that the data is in uncompressed SAM format. Running the pipeline starting with Tophat may be the best choice. If you using the public Main server and have continued problems not covered in our tutorial/FAQ, a bug report can be submitted from error datasets: http://wiki.galaxyproject.org/Support#Reporting_tool_errors Hopefully this helps, Jen Galaxy team On 12/17/12 11:46 PM, Davide Degli Esposti wrote: > Dear Jen, > > Thank you very much for your help. As you mentioned, it seems likely a > problem of the input. I tried to transform the bam file in sam at your > Galaxy site and then to run cufflinks and I have got the three output > files. Do you think it is an acceptable way to avoid the obstacle? I > am going to perform some controls checking for the results obtained > from other methods. > > Thank you again for your help > Best, > > davide > --- > Davide Degli Esposti, PhD > Epigenetic (EGE) Group > International Agency for Research on Cancer > Tel. +33 4 72738036 > Fax. +33 4 72738322 > 150, cours Albert Thomas > 69372 Lyon Cedex 08 > France > ------------------------------------------------------------------------ > *From:* Jennifer Jackson [jen(a)bx.psu.edu] > *Sent:* Tuesday, December 18, 2012 2:53 AM > *To:* Davide Degli Esposti > *Cc:* galaxy-user(a)lists.bx.psu.edu > *Subject:* Re: [galaxy-user] cufflinks analysis using .bam files > generated by LifeScope (ABI 5500 Sequencer) > > Hello Davide, > > The fact that you are not getting any error points to some problem > with the input. Perhaps you are sending just sequence data in BAM > format to Cufflinks, without any alignment performed first? Some sort > of error would be expected for most other cases, but this is not the > Galaxy server our team hosts, it is difficult to state exactly what > the issue may be, just offer suggestions. > > Tophat will require fastq files as input, unless this alternate Galaxy > site has a modified wrapper. Then the alignments generated by Tophat > (or another alignment tool, sometimes Bowtie is used) in BAM format > are the input to Cuffinks (along with other optional data). > > If your data are aligned BAM, and you continue to have problems with > this alternate Galaxy site, it would be best to contact the group that > runs it - the information is on their home page (middle panel) when > you follow the url. > > You could also decide to use the public Galaxy instance run by our > core project team at http://usegalaxy.org, if we have the tool set you > wish to use. A generalized tutorial for RNA-seq analysis is available > here: > http://main.g2.bx.psu.edu/u/jeremy/p/galaxy-rna-seq-analysis-exercise > And some troubleshooting help here: > http://wiki.galaxyproject.org/Support#Tools_on_the_Main_server > > The tool author's original documentation would be good to review as well: > http://tophat.cbcb.umd.edu > http://cufflinks.cbcb.umd.edu > > Best, > > Jen > Galaxy team > > > On 12/13/12 11:47 AM, Davide Degli Esposti wrote: >> Hello, >> >> I am new in using Galaxy and I am working on .bam files generated by >> our sequencing platform, using the LifeScope software associated to >> ABI 5500 sequencer. I uploaded my files on a galaxy browser ( >> http://galaxy.raetschlab.org) and I tried to run cufflink assemble >> and quantify reads expression levels for each file. However, when I >> run cufflinks (using default parameters) the output is an empty file. >> What is going wrong? Should I use special parameters? Are the .bam >> files generated by LifeScope suitable for cufflink analysis or should >> I transform the xsq ABI output in a fastq and then apply TopHat? >> >> I thank you very much for your help >> >> Davide >> >> --- >> Davide Degli Esposti, PhD >> Epigenetic (EGE) Group >> International Agency for Research on Cancer >> Tel. +33 4 72738036 >> Fax. +33 4 72738322 >> 150, cours Albert Thomas >> 69372 Lyon Cedex 08 >> France >> >> / >> >> >> ------------------------------------------------------------------------------------------------ >> This message and its attachments are strictly confidential. If you >> are not >> the intended recipient of this message, please immediately notify the >> sender >> and delete it. Since its integrity cannot be guaranteed, its content >> cannot >> involve the sender's responsibility. Any misuse, any disclosure or >> publication >> of its content, either whole or partial, is prohibited, exception >> made of >> formally approved use. >> ------------------------------------------------------------------------------------------------/ >> >> >> >> >> ___________________________________________________________ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ > > -- > Jennifer Jackson > http://galaxyproject.org > > / > > > ------------------------------------------------------------------------------------------------ > This message and its attachments are strictly confidential. If you are not > the intended recipient of this message, please immediately notify the > sender > and delete it. Since its integrity cannot be guaranteed, its content > cannot > involve the sender's responsibility. Any misuse, any disclosure or > publication > of its content, either whole or partial, is prohibited, exception made of > formally approved use. > ------------------------------------------------------------------------------------------------/ > > -- Jennifer Jackson http://galaxyproject.org

1 0

cufflinks analysis using .bam files generated by LifeScope (ABI 5500 Sequencer)
by Davide Degli Esposti 17 Dec '12

17 Dec '12

Hello, I am new in using Galaxy and I am working on .bam files generated by our sequencing platform, using the LifeScope software associated to ABI 5500 sequencer. I uploaded my files on a galaxy browser ( http://galaxy.raetschlab.org) and I tried to run cufflink assemble and quantify reads expression levels for each file. However, when I run cufflinks (using default parameters) the output is an empty file. What is going wrong? Should I use special parameters? Are the .bam files generated by LifeScope suitable for cufflink analysis or should I transform the xsq ABI output in a fastq and then apply TopHat? I thank you very much for your help Davide --- Davide Degli Esposti, PhD Epigenetic (EGE) Group International Agency for Research on Cancer Tel. +33 4 72738036 Fax. +33 4 72738322 150, cours Albert Thomas 69372 Lyon Cedex 08 France ----------------------------------------------------------------------- This message and its attachments are strictly confidential. If you are not the intended recipient of this message, please immediately notify the sender and delete it. Since its integrity cannot be guaranteed, its content cannot involve the sender's responsibility. Any misuse, any disclosure or publication of its content, either whole or partial, is prohibited, exception made of formally approved use -----------------------------------------------------------------------

2 1