- galaxy-user - lists.galaxyproject.org

Unable to upload data via ftp site
by Varsha Pardeshi 13 Jan '14

13 Jan '14

Hi I am a registered user of Galaxy. I am trying to load my plant species genome (Cicer arietinum) via FTP using my registered account varsha.pardeshi(a)rmit.edu.au and password. However, the connection has failed several times. Kindly help me to solve this problem I also request you to load Cicer arietinum genome sequence in galaxy dataset The sequence is available http://www.ncbi.nlm.nih.gov/assembly/525138/ Thank you Kind regards Varsha -- Dr. Varsha Pardeshi Research Fellow Health Innovations Research Institute School of Applied Sciences RMIT University Building 223, Level 1 Plenty Road, Bundoora. Victoria. 3083. Australia. Lab.: +61 3 99257140, Office: +61 3 99257113 Fax.: +61 3 9925 7110 Mobile: +61 3 0416183650

2 2

bam to bigwig
by Susanne Warrenfeltz 13 Jan '14

13 Jan '14

Hello, I am trying to convert a BAM file to Bigwig using the Convert Format option under Attributes (I click on the pencil next to the file name in my history) The conversion fails with the error message: 11L3_v3 is not found in chromosome sizes file. 11L3_v3 is a genomic sequence ID for the genome that the BAM file represents. The genome I need is not in the list of Database/build option in Galaxy. How do I get my conversion to work? I have uploaded the fasta file for my genome into my history but I do not see a way to point the conversion tool to that file. Am I on the right track? Cheers from a Galaxy Newbie! Susanne

2 2

download contains the html file
by Neil.Burdett＠csiro.au 10 Jan '14

10 Jan '14

Hi, I have a tool that works well. However, when I download the results, the results are zipped up but included into the zip file is the *.html file (with the same name as the tool output) do you know how I can stop this from being zipped up? Thanks Neil

1 2

Monitoring usage
by Neil.Burdett＠csiro.au 08 Jan '14

08 Jan '14

Hi, I have a local install of Galaxy. Is there something that I could use to monitor the usage on the system, users logged i/using the tools, CPU usage, disk space etc Thanks Neil

2 1

January 2014 Galaxy CloudMan Release
by Enis Afgan 07 Jan '14

07 Jan '14

*We just released an update to Galaxy CloudMan <https://wiki.galaxyproject.org/CloudMan>. *CloudMan<https://wiki.galaxyproject.org/CloudMan> offers an easy way to get a personal and completely functional instance of Galaxy in the cloud in just a few minutes, without any manual configuration. *This update brings a large number of updates and new features, the most prominent ones being:* - On AWS, updated galaxy (snap-69893175) and galaxyIndices (snap-4b20f451) file system snapshots, which include the Nov 4, 2013 Galaxy release as well as a significant number of Galaxy tools updates and additions. Tool installations from the Tool Shed work as expected. - Updated the AWS AMI: *Galaxy CloudMan <https://wiki.galaxyproject.org/CloudMan> 2.3* (ami-a7dbf6ce) - Made multi-process Galaxy the default option for running Galaxy with CloudMan <https://wiki.galaxyproject.org/CloudMan>. - Automatically toggle master as job execution host or not when workers are present. - Added support for attaching external Gluster based filesystems + the ability to init clusters off gluster/nfs volumes when so configured in snaps.yaml. - Added support for creating a volume based on an archive_url allowing a file system to be downloaded at cluster launch; also made it possible to use transient disk for this. - Added tagging support for OpenStack <http://openstack.org/> instances (requires OpenStack Havana release). - Galaxy Reports app now starts by default on Galaxy type clusters; it is accessible on<instance IP>/reports/ URL. *Minor updates* - Added AWS new High I/O instance types. - Created proFTPd service for managing the application; fixes occasional issues with FTP connectivity - Updated admin_users (in Admin) form data-prefill and explanatory text to indicate correctly that this form now sets all admin users, instead of appending to the existing list. - Included cluster name into the page title. - Explicitly indicate that upon cluster deletion shared clusters get removed too. - Added TMPDIR env var to point to a dir on (Galaxy's) data file system. - Generalize support for finding libc on newer Ubuntu platforms. Allows CloudMan <https://wiki.galaxyproject.org/CloudMan> to run on Ubuntu 13.04 and tries to be future compatible with new minor releases of libc (thanks Brad Chapman). - Numerous fixes, see commit log for details. For more details on the new features, see the the CHANGELOG<https://bitbucket.org/galaxy/cloudman/src/tip/CHANGELOG.md?at=default> and for even more details see, *all 103 commit messages <https://bitbucket.org/galaxy/cloudman/commits/all?search=a6bf542%3Acc55ca9> from 4 contributors*. Enjoy and please let us know what you think, Enis Afgan <https://wiki.galaxyproject.org/EnisAfgan> and Dannon Baker<https://wiki.galaxyproject.org/DannonBaker> Galaxy Team

1 0

GCC2014 Training Day Topic Voting open January 6-17
by Dave Clements 06 Jan '14

06 Jan '14

Hello all, What topics should be offered at the GCC2014 Training Day<https://wiki.galaxyproject.org/Events/GCC2014/TrainingDay> ? Topics <https://wiki.galaxyproject.org/Events/GCC2014/TrainingDay> for the GCC2014 Training Day <https://wiki.galaxyproject.org/Events/GCC2014/TrainingDay> are selected by you, the Galaxy Community. For GCC2014 there are 19 nominated topics<https://wiki.galaxyproject.org/Events/GCC2014/TrainingDay#Nominated_Topics> to pick from. Your votes will determine the topics that are offered, which topics should be offered more than once, and which ones should not be scheduled at the same time. Your vote matters. *Topic voting closes January 17.* The Training Day schedule, including instructors, will be published before early registration opens on February 10. Vote now! <https://wiki.galaxyproject.org/Events/GCC2014/TrainingDay> *About the GCC2014 Training Day <https://wiki.galaxyproject.org/Events/GCC2014/TrainingDay>:* The 2014 Galaxy Community Conference (GCC2014)<https://wiki.galaxyproject.org/Events/GCC2014> will start on June 30 with a Training Day<https://wiki.galaxyproject.org/Events/GCC2014/TrainingDay> featuring 4 parallel tracks, each with three workshops, each of which are two and a half hours long, for a total of twelve sessions. There will be at least one complete track (3 consecutive workshops) about using Galaxy for biological research, and at least one full track on deploying and managing Galaxy instances. As always, please let us know if you have any questions. Thanks, The GCC2014 Organizing Committee<https://wiki.galaxyproject.org/Events/GCC2014/Organizers> -- http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ http://wiki.galaxyproject.org/

1 0

Importing workflow from file fails in Galaxy instance on Amazon Cloud
by Sébastien Vigneau 06 Jan '14

06 Jan '14

Hi, I can't import workflows from file on a freshly installed instance of Galaxy on Amazon Cloud. The error message is copied below. Do you have some idea on how to fix this? Thanks, Sébastien Internal Server Error > Galaxy was unable to sucessfully complete your request > URL: > http://ec2-50-19-79-199.compute-1.amazonaws.com/workflow/import_workflow > Module galaxy.web.framework.middleware.error:149 in __call__ > >> app_iter = self.application(environ, sr_checker) > Module paste.recursive:84 in __call__ > >> return self.application(environ, start_response) > Module paste.httpexceptions:633 in __call__ > >> return self.application(environ, start_response) > Module galaxy.web.framework.base:132 in __call__ > >> return self.handle_request( environ, start_response ) > Module galaxy.web.framework.base:190 in handle_request > >> body = method( trans, **kwargs ) > Module galaxy.webapps.galaxy.controllers.workflow:1127 in import_workflow > >> workflow, missing_tool_tups = self._workflow_from_dict( trans, data, > source=src,add_to_menu=add_to_menu ) > Module galaxy.webapps.galaxy.controllers.workflow:1823 in > _workflow_from_dict > >> module = module_factory.from_dict( trans, step_dict, secure=False ) > Module galaxy.workflow.modules:428 in from_dict > >> return self.module_types[type].from_dict( trans, d, **kwargs ) > Module galaxy.workflow.modules:222 in from_dict > >> module.state.decode( d[ "tool_state" ], module.tool, module.trans.app, > secure=secure ) > Module galaxy.tools:849 in decode > >> self.inputs = params_from_strings( tool.inputs, values, app, > ignore_errors=True ) > Module galaxy.tools.parameters:92 in params_from_strings > >> value = json_fix( from_json_string( value ) ) > Module simplejson:384 in loads > Module simplejson.decoder:402 in decode > TypeError: expected string or buffer

2 1

Preferred way to make custom tool accessible though path
by Sébastien Vigneau 06 Jan '14

06 Jan '14

Hi, I have written a simple xml wrapper to run the UCSC *bigWigToBedGraph* tool on a custom Galaxy install on Amazon cloud. The tool works as expected in this install. The xml file itself is in /mnt/galaxy/galaxy-app/tools/myTools, but I added the bigWigToBedGraph binary to the /mnt/galaxy/tools/bin/ directory, which is by default in the PATH. Alternatively, I guess I could have modified the PATH so that it includes the myTools directory. Since I would like to contribute the tool (my contribution being the wrapper) to *Galaxy Tool Shed*, I am wondering* what is the best way to include it so that it is found in the PATH* whenever the tool is installed from the Tool Shed. Thanks for your help! Sébastien

2 1

FASTQ splitter empty and FASTQ manipulator doesn't work
by Janice Patterson 06 Jan '14

06 Jan '14

I am having the same issue as this user: http://user.list.galaxyproject.org/FASTQ-splitter-produced-empty-dataset-pl… I have a fastq file, in which both paired end reads were concatenated into a single file. @HWI-ST632:288:C2L0BACXX:8:1101:1639:1746 1:N:0:GCCAAT NTTTGTCTCTGGTCTGTACTTGTGGGCCAGCTTAAGCAGCTGAGTAGCTGTTTGGCGGTCCAGGGCCTGGGTGAACTGGTTAATCGCAGGAGGCACTTTCA + #1=DDFFFHHHGFHJIHJIJJIHHJJJIIIIIJJGIGIGIJIGIDGHJIIJJJJJIJJGHHGFFFFDDDDDCBBDCCDDCDDDEDDDDDDBDDDDBDDCCC @HWI-ST632:288:C2L0BACXX:8:1101:1876:1741 2:N:0:GCCAAT NTTTATTTTTCGTTATTGTTGGTGGTTTAAAAAATTCCCCCCATGTAATTATTGTGAACACCTTGCTTTGTGGTCACTGTAACATTTGGGGGGCGGGACAG Fastq splitter results in empty data sets because, as explained in the thread, the data is already split into their corresponding forward and reverse reads and splitter is meant to split reads in which the paired end reads have been joined tail to head. I tried the manipulate FASTQ tool as the thread above suggests, however the FASTQ sequence identifier is slightly different so the suggested Match of .1 and .2 example shown in the thread doesn't work, because my FASTQ file has the identifier in Casava 1.8 format, in which the identifier line does not end with the 1 or 2 for forward and reverse strand. Instead the strand is identified as the 1 or 2 after the space in the identifier line, so <space>1:N:0 . . . and <space>2:N:0 . . . . I tried running FASTQ manipulator with the Match Reads according to regular expression with " 1:" and " 2:" but that did not work, I ended up with two identical fastq files with same sequences as the original file, so it basically just made a copy and did not deconcatenate the forward or reverse. Am I using this Match Reads by regular expression wrong? Janice Patterson patterja(a)ohsu.edu

2 1

multiplex data
by Ann Holtz-Morris 03 Jan '14

03 Jan '14

Hi, I've several questions regarding multiplex data and its analysis. First, I'm using a MiSeq run on 96-plex (dual index) data. While our current MiSeq data has had the machine the adapters ( including the indexes), it would be nice to be able to clip adapters using a file of adapters rather than one at a time for our older data, which didn't have the adapter clipped. Second, we have the MiSeq run a BWA alignment to the refererence genome for each (96) sample. The folder containing them all averages at about 5GB of data. I noticed that on a local version of Galaxy, a user with administrator privileges can load multiple files. But how can a regular user load them to the main galaxy? I've been reading the developer thread-is this something that will be released soon-ish? Third, Is there a way to run a workflow , several Samtools and Picard analysis, on multiple files so they all get processed? Thanks Ann -- Ann Holtz-Morris, M.S. SRA III de Jong Laboratory CHORI aholtzmorris(a)chori.org

2 2