- galaxy-user - lists.galaxyproject.org

listing attributes of data input
by Freddy de Bree 03 Feb '11

03 Feb '11

Dear all, I was wondering if there is a place within the Galaxy content (a config, an xml file) that gives me some handles on how to address attributes of data input. For example, I can get the 'file_name' of data input, by addressing this attr as 'input.file_name', and for example, the original name of the data file can be addressed with 'input.name'. Anyone any clues where I can find this info? Freddy de Bree

2 1

CuffDiff gene fpkm tracking file- Sorry! I sent only a part of my email
by Samuele Gherardi 03 Feb '11

03 Feb '11

Hello everybody, I'm quite new in NGS world, I'm trying to analize dome RNA-seq data. I followed the workflow through tophat,cufflink,cuffcompare and cuffdiff I suppose everything work fine but in the Cuffdiff gene fpkm file the column Class_Code is empty and i don't know why? this is an example of my CuffDiff gene fpkm tracking file. tracking_id class_code nearest_ref_id gene_short_name tss_id locus q1_FPKM q1_conf_lo q1_conf_hi q2_FPKM q2_conf_lo q2_conf_hi XLOC_000001 - - MT-ND5 - chrM:0-16571 12484.2 12260.8 12707.7 11447 11233.1 11661 XLOC_000002 - - USP14 TSS1,TSS2,TSS3 chr18:148586-236453 16.7235 9.41244 24.0346 19.437 11.7368 27.1371 XLOC_000003 - - SMCHD1 TSS10,TSS11,TSS12,TSS4,TSS5,TSS6,TSS7,TSS8,TSS9 chr18:2719322-2728540 28.2493 17.5093 38.9892 27.2263 16.6263 37.8262 XLOC_000004 - - EMILIN2 TSS13,TSS14 chr18:2880607-2882469 3.98118 0 7.99721 4.62875 0.278519 8.97899 I this is normal, how can I find the class code of transcript listed in the CuffDiff gene expression file? thank you in advance Samuele.

1 0

have fsatq ... but don't know input format for groomer?
by Johnson, Kory (NIH/NINDS) [C] 02 Feb '11

02 Feb '11

Hello, My account login is: johnsonko(a)ninds.nih.gov<mailto:johnsonko@ninds.nih.gov> I am a first time Galaxy user. I have uploaded my sequences as format "fastq" into Galaxy and would like to next use "Groomer" to output Sanger fastq format so to go on with exploring quality via box plot, deciding on a trim length (if any), and map to genome using bwa or bowtie. However, I am running into a problem using "Groomer". I do not know what format my sequences are per setting the required input parameter. An example of my sequences is as follows: @SNPSTER6_0679:1:1:1083:939#0/1 run=100908_SNPSTER6_0679_70929AAXX NATTTATGGATAGTTGGGTAGTAGGTGTAAATGTATGTGGTAAAAGGCCTAGGAGATTTGTTGATCCAATAAATATGATTAGGGAAACAA +SNPSTER6_0679:1:1:1083:939#0/1 BIQQIQQQTP[[[[[VVVVQPPPPPTWWWW[[YYTTTOVV____TWVXRWPTQPQWWWWWTOOVV___V_TROOWTWTWTQWQWTTRWRO ... how to tell if you have: "Sanger", "Solexa", "Illumina 1.3+", etc. I have tried to submit to "Groomer" different times using these options one at a time and none return with results. Need help please. Also, what is the expected time for "Groomer" to return results for a file containing 2.7 million reads. Thank you ... best, Kory -------------------------------------------- Kory R. Johnson, MS, PhD Sr. Bioinformatics Scientist [cid:image001.jpg@01CBC2E0.B2CEC7F0] www.kellygovernmentsolutions.com Providing Contract Services For: Bioinformatics Section, Information Technology & Bioinformatics Program, Division of Intramural Research (DIR), National Institute of Neurological Disorders & Stroke (NINDS), National Institutes of Health (NIH), Bethesda, Maryland Mailing Address: NINDS/NIH Clinical Center (Building 10) Office 5S223 9000 Rockville Pike Bethesda, MD 20892 Contact Information: Phone: 301-402-1956 Fax: 301-480-3563 email: johnsonko(a)ninds.nih.gov P Green Message: Please consider the environment before printing this e-mail. Thank you. Important Message: This electronic message transmission contains information intended for the recipient only. Such that, the information contained herein may be confidential, privaledged, or proprietary. If you are not the intended recipient, be aware that any disclosure, copying, distribution, or use of this information is strictly prohibited. If you have received this electronic information in error, please notify the sender immediately by telephone. Thank you. --------------------------------------------

2 1

Workflows with parameters
by Florent Angly 01 Feb '11

01 Feb '11

Hi, I was talking about the Galaxy workflow with someone recently. He pointed out an "obvious" limitation of the workflows that I never realized before. So I thought I'd ask the team if any work is planned in this direction: In a workflow, the only part that is dynamic and configurable by the workflow user is the input files at the moment. I think it would be nice to allow setting parameters for some specific workflow steps. For example, say that my workflow involves running Megablast, as a workflow designer, I would be able to tick a box that makes the "word size" input be changed by the user when he runs the workflow. What do you think? Does this feature already exist? Are there plans to implement it? Regards, Florent

2 2

Python error when running Bowtie for Illumina
by Weng Khong Lim 01 Feb '11

01 Feb '11

Hi all, I'm new to next-gen sequencing, so please be gentle. I've just received a pair of Illumina FASTQ files from the sequencing facility and intend to map them to the hg19 reference genome. I first used the FASTQ Groomer utility to convert the reads into Sanger reads. However, when running Bowtie for Illumina on the resulting dataset under default settings, I received the following error: An error occurred running this job: *Error aligning sequence. requested number of bytes is more than a Python string can hold* * * Can someone help point out my mistake? My history is accessible at http://main.g2.bx.psu.edu/u/wengkhong_lim/h/chip-seq-pilot-batch Appreciate the help! Weng Khong, LIM Department of Genetics University of Cambridge E-mail: wkl24(a)cam.ac.uk Tel: +447503225832

4 3

March 2011 GMOD Meeting: Registration is open
by Dave Clements 01 Feb '11

01 Feb '11

Hello all, Registration is now open for the March 2011 GMOD Meeting ( http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting) This meeting is part of GMOD Americas 2011, an event that includes a day of Satellite Meetings, a GMOD Course (ialready full), and for the first time, an "Introduction to GMOD" session the night before the meeting for GMOD newcomers. GMOD Americas 2011 events are being held at the US National Evolutionary Synthesis Center (NESCent) in Durham, North Carolina, United States. As with previous GMOD meetings, this meeting will have a mixture of project talks, component talks, and user talks. Our guest speaker is Dr. Eric Stone of North Carolina State University. Dr. Stone will talk about his experience on the "Drosophila Genome Reference Panel," a project that is sequencing 192 lines. See http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda for more. The agenda is driven by attendee suggestions, and you are encouraged to add your suggestions now ( http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda_Proposals) For examples of what happens at a GMOD meeting, see the writeup of the September 2010 GMOD Meeting (http://gmod.oicr.on.ca/wiki/September_2010_GMOD_Meeting) or any previous meeting. GMOD meetings are an excellent way to meet GMOD developers and users and to learn (and affect) what's coming in the project. Registration for the March 2011 GMOD Meeting is $80 on or before February 18 <<<<======= $95 after February 18 Please register early, both to save money, and ensure a spot. You are also strongly encouraged to sign up for (or propose) a Satellite Meeting (more details to come). Details on transportation, suggested lodging, and other logistics are on the GMOD Americas 2011 page. This meeting, and all GMOD Americas 2011 events, are jointly sponsored by NESCent and the Galaxy Project. Dave Clements Galaxy Project -- http://gmod.org/wiki/GMOD_Americas_2011 http://nescent.org http://usegalaxy.org/ http://getgalaxy.org

1 0

January 31, 2011 Galaxy Development News Brief
by Jennifer Jackson 31 Jan '11

31 Jan '11

January 31, 2011 Galaxy Development News Brief http://bitbucket.org/galaxy/galaxy-central/wiki/Features/DevNewsBrief/2011_… ---- Get Galaxy! http://bitbucket.org/galaxy/galaxy-central/wiki/GetGalaxy * new: % hg clone http://www.bx.psu.edu/hg/galaxy galaxy-dist * upgrade: % hg pull -u -r 95d65755ac69 ---- What's New = Workflow Additions= 1) Usability improvements for workflow annotations * Workflow annotation is now shown at the top of the page. * Step annotations are shown in the step header rather than at the bottom. example: Annotation http://bitbucket.org/galaxy/galaxy-central/wiki/Features/DevNewsBrief/2011_… 2) Easier to move workflows directly from one Galaxy instance to another * Workflow download/export page now provides URL that can be used to directly import a workflow from one instance to another. example: URL import http://bitbucket.org/galaxy/galaxy-central/wiki/Features/DevNewsBrief/2011_… 3) New Parameter settings for global application or specific actions * Workflow parameters are a new feature we've added to simplify reuse of workflows, and to allow for easier variation of parameters when re-running a workflow. * Instead of filling in explicit values when building a workflow, you can now use flexible parameters. To specify a workflow parameter, simply use a tag like ${my_variable_name} in any tool input field or in a rename dataset action field. * The workflow shown below has two parameters, as shown in the Workflow Parameters display in the top right of the editor window. You can see the ${filter_condition} parameter in the right panel in both the tool input and the rename action. ** Note that while this ${filter_condition} is only used in a single step in this simple demo workflow, variables can be used across steps. example: Parameters http://bitbucket.org/galaxy/galaxy-central/wiki/Features/DevNewsBrief/2011_… *As the inputs are filled in the Workflow Parameters box, seen in the runtime example below, the new values will be reflected in all workflow steps and will be used when the workflow is executed. example: Runtime display http://bitbucket.org/galaxy/galaxy-central/wiki/Features/DevNewsBrief/2011_… 4) General workflow tuning * HideDataset Action will no longer show in the workflow editor. The ability to manually create one of these actions has been deprecated in favor of the workflow outputs approach. * Workflow run results can now be sent to a new history instead of the current one. * Ordering of workflow steps is now sorted based on the layout in the workflow editor, arranged based on distance from top left corner of the editor. This won't affect existing workflows until re-saved. * Workflows that contain steps expecting tools that are unavailable (as might be the case for a workflow imported from another Galaxy instance) will now have problem nodes marked with an error state. The workflow cannot be saved until the steps are removed or the tools are added to the current Galaxy instance. = Deferred Jobs & Managed Transfers = These components are under rapid development and interfaces should be considered experimental. They can be enabled by setting 'enable_beta_job_managers = True' in universe_wsgi.ini. 1) Deferred Jobs * A generic method for creating a dependency on an event before executing arbitrary code has now been defined in: galaxy-dist/lib/galaxy/job/deferred/__init__.py * The deferred job runner loads plugins found in the same directory which implement the necessary methods check_job() and run_job(). check_job() returns a state which informs the deferred job runner whether it is okay to execute the run_job() method. * The deferred job runner is independent from the regular tool-related job runner and is not coupled with tools, nor does it have any integrated cluster support. * No documentation is provided for the format of a plugin at this time, but a sample plugin will be included at a later date. 2) Transfer Manager * Galaxy can now spawn persistent transfers of (unauthenticated) http and https URLs via the code in: galaxy-dist/lib/galaxy/job/transfer_manager.py * The transfer manager is accessible in-application at app.transfer_manager. * Transfers are daemonized and thus not influenced by Galaxy restarts, although a loss of database connection (restarting the database server) will cause transfers to fail. * A transfer can be polled for progress via JSON-RPC requests to its socket. An interface for this request is available in the transfer_manager class. * Future enhancements will allow for authenticated http/https and scp. ---- Updated & Improved = Data Content = * New "Get Data" source: modENCODE modMine server. * New Genomes: format: Genome [dbkey] ** //Pseudomonas aeruginos (str. PA7) [16720] ** Pseudomonas aeruginos (str. PAO1) [pseuAeru] ** Pseudomonas aeruginos (str. UCBPP-PA14) [386] ** Silkworm (Bombyx mori str. p50T) [Bombyx_mori_p50T_2.0] ** Rice pathogen: Xanthomonas oryzae (str. KACC10331) [12931] ** Rice pathogen: Xanthomonas oryzae (str. MAFF 311018) [16297] ** Rice pathogen: Xanthomonas oryzae (str. PXO99A) [Xanthomonas_oryzae_PXO99A] ** Little Brown Bat (Myotis lucifugus) [myoluc2] = Current Tools = * Optional 'min' and 'max' attributes for tool integer and float parameters. * Add --max and --un options to Bowtie. * Validators enforce min/max values and generated error messages for invalid values. * Add Standard deviation operation to grouping tool. * Enhance histogram tool to allow plotting as frequency/counts. * Allow fastx_toolkit clipper wrapper to work on fastqsanger formatted files. * SAM metadata detection and setting sped up dramatically upon import. * Wig-to-bigWig converter tool default parameters now same as UCSC's. * Cufflinks tool suite updates: ** Update Cufflinks tool suite wrappers to support v0.9.3. ** Add support for bias correction to Cufflinks and Cuffdiff; bias correction improves transcript quantitation results (FPKM values). ** Enable Cuffcompare to use sequence data so that it can generate data for use by Cuffdiff. Cuffcompare uses sam_fa_indices.loc to find locally cached genome sequence data and indices that are needed for this option. ** Add normalization support to Cufflinks and Cuffdiff and replicate support for cuffdiff. = New Tools = * BED-to-bigBed converter tool now under "Convert Formats". ** Converts sorted BED files into UCSC's bigBed format. ** Requires bedToBigBed in PATH. * BLAST+ tools are now commented in tool_conf.xml.sample. ** Not in Galaxy main, for local instance use. ** If you run the BLAST+ tools at your site, please be sure to uncomment them if updating to the latest tool_conf.xml.sample (will be default at next update). * Add SAMtools flagstat tool. * Add CCAT ChIP-seq peak/region caller. * Add BWA wrapper for SOLiD. = Histories = * Estimated size is now displayed for very large text-based (non-binary) datasets. * Always show Galaxy masthead and enable Saved Histories to work with and without panels. * New "Copy Datasets" link added under History Options dropdown. ** Dataset and history IDs are now encoded. ** JS dropdown used to change source history, so you no longer have to switch desired source history to be "active". ** Remove link in "edit attributes" of datasets. ** Simplified destination interface by using a single select box by default, but also providing a link to show checkboxes for multiple destination histories. ** Use newly imported Inflector library to get correct plural/singular nouns on actions. ** Added arrow between source and destination. ** Removed checkbox for copying to a new history. Instead, create new history if new history field is not blank. = Data Libraries= * Creating job information (stdout/stderr) is now available on the library item info page, which is helpful when library uploads fail. = Trackster = * Add bigWig display to trackster. Automatically converts wig to bigwig if needed (NOTE: datatypes_conf.xml.sample has been edited to add the new converter, you must update datatypes_conf.xml to use it). The converter requires that wigToBigWig be in the PATH, but no other tools are needed to view bigwig files as they are provided by bx_python. * Tuning ** Fix track preferences not being applied ** Fix chroms not being selectable when a new track browser is created ** Fix ReferenceTrack not working with filters ** Fix visual analytics error when tool configuration has changed ** Fix visualization saving on Chrome by using $.each instead of for loop ** Fix shared visualizations ** Fix tracks fetching from data provider when indexer returned None, and when ** Fix BAM reads without cigar string. = Sample Tracking = * Additions and tuning to improve tracking (complete documentation will be available soon). = User Interface (UI) = *Version info is now printed in history item for Bowtie, BWA, Lastz, TopHat, Samtools, Cuffdif, Cufflinks, Cuffcompare, BFAST, and PerM. * Turn off web browser auto-complete for tool search (includes workflows). * Grid changes resulting in better readability: ** Better page number display. ** Use "~" instead of "about" example: "about 2 hours ago" -> "~ 2 hours ago". ** Cell padding decreased. ** Added new "nowrap" parameter to prevent text from being wrapped. Currently only used for tags to prevent "X tags" from wrapping in the middle. = Application Programming Interface (API) = * Still 'alpha', but: Initial pass completed for forms, request_type, users and roles. See README and examples in source. = Source = * Galaxy now runs with system python on 64-bit mac kernel. * Enhance select parameter wrapper objects to provide access to additional fields by name for dynamically generated select lists (i.e. dynamic_options). example: use ${param.fields.path} to access a path field * Updated the XML in filter specification for output files. The closing filter tag can now be on separate line to use as an # actual filter. * Implemented 'from_work_dir' attribute for tool outputs. Using this attribute matches a file in the working directory to a tool output/HDA; when a tool finishes, the file in the working directory is automatically copied to the HDA. Hence, it's no longer necessary for tool wrapper scripts to manually copy tool output files to HDA files. * More programmatic control of page numbers on grid (custom UI). * Many formerly undocumented options have been added to the universe_wsgi.ini.sample file. Please compare your working copy with the new .sample and determine whether any of the options are relevant to your environment. *The "welcome page" found at static/welcome.html, has been renamed to static/welcome.html.sample. * The UCSC Genome Browser now supports loading data via https. If you implemented this former Galaxy URLs from https->http method in Apache as per the wiki documentation you will also need to remove it there, and allow the browser through your authentication scheme over https. * Explicitly convert autocomplete dropdown values on refresh_on_change. * Adjust image links in tools to work with a proxy prefix (thanks Brad Chapman). = Bug Fixes = * Ensembl GTF files are recognized correctly. * Make Tophat wrapper compatible with python 2.4 by removing try-catch-finally. * Fix unicode error for dataset peeks. * Sanitize tool links in tool menu so that they can be searched. Use only lowercase letters, numbers, and underscores in links to ensure cross-browser functionality. * Fix for building form element for boolean tool parameter when default state is configured as checked in tool configuration, but user provided value is non-checked. Fixes an issue seen in workflows that prevents saving the unchecked state under described conditions. * Fix typo in BFAST. * Trackster: fix BAM display bugs, Dense display bug, better dataset selection. * Add validator to Tophat's segment mismatches parameter. * Turn off web browser autocomplete for tool search in workflows. * Fix Trackster's BAM display bugs, Dense display bug, better dataset selection. * Add validator to Tophat's segment mismatches parameter. * Added the ctypes egg so the DRMAA egg will now work under Python 2.4. * Bug fixes to the Mac OS X launcher in the galaxy-dist/contrib/ folder (from Florent Angly). * Python reports the wrong platform when running a 32-bit Python on 64-bit Linux, so Galaxy now forces the correct platform in this environment (thanks David Hoover). * Fix Chrome not auto-saving changes to workflow checkboxes. ---- About Galaxy Galaxy is supported in part by NSF, NHGRI, the Huck Institutes of the Life Sciences, and The Institute for CyberScience at Penn State. Core Team http://bitbucket.org/galaxy/galaxy-central/wiki/GalaxyTeam Use Galaxy! http://usegalaxy.org GalaxyProject.org http://galaxyproject.org|GalaxyProject.org Development Home http://bitbucket.org/galaxy/galaxy-central ---- Galaxy Team January 31, 2011

1 0

does Galaxy record tool versions?
by Yury Bukhman 28 Jan '11

28 Jan '11

Hi, in order to reproduce an analysis, it's good to know not only what tools were used, but also their versions. Is there a way to figure that out from a Galaxy history? I would like to be able to answer questions like "what version of bowtie have I run in an analysis performed 6 months ago?" Thanks. Yury -- Yury V. Bukhman, Ph.D. Associate Scientist, Bioinformatics Great Lakes Bioenergy Research Center University of Wisconsin - Madison 445 Henry Mall, Rm. 513 Madison, WI 53706, USA Phone: 608-890-2680 Fax: 608-890-2427 Email: ybukhman(a)glbrc.wisc.edu

3 4

Re: [galaxy-user] Extract sequences from [gtf file] + [genome FASTA file]
by Jennifer Jackson 28 Jan '11

28 Jan '11

-------- Original Message -------- Subject: Re: [galaxy-user] Extract sequences from [gtf file] + [genome FASTA file] Date: Thu, 27 Jan 2011 17:23:11 -0700 From: Brian Foley PhD <btf(a)lanl.gov> To: Jennifer Jackson <jen(a)bx.psu.edu> Dear Jen, I am not much of a Galaxy user yet, but a long time user of GenBank and other databases and sequence analysis tools (Phylogenetics software, etc). A common task I would like to do, is obtain a FASTA format file (ideally aligned, but I can do the alignment later very easily) of the regions of sequences hit in a BLAST search on GenBank. It is easy to ask GenBank to give me all (or the selected few) sequences hit in the BLAST search, but not so easy to get each sequence "clipped" to the matched region. For example, if I search with the D-loop region of a mammal mitochondrial genome, I would like to get that region clipped out of all the hundreds of complete mitochondrial genomes. Or if I search with a mammalian endogenous retrovirus, get the retroviruses clipped from the complete chromosome entries. Ideally, I would add one more criteria. I would add that I would like to be able to get some number of bases (lets say 100) flanking the matched region. So I could capture the integration sites of endogenous retroviruses, for example. Or get the intron flanks of a gene if I was searching with a mammalian gene exon. The final thing would be to deal with the fact that GenBank BLAST match results often get fragmented. For example the LTRs of retroviruses (endogenous or not) create a problem. And any large in/dels or highly variable regions often split one contiguous homologous string into two individual matches split at the in/del or variable site. This looks somewhat similar to the task you describe below, so I am wondering if it is something I can do in Galaxy (or with Galaxy plus a few other tools). GenBank/BLAST will almost give me what I want. The trouble I find is that either I can get the result as a multiple sequence alignment but with useless sequence names (just the gi number for identifier) and not in FASTA format, or I can get full sequence entries but not the matched region clipped out. I have asked NCBI/GenBank if they would serve up the results in FASTA format, but they are not responsive on that. Brian Foley PhD HIV Databases btf(a)lanl.gov http://www.hiv.lanl.gov On 1/27/11 1:36 PM, "Jennifer Jackson" <jen(a)bx.psu.edu> wrote: > Hello Karen, > > The following general workflow should help you to pull sequences from > any source. > > 1) cut out the sequence IDs from the query (in this case, a GTF & BED > file) and sort them. > Text Manipulation -> Cut columns from a table > Filter and Sort -> Sort > 2) convert the target fasta file to tabular format > Convert Formats -> FASTA-to-Tabular converter > 3) join the two datasets based on the sequence ID > Join, Subtract and Group -> Join two Queries > 4) covert to fasta > Convert Formats -> Tabular-to-FASTA > 5) when starting with a GTF file, there will most likely be duplicates. > To remove, use: > NGS: QC and manipulation -> Collapse sequences > > Once you create the actual workflow that performs the job, be sure to > save it so that you can just re-use it whenever you need to perform the > same task. To do this, from the history pane (most right) use Options -> > Extract workflow and following the instructions on the form to customize. > > Hopefully this helps, > > Jen > Galaxy team

1 0

Browser support for Galaxy
by Sonali Amonkar 28 Jan '11

28 Jan '11

Hi, (It was good to hear about that there is another release upcoming very soon. Looking forward to it.) I came across an issue in IE8 of the Workflow design progress bar not closing for a long time. When I tried it in Mozilla Firefox it worked fine. I also found that the history pane in Firefox does not refresh often. Even when done manually, however is works just fine in IE8. Is there any piece of document mentioning the browser support for Galaxy? Thank you for your time. Warm Regards, Sonali Amonkar DISCLAIMER ========== This e-mail may contain privileged and confidential information which is the property of Persistent Systems Ltd. It is intended only for the use of the individual or entity to which it is addressed. If you are not the intended recipient, you are not authorized to read, retain, copy, print, distribute or use this message. If you have received this communication in error, please notify the sender and delete all copies of this message. Persistent Systems Ltd. does not accept any liability for virus infected mails.

1 0