- galaxy-user - lists.galaxyproject.org

Merging of illumina paired end files
by Arun Khattri 15 Sep '11

15 Sep '11

I have 3 illumina paired end reads of exome capture of the sample. I want to assemble these reads to genome using tools available in Galaxy (BWA etc). My concern is the amount of data that I can analyzed and when these reads should be merged. The total size of data is +30Gb. Thanks, Arun

2 1

Re: [galaxy-user] Upload of most recent genome data for Apis mellifera onto Galaxy and/or NCSC web sites?
by Anton Nekrutenko 15 Sep '11

15 Sep '11

Diana: It is best to direct such requests to galaxy-user(a)bx.psu.edu mailing list, which I am doing. Adding this genome should be possible, but will take us some time. Thanks, anton Anton Nekrutenko http://galaxyproject.org On Sep 12, 2011, at 1:23 PM, Diana Cox-Foster wrote: > Hi, Anton--- I am currently doing a NGS project and want to compare the sequencing data to the Apis mellifera genome. Unfortunately, the genomes on Galaxy and the UCSC website are quite outdated. I am planning to do another sequencing project that would also benefit from having the newest version as well. >

3 2

How to use GATK Unified Genotyper with "A list of genomic intervals over which to operate" option
by Carlos Borroto 15 Sep '11

15 Sep '11

Hi, I would like to run "Unified Genotyper" on a region of a BAM file, I see the advance option "A list of genomic intervals over which to operate" exist and seems to be what I need. The problem is I only get a drop-down menu with the single option "Selection is optional", which I don't understand. Thanks, Carlos

2 1

Fwd: Help with sam to bam
by Austin Paul 15 Sep '11

15 Sep '11

Hi Zach, You should reply to all so people dont keep working on your questions. Glad to help. Austin ---------- Forwarded message ---------- From: Zachary A Lewis <zlewis(a)uga.edu> Date: Tue, Sep 13, 2011 at 3:10 PM Subject: Re: [galaxy-user] Help with sam to bam To: Austin Paul <austinpa(a)usc.edu> Thanks Austin! That did the trick. Zack On Sep 13, 2011, at 4:47 PM, Austin Paul wrote: You could try "fasta width formatter" on your reference fasta. This has helped me in the past when I received a similar error. On Tue, Sep 13, 2011 at 11:32 AM, Zachary A Lewis <zlewis(a)uga.edu> wrote: > Hi, > I was wondering if someone could help me with an error message I'm getting > after performing a sam to bam conversion in galaxy. I've used Bowtie to map > sequence reads to a custom fasta file corresponding to one chromosome in my > organism. The mapping seems to work fine, but when I attempt a sam to bam > conversion, I receive the folowing error message: > > An error occurred running this job: *Samtools Version: 0.1.12 (r862)* > *Error creating indexes from reference > (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] > line length exceeds 65535 in sequence 'LGVII'. > Segmentation fault* > * > * > Any help would be appreciated. > > Thanks, > > Zack > > > > ___________________________________________________________ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > >

2 1

Trinity
by David Joly 15 Sep '11

15 Sep '11

I want to run Trinity on the "test" instance of Galaxy, but there seems to be a problem. The analysis complete very quickly and I've got no assembled transcripts. In the log file created by Trinity, there is one line: /var/spool/torque/mom_priv/jobs/1204985.thumper.g2.bx.psu.edu.SC: 11: Trinity.pl: not found Any idea? David

2 1

Help with sam to bam (Zachary A Lewis)
by Pandey, Ashutosh 15 Sep '11

15 Sep '11

Message: 1 Date: Tue, 13 Sep 2011 18:32:43 +0000 From: Zachary A Lewis <zlewis(a)uga.edu> To: "galaxy-user(a)lists.bx.psu.edu" <galaxy-user(a)lists.bx.psu.edu> Subject: [galaxy-user] Help with sam to bam Message-ID: <AE8E036C-CBD3-46F9-B5A4-0615CD80610D(a)uga.edu> Content-Type: text/plain; charset="us-ascii" Hi, I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message: An error occurred running this job: Samtools Version: 0.1.12 (r862) Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'. Segmentation fault Any help would be appreciated. Thanks, Zack Hi Zack, I got a similar problem but I am not sure if you have the same problem. My problem was due to use of different chromosome symbol by reference fasta file and the SAM file. May be you are using "chr2" in SAM file and "2" in reference file or vice-versa. Converting chromosome symbol would be easy for reference fasta file. Thanks -Ash

2 1

How to clip multiple adapter sequences in Penn State Galaxy? Thank.
by Binbin You 15 Sep '11

15 Sep '11

Hi All, In " Clip adapter sequences" option of Penn State Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip. In addition, In "What it does" it shows: This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. So how could i do if I have the adapter sequences like this: 5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT 5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA 5' GACGGCATACGAGCTCTTCCGATCT 5' AGATCGGAAGAGCTCGTATGCCGTC Thanks very much for any response! Best wishes, Bin

2 1

MACs
by Keith Giles 14 Sep '11

14 Sep '11

Does anyone have advice on how to set the fdr threshold when using MACs in galaxy? Conversely, is there a way to learn what the fdr is for each peak that is called?

1 0

BFAST for SOLID paired end reads
by Candace Seeve 14 Sep '11

14 Sep '11

I am new to RNA-Seq and trying to map ABI SOLID paired-end reads. I've read that BFAST + BWA is a good program for this. I have found BFAST on the galaxy test site. Is it possible to map paired end reads using the BFAST version there? Could someone help me with this workflow? Thanks very much in advance.

2 1

Help with sam to bam
by Zachary A Lewis 13 Sep '11

13 Sep '11

Hi, I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message: An error occurred running this job: Samtools Version: 0.1.12 (r862) Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'. Segmentation fault Any help would be appreciated. Thanks, Zack

2 1