- galaxy-user - lists.galaxyproject.org

Posting in the List
by santhi ramachandran 19 Oct '11

19 Oct '11

1 0

How to combine two Reference Genome (Files) In Galaxy?
by Binbin You 19 Oct '11

19 Oct '11

Hi all, I have two reference (genome) files. Let's say EAB_FB_MG.fa(total37972 sequences/contigs) and EAB_FB.fa(21272 sequences/contigs). I know there are some common contigs between them. How could I combine/merge them to get a new reference file with all unique contigs (without duplicates)? Many thanks for any idea!!

2 1

Regarding perl script
by Shambhavi Srivastava 18 Oct '11

18 Oct '11

Hello all, I am a new to GALAXY and am trying to create my own workflow with my own scripts written in PERL and integrating it with few already available in GALAXY. I tried the basic example given in GALAXYwiki..the program about counting GC content. I followed all the steps mentioned but when I start my galaxy server I dont see myTools option and even the pre installed options like GetData and all dont appear on screen. What should I do...can anyone send me another or a step by step procedure of how can I run my programs. Thankss..

2 1

Memory issues while using Galaxy
by prashant singh 18 Oct '11

18 Oct '11

Hi We have installed Galaxy on a local machine (Mac pro 2 x 2.4 gHz quad core Intel Xeon with 32 GB RAM). We wish to use dynamic trimmer in order to trim the data and while downloading a groomed file from galaxy, it runs out of memory. Please advise. Sent from my iPhone

2 1

Data files for Gencode Partition tool
by Harald Dahle 17 Oct '11

17 Oct '11

Hello! I tried asking this at the galaxy-dev list a while back, but figure it might more rightly belong on this list. I am trying to configure the Gencode Partition tool on our local installation of Galaxy. However, I am not able to find any information about what sort of files it should have. I have tried with various formats of gencode partition files, but have not managed to get it working. Could anybody please help me out with a few pointers as to where I can find these files, or how to generate them? If I have just overlooked the documentation on how to do this, I apologize, and would greatly appreciate a link to where I can find it. Thanks in advance, -Harald

1 0

question about sorting barcoded sequences
by Qingquan Liu 17 Oct '11

17 Oct '11

Hi, I have an Illumina HiSeq lane of sequences, in which I input multiple samples with 5-prime 6 bp barcodes. The barcodes were added in a way so that the barcodes are the first 6 bp in the reads. What I need to do is to sort my reads according to the barcodes, then clip off the barcodes and use the remaining to do mapping. Could anybody advise how I could sort my reads based on the barcodes (e.g. the first 6 base pairs) in Galaxy? Thanks a lot! Tracy

2 1

passing the url for ucsc browser (send output to galaxy)
by Joseph Hargitai 14 Oct '11

14 Oct '11

Hi, we are running distinct instances on 80 and 8080 - when you use the 8080 instance - the url is built for /galaxy not :8080/galaxy http://genome.ucsc.edu/cgi-bin/hgTables?GALAXY_URL=http%3A//genome.einstein…...... thus you cannot pass the data back to the correct instance. What/where is the easiest to pass the 8080 information to the browser? Looking at some candidate files: ucsc_proxy.py ucsc_tablebrowser.xml but perhaps there is a better way, best, joe

1 0

Problem with new tool shed
by Florent Angly 14 Oct '11

14 Oct '11

Hi all, I tried the latest stable version of Galaxy: http://wiki.g2.bx.psu.edu/News%20Briefs/2011_08_30. This page has links to how to use the new tool shed including how to automatically deploy tools from the shed in a local Galaxy server. The documentation mentioned some tool shed options available from the the admin section of Galaxy but I could not locate these options in my instance of galaxy. So my question is: Can one only take advantage of the tool deployment from the shed in the development version of Galaxy? If so, I think the Tool shed wiki should be more clear about this. Then I tried the latest development version of Galaxy and could locate the tool shed deployment options. I attempted to install the Grinder wrapper (http://toolshed.g2.bx.psu.edu/repository/manage_repository?sort=name&webapp… <http://toolshed.g2.bx.psu.edu/repository/manage_repository?sort=name&webapp…>) but ran into an error that I am pasting below: > URL: > http://localhost:8080/admin/install_tool_shed_repository?tool_shed_url=tool… > File > '/home/floflooo_mint/Software/galaxy-central/eggs/WebError-0.8a-py2.6.egg/weberror/evalexception/middleware.py', > line 364 in respond > app_iter = self.application(environ, detect_start_response) > File > '/home/floflooo_mint/Software/galaxy-central/eggs/Paste-1.6-py2.6.egg/paste/debug/prints.py', > line 98 in __call__ > environ, self.app) > File > '/home/floflooo_mint/Software/galaxy-central/eggs/Paste-1.6-py2.6.egg/paste/wsgilib.py', > line 539 in intercept_output > app_iter = application(environ, replacement_start_response) > File > '/home/floflooo_mint/Software/galaxy-central/eggs/Paste-1.6-py2.6.egg/paste/recursive.py', > line 80 in __call__ > return self.application(environ, start_response) > File > '/home/floflooo_mint/Software/galaxy-central/eggs/Paste-1.6-py2.6.egg/paste/httpexceptions.py', > line 632 in __call__ > return self.application(environ, start_response) > File > '/home/floflooo_mint/Software/galaxy-central/lib/galaxy/web/framework/base.py', > line 160 in __call__ > body = method( trans, **kwargs ) > File > '/home/floflooo_mint/Software/galaxy-central/lib/galaxy/web/framework/__init__.py', > line 173 in decorator > return func( self, trans, *args, **kwargs ) > File > '/home/floflooo_mint/Software/galaxy-central/lib/galaxy/web/controllers/admin.py', > line 805 in install_tool_shed_repository > shed_tool_conf = trans.app.toolbox.shed_tool_confs.keys()[0].lstrip( > './' ) > IndexError: list index out of range I get the same problem with other wrappers such as FastQC. Am I doing something wrong? Thanks, Florent

2 8

Re: [galaxy-user] Problem with Cuffcompare
by Chandu Galaxy 14 Oct '11

14 Oct '11

Thank you very much Jeremy. Can I have a look at the re-ran datasets? On Thu, Oct 13, 2011 at 12:12 PM, Jeremy Goecks <jeremy.goecks(a)emory.edu>wrote: > Chandu, > > There are two problems: > > (1) you mapped your reads to AgamP3, but the dbkeys for all of your > Cufflinks datasets is anoGam1. This should not have happened automatically > with Galaxy, but I'm looking into the issue now. Did you do this yourself? > > (2) Galaxy does not have sequence data for anoGam1, and this directly led > to the problem that you're seeing. > > I corrected the problem by manually assigning build AgamP3 to your > Cufflinks datasets and then rerunning Cuffcompare. In the future, I expect > that we'll add anoGam1 data to our public server, but it's not clear when > this will occur. > > Thanks, > J. > > > > On Oct 12, 2011, at 5:35 PM, Chandu Galaxy wrote: > > Thank you Jeremy. I've shared my History named 'Mosquito Work: RNA-Seq > analysis 2' with you just now. Please see the datasets from 1-58 (also see > deleted datasets). Thanks. > > -- > Chandu > > On Wed, Oct 12, 2011 at 2:02 PM, Jeremy Goecks <jeremy.goecks(a)emory.edu>wrote: > >> Chandu, >> >> Are you running your analysis on our public server ( main.g2.bx.psu.edu)? If so, can you share your history me please >> (Options-->Share/Publish-->Share with a User-->my email address). >> >> Thanks, >> J. >> >> On Oct 11, 2011, at 4:26 PM, Chandu Galaxy wrote: >> >> Thank you for the response. >> I can't check my reference genome dataset because I'm using reference >> provided by Galaxy (*Mosquito (Anopheles gambiae): AgamP3*). Is there any >> solution? Thank you. >> >> -- >> Chandu >> >> >> >> On Mon, Oct 10, 2011 at 7:15 AM, Jeremy Goecks <jeremy.goecks(a)emory.edu>wrote: >> >>> >>> Tool execution generated the following error message: >>> >>> Error running cuffcompare. Warning: Your version of Cufflinks is not up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu) >>> No fasta index found for ./input1. Rebuilding, please wait.. >>> Error: sequence lines in a FASTA record must have the same length! >>> >>> Chandu, >>> >>> Cufflinks/compare/diff requires that your reference genome dataset have >>> the following format: >>> >>> >my_chrom >>> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT >>> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT >>> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT >>> ... >>> >>> Note that all lines of sequence data have the same length. >>> >>> The problem you're seeing is because there are lines in your sequence >>> data that are not the same length, e.g. >>> >>> >my_chrom >>> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT >>> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTA >>> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCG >>> ... >>> >>> The FASTA Width tool in Galaxy can help you format your dataset >>> correctly. >>> >>> Good luck, >>> J. >>> >> >> >> > >

2 1

customizing mm9 mouse reference genome and then using that as the ref genome when uploading Illumina data
by Christopher Callaway 13 Oct '11

13 Oct '11

I would like to filter out the mm9 mouse build ref genome to only show MspI sites, and then use that as my "Genome" when uploading my Illumina data. Anyone have a protocol for that? Thanks, Christopher W. Callaway University of Utah Dept. of Pediatrics Division of Neonatology 417 Wakara Way #2222 Salt Lake City, UT 84108

2 1