- galaxy-user - lists.galaxyproject.org

Question about building a reference genome index using Bowtie
by William Light 10 Nov '11

10 Nov '11

I am trying to compare two genetically different strains that I have sequenced using SOLiD. I was trying to ask where these two strains are different, either in terms of deletions or polymorphisms, and one idea I had was to use Bowtie to create an index from one of these strains and then to map my reads for the other strain using this index. Is this a reasonable strategy? - Will Light Northwestern University

1 0

visualization
by wu yijin 09 Nov '11

09 Nov '11

Hi All, I am new of Galaxy. I want to visualize my short mapping results in the browser. I uploaded my .wig file which has format as this, (first column is position, second is the read soverage of that position) variableStep chrom=Chr1 4 1 5 1 6 1 7 1 8 2 9 3 10 3 11 3 12 3 13 3 14 3 15 3 16 4 17 4 18 4 But it comes an error Couldn't open /galaxy/home/g2main/galaxy_main/tool-data/shared/ucsc/chrom/arabidopsis.len , No such file or directory Does anyone know how to fix this? Many thanks! Best, Peggy

2 1

Galaxy local install problems understanding where to put mouse ref seq data to populate ref genome in BWA
by Christopher Callaway 09 Nov '11

09 Nov '11

Hello, I am still having problems understanding how to install mm9 mouse ref genome into our own install of Galaxy. When I try to map with BWA for Illumina the drop down for select ref genome is not populated with anything. How do you grab the mm9 ref file and how do you convert it so that Galaxy local "sees" it? How do you build the index and how do you prepare the loc file? Our install does not contain a folder tool-data/shared/ucsc/builds.txt. Sorry but I am not a programmer, just a bench scientist. Thanks in advance, Christopher W. Callaway University of Utah Dept. of Pediatrics Division of Neonatology 417 Wakara Way #2222 Salt Lake City, UT 84108

2 1

TopHat/Cufflinks visualization
by Alessia D 09 Nov '11

09 Nov '11

How do people on this mailing list usually visualize Tophat and/or Cufflinks results (eg. tracks on UCSC browser)? I have only this once before, and I started with a .wig file that I uploaded to the genome browser, however it looks like Tophat does not give any .wig file in the output. Suggestions? Thanks! A

3 2

Application error
by Palmer, Sarah 09 Nov '11

09 Nov '11

Hi, I have been trying to run fastqc on our standalone installations of Galaxy and repeatedly get the attached error message. I have tried this now with both 454 and Illumina fastq files, on 2 different Mac Machines with 10.5 and 10.6 OS and Python versions 2.5 and 2.7 on one of the machines and get the same problem occurring each time. Could you please help me find a fix for this? Cheers, Sarah

2 1

selecting reads at random from fastq file
by Austin Paul 09 Nov '11

09 Nov '11

Hi, I am curious if anyone knows how to select random lines from a fastq file. There is a select random lines tool in text manipulation tools, but it does not treat fastq files specifically, so it will not group quality lines with sequence lines. And if I turn the fastq file to tabular form in order to select lines, I can no longer return it to fastq form. Anyone know a way to do this in galaxy? Otherwise, perhaps another program? Thanks. Austin

7 9

more on varying number of output files in xml
by Nicholas Robinson 09 Nov '11

09 Nov '11

2 1

CEAS in Galaxy
by shamsher jagat 09 Nov '11

09 Nov '11

Is there an option of running CEAS tool in Galaxy I want to annotate selected enriched regions of ChIP seq data with gene names etc? Thanks

3 3

fastq joiner problem
by Matthew Herron 08 Nov '11

08 Nov '11

Hi, I am trying to join two groomed fastq files from a paired-end Illumina read using the fastq joiner tool. The drop-down menus correctly identify the groomed fastq files, but after cranking for a few minutes the tool produces empty output: "FASTQ joiner on data 5 and data 4emptyformat: fastqsanger, database: ?Info: There were 3497909 known sequence reads not utilized.Joined 0 of 3497909 read pairs (0.00%)." The files have the same number of reads (3497909), reads have the same number of bases (102), and the joiner tool doesn't have any options (other than choosing the two files to join). I have tried this with Sanger and with Illumina 1.3+ quality scores, and in both (left-right) orientations. I've pasted the beginnings of the two files below my signature in case this is useful for diagnosing the problem. Can anyone tell me what I'm doing wrong? Thanks, -- Matthew D. Herron, PhD Department of Zoology University of British Columbia X.princeps(a)gmail.com http://www.eebweb.arizona.edu/grads/mherron/ Sample of read 1: @HWI-ST765:83:D091AACXX:1:1101:1202:2130 1:N:0:ACTTGA TTATTCCGTTTACCTTCACGCTGTTATGGCTCTCGGTGTTCGGCAATAGCGCGCTGTATGAAATTATCCACGGCGGCGCGGCATTTGCCGAGGAAGCGATG + CCCFFFFFHHHHHJJJJJJJJJJJJIJIJJJIEHII?FGIIJJJJJJJIJJJHFFDDEEEDEDDDDEDDDDDDDDDDDDDDDDDDD@CCD3<BDD@DDDBD Sample of read 2: @HWI-ST765:83:D091AACXX:1:1101:1202:2130 2:N:0:ACTTGA ATTCCCCAGCACCAGCGCCCCGGAGTCCGCCGAGGTCACATAAAACAGCAGGCCAGTAATGGTGGCGACGGAGGCGCTAAAGGTAAACGCCGGATACTGCG + CCCFFFFFFGHHHJJJJJJJJJIJIFHIIJJJJIG:BEFFFFEEEDDCBDDDDDDD@CDDDCACDDDBDDDDDDBDDDDDDDC>@CCC@@DDDDDDDDEDB

3 2

adaptor trimming
by Soetkin Versteyhe 08 Nov '11

08 Nov '11

Hi! Does anyone know if it is possible to trim sequencing adaptor sequences away in Galaxy? Thanks! Soetkin Versteyhe, PhD PostDoc University of Copenhagen Faculty of Health Sciences The Novo Nordisk Foundation Center for Basic Metabolic Research Integrative Physiology Blegdamsvej 3B 2200 København N Denmark PHONE +45 35337116 soetkin.versteyhe(a)sund.ku.dk http://sund.ku.dk http://metabol.ku.dk<http://metabol.ku.dk/> [cid:image001.gif@01CC9E39.FE2E3F70]

2 1