galaxy-user December 2012

galaxy-user@lists.galaxyproject.org

41 participants
55 discussions

User stats
by Nicholas Beckloff 07 Dec '12

07 Dec '12

Dear Galaxy, Do you have any publicly available user stats? More specifically, we are implementing a local version on our campus and need to justify the use. If it is possible to report how many users, or even how many users from our own institution, use your software it would help tremendously. Cheers, -- --------------------------------- Nicholas Beckloff, PhD Genomics Core Laboratory Director Department of Genetics and Genome Sciences Case Western Reserve University 2109 Adelbert Road BRB 646 Cleveland, OH 44106 phone: 216-368-2791 fax: 216-368-3432 http://genomics.case.edu email: nmb64(a)case.edu

2 1

conditional in Compute tool
by Ido Tamir 07 Dec '12

07 Dec '12

Hi, is it possible to do a conditional in the compute tool? something like: "a" if c1 == 4 else "b" or if c1 == 4 "a" else "b" or c1 == 4 ? "a" else "b" thank you very much, ido

1 0

Tophat alignment statistics?
by Wei Liao 07 Dec '12

07 Dec '12

Hi, galaxy users How to get Tophat alignment statistics such as % of reads aligned to exon, intron, splice junction? is there a Log file available? How many unique and mutiple alignments? I use Bam index, Flagstat, and Bam alignment metrix in Galaxy, but none reported the information I need. -- Wei Liao Research Scientist, Brentwood Biomedical Research Institute 16111 Plummer St. Bldg 7, Rm D-122 North Hills, CA 91343 818-891-7711 ext 7645

2 1

Problem in Manage data Library
by Sachit Adhikari 06 Dec '12

06 Dec '12

We have found that, in Galaxy, when we add dataset to a library under Manage data libraries, Galaxy sometimes detects the type of the file and sometimes does not. What I have noticed is that it detects the type of the file when we select "Copy file into Galaxy" under "Copy data into Galaxy?" option and does not detect it when we select "Link to files ..." Is this a known issue? Regards, Sachit

2 1

order of steps
by Zhiqiang Shu 05 Dec '12

05 Dec '12

Hi, I have two simple questions related to manipulating step history. So, how to change the order of steps, for example, put step 7 right after step 3. Second question is related, how to re-order steps, for instance, I deleted step 4 and 5 and want the next step (step 6) to take the order of 4, just to make them look nicer. How can I do that? Thanks Zhiqiang

2 1

NGS SAM Tools: Filter Pileup tool not working
by Lanelle Oni Edwards 05 Dec '12

05 Dec '12

Hello, I am currently using galaxy main to run a filter pileup on datasets that used the generate pileup tool. The filter pileup function is not recognizing any of my generate pileup datasets in the drop-down box so I cannot even execute the job. I think there may be a problem with this tool. I would greatly appreciate any help or an update as to when this tool will be functioning again. Thank You, Lanelle Edwards

2 1

Barcode splitting
by Rajarshi Ghosh 05 Dec '12

05 Dec '12

I have lllumina sequences which are barcoded in the sequence identifier e.g.: @FCC186GACXX:6:1101:1473:2060#TCGCAGGA/1 CTCCACGAAACCGGAAGGGTAGAAAAGTTCGGTCAACTCGTTCCTCACAATTTGCCCGATTCTCAGAAAAATTGTTTTGTGACCTCTCTC The '#TCGCAGGA" is the barcode. As the barcode is not on the 5' or 3' end I cannot use the barcode splitter. Is there a workaround in Galaxy for this? Thanks!

3 2

Trouble with KB1454chr5.bam, Bushman Chrm5, 454 data only
by Allan Lindh 05 Dec '12

05 Dec '12

Sorry to bother you with this, but I am trying to process the KB1 Bushman data, through a pipeline that starts with samtools mpileup -C50 -uf ~/Bushman/hg18/chromFa/chr1.fa ../KB1illumChr1.bam ../KB1454chr1.bam | bcftools view -c - >Chrm1_illum_454.vcf Processing the data one cromosome at a time, aligning the data against hg18, using mpileup to combine the illumina and 454 data. All goes very well, everything looks good all the way through, results are stable, hi-quality, and conceivably even meaningful, except for KB1454chr5.bam, the 454 data for Chrm5 When combined with the illumina data for Chrm5 it results in garbage, even though if I run the illumina data alone, it looks like all the other Chromosomes. I confess that I am worse than a Newbie, I'm an old guy working on my own, so may in fact just be in way over my head. But if there is any chance you could take a look at KB1454chr5.bam to see if there were a lot of bad reads, or an error was made in processing, or anything else is wrong, I'd be most grateful.

1 0

compare two dataset
by Ianiri, Giuseppe 03 Dec '12

03 Dec '12

Hi all, I got my cuffdiff output and I have to compare results from two (or eventually more) different dataset. Does anybody know if there is a way to do that on Galaxy? Also more in general, is there a manual for the Galaxy tools? That would be very helpful for someone who is new on the field (like in my case). Thanks Giuseppe Ianiri, Ph.D. Division of Cell Biology and Biophysics

1 0

December 3, 2012 Distribution & News Brief
by Jennifer Jackson 03 Dec '12

03 Dec '12

December 3, 2012 Distribution & News Brief <http://wiki.galaxyproject.org/News/2012_12_03_DistributionNewsBrief> * Complete News Brief <http://wiki.galaxyproject.org/DevNewsBriefs/2012_12_03>* * Highlights:* * *NGS: Mapping* tools *Bowtie <http://bowtie-bio.sourceforge.net/index.shtml>* and *Lastz <http://www.bx.psu.edu/%7Ersharris/lastz/>* have moved from the *Galaxy distribution <https://bitbucket.org/galaxy/galaxy-dist>* to the *Galaxy Main Tool Shed <http://toolshed.g2.bx.psu.edu/>*. * Improvements in the display of *Tool Shed <http://wiki.galaxyproject.org/Tool%20Shed>* repository dependencies and contents. * More *Tool Shed <http://toolshed.g2.bx.psu.edu/>* updates including details of the Functional test framework <http://wiki.galaxyproject.org/HostingALocalToolShed#Functional_test_framewo…>, a new hgweb.config file and HgWebConfigManager tool, plus other management features. * Updated *UI* display and functionality for datasets and histories: new *paused* state and "resume/paused" toggle, new *History menu options*, and improved *Scatterplot* visualizations. * The *SGE* job runner has now been fully deprecated and replaced with *DRMAA*. * Several enhancements to aid with *reproducibility*: "Re-run" and "Extract workflow" validates datasets and tools, respectively, and a new data tables registry within the Administration menu, along with associated tools, corrects or warns about tool migration issues. * Highlights from the new Galaxy *CloudMan <http://usegalaxy.org/cloud>* release and /*December 2012 Galaxy Update <http://wiki.galaxyproject.org/GalaxyUpdates/2012_12>*/. * http://getgalaxy.org* *http://bitbucket.org/galaxy/galaxy-dist* *http://galaxy-dist.readthedocs.org* new: $ hg clone http://www.bx.psu.edu/hg/galaxy galaxy-dist upgrade: $ hg pull -u -r f364d992270c * Thanks for using Galaxy!* The Galaxy Team <http://wiki.galaxyproject.org/Galaxy%20Team> -- Jennifer Jackson http://galaxyproject.org

1 0

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user December 2012