galaxy-user December 2012

galaxy-user@lists.galaxyproject.org

41 participants
55 discussions

Re: [galaxy-user] Galaxy Question
by Jennifer Jackson 17 Dec '12

17 Dec '12

Hi Dominique, This means that there were no results. My fault - the Filter tool is the wrong choice. The Select tool, as you were starting with, is better for this case. The issues you had originally were most likely with format or the regular expression. So, be sure to do the following this time: 1. Converting to tabular format (choose "1" for the identifier on this tool's form, to keep the output in a simple two column format) 2. Use a regular expression in the Select tool, "Matching", like this: \tATGC Where the "\t" indicates tab (the tab between the two columns), anchoring the matching text to the start of the sequence string. You could be more specific with the regular expression if you need to, following the guidelines on the tool help, but it probably isn't necessary if the rest of your sequences are formatted like the examples below. These sequences in your example are seperated by an empty line - but I am assuming that was just the way the data was pasted into the email. In a properly formatted fasta file, there should be no empty lines. To remove empty spaces in a fasta file, you can also use the Select tool (directly on the fasta format file), with a "NOT Matching" and this regular expression: ^$ Where ^ means the start of a line, and $ means the end. Together, they indicate a blank line. "NOT Matching" selects all lines that are not a blank line, e.g. have content. Please give this a try and let us know how it works. Jen Galaxy team On 12/17/12 8:53 AM, D. A. Cowart wrote: > Hi Jennifer, > Thank you for your reply. > I tried used the options you gave me to split files. > The second option, which would filter by basepair identity executes, > however, the resulting job is green but empty and says "no peek" in > the columns when I go to view. Do you know what this means? > Thank you, > Dominique > > On Mon, Dec 17, 2012 at 7:57 AM, Jennifer Jackson <jen(a)bx.psu.edu > <mailto:jen@bx.psu.edu>> wrote: > > Hello Dominique, > > Would the tool 'NGS: QC and manipulation -> Barcode Splitter' meet > your needs? Please see the tool's help for usage. > > Another option is to first covert the file to tabular with 'FASTA > manipulation ->FASTA-to-Tabular', then use the 'Filter and Sort -> > Filter' tool. The match criteria would look something like: > c2=='ATGC' . Once done, convert back to fasta with 'FASTA > manipulation -> Tabular-to-FASTA'. > > Hopefully one of these methods will work out for you, > > Jen > Galaxy team > > > On 12/14/12 11:10 AM, D. A. Cowart wrote: >> Hello, >> >> I would like to use Galaxy to divide a very large Ilumnia fasta >> file (~3GB) into separate fasta files. Is this possible on >> Galaxy? Here is an example of the reads: >> >> >HWI-ST156:535:C10GLACXX:8:1101:1195:1080 1:N:0:CGGTTGT >> AAATAGAATATCACATTAAAATCACAAGCAGGACAGTGTGTGTAAAAGAAATCTTTTGTGAATTCAACGTTTATCAATTAGANNNNACGCCTACGTGTAG >> >> >HWI-ST156:535:C10GLACXX:8:1101:1210:1102 1:N:0:CGGTTGT >> ATTTATCATAACAACTTAAATCAGTCAGTGGATTTCTGTCGGTCCGGTTAGCTCGGTTGGTAAAGGCGTTTGTTCGATCGTCTGTATTTTGCAATCGGGC >> >> I have tried the "Filter and Sort" option to try and select >> sequences just by a beginning sequence (ATGC, for example) to >> separate these sequences into a specific file, but I have been >> unsuccessful in this. >> >> Thank you, >> >> Dominique >> >> >> ___________________________________________________________ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> atusegalaxy.org <http://usegalaxy.org>. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ > > -- > Jennifer Jackson > http://galaxyproject.org > > -- Jennifer Jackson http://galaxyproject.org

1 0

Galaxy Question
by D. A. Cowart 17 Dec '12

17 Dec '12

Hello, I would like to use Galaxy to divide a very large Ilumnia fasta file (~3GB) into separate fasta files. Is this possible on Galaxy? Here is an example of the reads: >HWI-ST156:535:C10GLACXX:8:1101:1195:1080 1:N:0:CGGTTGT AAATAGAATATCACATTAAAATCACAAGCAGGACAGTGTGTGTAAAAGAAATCTTTTGTGAATTCAACGTTTATCAATTAGANNNNACGCCTACGTGTAG >HWI-ST156:535:C10GLACXX:8:1101:1210:1102 1:N:0:CGGTTGT ATTTATCATAACAACTTAAATCAGTCAGTGGATTTCTGTCGGTCCGGTTAGCTCGGTTGGTAAAGGCGTTTGTTCGATCGTCTGTATTTTGCAATCGGGC I have tried the "Filter and Sort" option to try and select sequences just by a beginning sequence (ATGC, for example) to separate these sequences into a specific file, but I have been unsuccessful in this. Thank you, Dominique

2 1

rice reference genome
by Jennifer Jackson 14 Dec '12

14 Dec '12

Hi Aaron, I don't - but I am not sure if it is there anyway (didn't find or missed it). This will take some research, unless someone else on the list knows where to look and can send info. My quick scan didn't find it. I checked "Get Data -> GrameneMart Central server", since I saw some documentation at one of these sites yesterday (maybe the last link I sent, with all the rice resources listed) that noted that rice anno data was now available there. But when I just checked the builds, and it wasn't this strain. "BioMart Central server" also has the other strain. I would look around at IRGSP or the other resources in that last link. I did see that Ensembl (next to last link before) had many files for download, including one where they mapped annotations (SNPs, I think) from the IRGSP build to the MSU build, which means they had the starting IRGSP file to begin with. So even if it is not in the download, they may have the sources documented somewhere (which would tell you where to fetch it and potentially gene annotations as well), or you could write them (or the IRGSP project) directly to find out what they recommend. You could also search seqanswers.com to see if anyone else was looking/found the annotation data. Too bad iGenomes did not pick this up, since if you are using RNA-seq tools, the extra attributes will maximize what Cuffdiff results you can produce. It couldn't hurt to ask them to add it to the set, I'm sure they get requests all the time. I know the MSU build is popular, but both strains are important, and IRGSP is public without any restrictions, which has certain advantages of course. Galaxy only includes the IRGSP build as a native index for this reason. But you could use the MSU build if you really wanted - and meet the usage criteria - as a custom reference genome: http://wiki.galaxyproject.org/Support#Custom_reference_genome Wish I could just find this for you! But I think this will take a big of digging and then you'll have to make a call about reliability of the source, resolve format issues (if any), that sort of thing - so investigating this on your own is a better path in the absence of a definitive go-to source. I've tried to share all the leads I could find. If you do find a good file and it works well, please consider sharing on the Public server (with the source well documented). Good luck! Jen Galaxy team On 12/14/12 7:33 AM, Aaron P Smith wrote: > > Hi Jen, > > Do you have a direct link for the gene coordinates file (GFF?) from > NCBI for the rice genome? > > Thanks, > > Aaron > > ______________________________ > > Aaron Smith, Ph.D. > > Assistant Professor > > Biological Sciences > > Louisiana State University > > 202 Life Sciences Building > > Baton Rouge, LA 70803 > > apsmith(a)lsu.edu <mailto:apsmith@lsu.edu> > > http://www.smith.biology.lsu.edu/lab > > *From:*Jennifer Jackson [mailto:jen@bx.psu.edu] > *Sent:* Thursday, December 13, 2012 11:51 AM > *To:* galaxy-user > *Cc:* Aaron P Smith > *Subject:* rice reference genome > > Hello Aaron, > > The genome was obtained from Genbank: > http://www.ncbi.nlm.nih.gov/genome/10 > http://www.ncbi.nlm.nih.gov/assembly/313038/ > > Download links can be found at the International Rice Genome > Sequencing Project (IRGSP), but, we source from NCBI directly whenever > possible. > http://rgp.dna.affrc.go.jp/E/IRGSP/index.html > http://rgp.dna.affrc.go.jp/E/IRGSP/Build4/build4.html > > These resources may also be helpful in general: > http://www.gramene.org/resources/ > http://plants.ensembl.org/Oryza_sativa/Info/Index > http://rice.genomics.org.cn/rice/link/link.jsp > > Best, > > Jen > Galaxy team > > ps. Going forward, please use the mailing list, galaxy-user(a)bx.psu.edu > <mailto:galaxy-user@bx.psu.edu>, for new questions to help us out with > tracking. Thanks! > > On 12/13/12 9:11 AM, Aaron P Smith wrote: > > Hi Jen, > > I'm trying to obtain the coordinates for the rice genome used in > Galaxy to compare some sequences from another source. Can you > direct me to the version of the genome used in Galaxy > (oryza_sativa_japonica_nipponbare_IRGSP4.0)? > > Thanks! > > Aaron > > > > -- > Jennifer Jackson > http://galaxyproject.org -- Jennifer Jackson http://galaxyproject.org

1 0

Bowtie index in data libraries
by Anthony Bretaudeau 14 Dec '12

14 Dec '12

Hi, I have a galaxy instance where I would like to make some private data available to a specific group of users. The data I would like to make available are some bowtie indexes, so each index is made of several files with the same prefix. How can I do this? I have tried to put these files in a data library, but each file is seen individually, so it is not usable in the bowtie tool. I could add it to the bowtie_indices.loc file, but I see no way to restrict the access to a specific group of user. Any help would be welcome ! Thanks Anthony

2 1

Data library and symbolic link
by MONJEAUD 14 Dec '12

14 Dec '12

Hi all, I created data libraries using options "Upload files from filesystem paths" and "Link to files without copying into Galaxy". It worked but I use symbolic links because my data are frequently updated. The problem is that Galaxy takes the real link ("external_filename" column in "dataset" table) and doesn't find the files. Is there a way for galaxy to take the symbolic link in the database. Thanks in advance for your help! Cheers, -- Cyril Monjeaud Equipe Symbiose / Plate-forme GenOuest Bureau D156 IRISA-INRIA, Campus de Beaulieu 35042 Rennes cedex, France Tél: +33 (0) 2 99 84 74 17

2 1

rice reference genome
by Jennifer Jackson 13 Dec '12

13 Dec '12

Hello Aaron, The genome was obtained from Genbank: http://www.ncbi.nlm.nih.gov/genome/10 http://www.ncbi.nlm.nih.gov/assembly/313038/ Download links can be found at the International Rice Genome Sequencing Project (IRGSP), but, we source from NCBI directly whenever possible. http://rgp.dna.affrc.go.jp/E/IRGSP/index.html http://rgp.dna.affrc.go.jp/E/IRGSP/Build4/build4.html These resources may also be helpful in general: http://www.gramene.org/resources/ http://plants.ensembl.org/Oryza_sativa/Info/Index http://rice.genomics.org.cn/rice/link/link.jsp Best, Jen Galaxy team ps. Going forward, please use the mailing list, galaxy-user(a)bx.psu.edu, for new questions to help us out with tracking. Thanks! On 12/13/12 9:11 AM, Aaron P Smith wrote: > > Hi Jen, > > I'm trying to obtain the coordinates for the rice genome used in > Galaxy to compare some sequences from another source. Can you direct > me to the version of the genome used in Galaxy > (oryza_sativa_japonica_nipponbare_IRGSP4.0)? > > Thanks! > > Aaron > > <http://www.smith.biology.lsu.edu/lab> > -- Jennifer Jackson http://galaxyproject.org

1 0

GATK Not running
by Farooq,Umar (res) 13 Dec '12

13 Dec '12

Hi, I am trying to incorporate GATK in my pipeline but not been able to make it work. I aligned my data with Hg 19 and then ran sam tool filter and then picard duplicate removal. I uploaded dbSNP and the reference FASTA file for Hg 19 in galaxy to run this pipeline. But for some reason GATK tool for base recalibration will not accept this output file. I wonder if there is sorting or indexing issue but how to fix this in galaxy. An error occurred running this job: Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/space/g2main [Mon Dec 10 10:30:42 EST 2012] net.sf.picard.sam.CreateSequenceDictionary REFERENCE=/space/g2main/tmp-gatk-tKp41A/gatk_input.fasta OUTPUT=/space/g2main/tmp-gatk-tKp41A/dict3503196447953523717.tmp Thanks, Umar

4 7

Should fastq files be merged?
by Karen Margrethe Jessen 12 Dec '12

12 Dec '12

Hi, I have downloaded the fastq.tgz files for an ENCODE RNA-SEQ data and unpacked the files. The data set is paired end illumina. I am a bit confused, as there are 5 files for read1 and 5 files for read2 for each sample. Am I supposed to merge the 5 files before aligning to the hg19 genome? If yes, how should I merge these files? I would greatly appreciate any help you can provide. Best regards, Karen Margrethe Jessen Cand. Scient., ph.d.-student Aarhus University Denmark

2 1

Link to display BED files in UCSC Genome Browser
by Lucy A. Skrabanek 12 Dec '12

12 Dec '12

Dear all, For BED files, there used to be an option in the preview window to visualize them in the UCSC Genome Browser, but that seems to have disappeared. Specifically, from a TopHat/Cufflinks run, I used to be able to visualize the accepted hits, the splice junctions and the assembled transcripts datasets in the UCSC Genome browser by simply clicking on the 'display at UCSC' link. This link is still available for the accepted hits dataset, but seems to have disappeared for the other two datasets. I realize I can still visualize these datasets by downloading them (although this seems somewhat less convenient). Is the loss of this link to UCSC intentional? Thanks, luce

2 1

How to add to add hg16 index into the build-in index / reference gnome list?
by Sachit Adhikari 12 Dec '12

12 Dec '12

How do I add hg16 into the build-in index?

2 1

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user December 2012