- galaxy-user - lists.galaxyproject.org

MACs empty file format
by Keith E. Giles 05 Jan '11

05 Jan '11

I can not seem to get MACs to call peaks for some very large data sets (30 million aligned reads). I know that this is a computational issue and not a matter of there not being peaks. Do the ChIP and Input files need to be in BED-3? If not, what type of file format do they need to be in? They are in BED, but do have different numbers of columns.

1 0

slow ftp uploads
by djkowbel＠berkeley.edu 05 Jan '11

05 Jan '11

Hello. I am having trouble uploading my sequence fastq files. They are uploading at extremely slow speeds of ~40K/sec, using ftp from our server or from Fetch. Since these are 3Gbyte files, this will take a day to upload. Any suggestions? -- David Kowbel Dept. Plant and Microbial Biology University of California Berkeley Berkeley, California email: djkowbel(a)berkeley.edu 510-643-2546

2 1

Re: [galaxy-user] Fwd: Need a generous help regarding uploading
by Jennifer Jackson 03 Jan '11

03 Jan '11

Hello Vasu, Are you still having problems? Or did this other reply help? http://gmod.827538.n3.nabble.com/Bam-file-after-Tophat-run-td2089789.html#a… If the problem is persistent, Galaxy needs to be updated to get better UI support for downloading BAM files. Hopefully the problem can be resolved, but please let us know if you need more help. Thanks! Jen Galaxy team On 12/15/10 12:23 PM, vasu punj wrote: > I have submited your email to share job 31 and 25 are the Tophat runs > which I am trying to save as bam files from Floppy icon. > The job is run on our University cluster. I have alos enclosed screen > shot for your ready reference. > vasu > > --- On *Wed, 12/15/10, Jennifer Jackson /<jen(a)bx.psu.edu>/* wrote: > > > From: Jennifer Jackson <jen(a)bx.psu.edu> > Subject: Re: [galaxy-user] Fwd: Need a generous help regarding uploading > To: "vasu punj" <punjv(a)yahoo.com> > Cc: "galaxy-user(a)bx.psu.edu" <galaxy-user(a)bx.psu.edu> > Date: Wednesday, December 15, 2010, 10:02 AM > > Hello Asifullah, > > It would be helpful if you would be able to share your history. Please > note which exact datasets (by number) you are having problems saving. > > Use Options -> Share or Publish -> click on the button to Share via > link > and then email that to me. > > Thank you, > > Jen > Galaxy team > > On 12/15/10 7:56 AM, vasu punj wrote: > > I have done the same it gav eme bam index file when i removed the > > extension index or as such it come out to be not right bam file > format > > as recognized by various tools > > Thanks > > > > --- On *Wed, 12/15/10, Jennifer Jackson /<jen(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=jen@bx.psu.edu>>/* wrote: > > > > > > From: Jennifer Jackson <jen(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=jen@bx.psu.edu>> > > Subject: Re: [galaxy-user] Fwd: Need a generous help regarding > uploading > > To: "vasu punj" <punjv(a)yahoo.com > <http://us.mc1147.mail.yahoo.com/mc/compose?to=punjv@yahoo.com>> > > Cc: "galaxy-user(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@bx.psu.edu>" > <galaxy-user(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@bx.psu.edu>> > > Date: Wednesday, December 15, 2010, 9:52 AM > > > > Hello Asifullah, > > > > Click on the "save" icon for the dataset to initiate a download. This > > icon is shaped like a little purple disk on the very left side of the > > dataset's box in the right history pane. > > > > Hopefully this is helpful, > > > > Thank you, > > > > Jen > > Galaxy team > > > > On 12/15/10 7:47 AM, vasu punj wrote: > > > Hi, > > > Can we save Bam file from Tophat out put if so how can we do that > > please. > > > Thanks. > > > > > > --- On *Wed, 12/15/10, Jennifer Jackson /<jen(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=jen@bx.psu.edu> > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=jen@bx.psu.edu>>/* > wrote: > > > > > > > > > From: Jennifer Jackson <jen(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=jen@bx.psu.edu> > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=jen@bx.psu.edu>> > > > Subject: Re: [galaxy-user] Fwd: Need a generous help regarding > > uploading > > > To: "asifullah khan" <asifullah111(a)gmail.com > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com>> > > > Cc: galaxy-user(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@bx.psu.edu> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@bx.psu.edu> > > > Date: Wednesday, December 15, 2010, 9:38 AM > > > > > > Hello Asifullah, > > > > > > The Galaxy tool "Get Data -> Upload File" has instructions for > > > uploading > > > data to the FTP server. We recommend using the 3rd party utility > > > FileZilla as a desktop FTP client. > > > > > > http://file-zilla.com/ > > > > > > Hopefully this will get you started, > > > > > > Best! > > > > > > Jen > > > Galaxy team > > > > > > ps: In the future, if you could send questions directly to > > > galaxy-user(a)bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@bx.psu.edu> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@bx.psu.edu> > > > > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@bx.psu.edu>, > > > it would be very helpful for us. > > > > > > On 12/12/10 8:32 AM, Kelly Vincent wrote: > > > > > > > > > > > > Begin forwarded message: > > > > > > > >> *From: *asifullah khan <asifullah111(a)gmail.com > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com> > > > > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com> > > > >> <mailto:asifullah111@gmail.com > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com> > > > > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=asifullah111@gmail.com>>> > > > >> *Date: *December 12, 2010 11:01:27 AM EST > > > >> *To: *galaxy-user-owner(a)lists.bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user-owner@lists.bx.ps…> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user-owner@lists.bx.ps…> > > > > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user-owner@lists.bx.ps…> > > > >> <mailto:galaxy-user-owner@lists.bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user-owner@lists.bx.ps…> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user-owner@lists.bx.ps…> > > > > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user-owner@lists.bx.ps…>> > > > >> *Subject: **Need a generous help regarding uploading* > > > >> > > > >> Dear All, > > > >> > > > >> I am in trouble to upload 1.2Gb illumine data on Galaxy page for > > > >> subsequent assembling and analysis steps. I am basically a > > biologist > > > >> and new regarding utility of modern bioinformatics tools. > some one > > > >> have suggested to upload first your data on a http web page > > then it > > > >> would be easy to be uploaded on GALaxy. But it is also not > > possible > > > >> for me as having little computer knowledge. So could some one > > > help me > > > >> generously regarding these issue. I will highly appreciate > > > his/her help. > > > >> > > > >> Regards > > > >> Asifullah Khan > > > > > > > > > > > > > > > > _______________________________________________ > > > > galaxy-user mailing list > > > > galaxy-user(a)lists.bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@lists.bx.psu.edu> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@lists.bx.psu.edu> > > > > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@lists.bx.psu.edu> > > > > http://lists.bx.psu.edu/listinfo/galaxy-user > > > > > > -- > > > Jennifer Jackson > > > http://usegalaxy.org <http://usegalaxy.org/> > <http://usegalaxy.org/> <http://usegalaxy.org/> > > > _______________________________________________ > > > galaxy-user mailing list > > > galaxy-user(a)lists.bx.psu.edu > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@lists.bx.psu.edu> > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@lists.bx.psu.edu> > > > > > > <http://us.mc1147.mail.yahoo.com/mc/compose?to=galaxy-user@lists.bx.psu.edu> > > > http://lists.bx.psu.edu/listinfo/galaxy-user > > > > > > > > > > -- > > Jennifer Jackson > > http://usegalaxy.org <http://usegalaxy.org/> <http://usegalaxy.org/> > > > > > > -- > Jennifer Jackson > http://usegalaxy.org <http://usegalaxy.org/> > > -- Jennifer Jackson http://usegalaxy.org

1 0

add other genomes to galaxy
by Wei,Xintao 03 Jan '11

03 Jan '11

Hi, Is there any chance to add a new genome reference to the Galaxy browser? I am working on the chip-seq data of Trypanosome brucei 927, and the T. brucei genome is not available on the Galaxy browser version. Thank you! Xintao

2 1

Advanced text manipulations in Galaxy
by Maxim Ivanov 03 Jan '11

03 Jan '11

Hello, Sorry for possibly stupid question. Could you advise me whether there are any ways in Galaxy to perform specific manipulations on DNA sequences like: "Substitute all Gs to Cs (except for CG dinucleotides)": Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT or like: "Count the number of CG dinucleotides" Input: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT Output: chr1 9078238 9078358 Bait1 ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT 4 using built-in tools (e.g. specific expressions in the "Compute" tool), or this task cannot be done without programming skills? Thank you in advance! With respect, Maxim Ivanov Dept. of Physiology and Pharmacology Karolinska Institutet Stockholm, Sweden

2 1

query related to lift over
by vaibhav jain 03 Jan '11

03 Jan '11

Hi all,I have data with RGSC 3.4 build, along with the start and end coordinates of genes. I want to use lift-over tool to get the corresponding coordinates of those genes for Rat Nov. 2004 (Baylor 3.4/rn4) Assembly. So how I can do this using lift-over ???Or is there any other method to do this work ??? Thanks in advance Vaibhav Jain Research Scholar @IGIB Delhi, INDIA

2 1

Zipping files to download
by Cristian Rojas 03 Jan '11

03 Jan '11

I would like to know if it is possible zip files in Galaxy before download to my computer. How can I do this? Thnks. Regards, Cristian

2 1

Error in running Cuffcompare
by vasu punj 03 Jan '11

03 Jan '11

I get the error message run Cuff compare with Cufflinks- GTF file and Ensembl file downloaded to Galaxy. To download Ensembl file Is used following procedure: Get Data --> UCSC Main select clade/genome/assembly for group, use 'Genes and Gene Prediction Tracks' for track, use Ensembl for table, choose the default (enGene) region: genome output format: GTF The error message is:Error in cuffcompare: [Errno 2] No such file or directory: '/tmp/9935868.hpc-pbs.usc.edu/tmpGXnESn/input1.tmap' Begin PBS Prologue Thu Dec 23 16:29:09 PST 2010 Job ID: 9935868.hpc-pbs.usc.edu Username: ramjan Group: hsc-ar Name: 84_cuffcompare_ramjan(a)usc.edu Queue: laird Shared Access: yes Nodes: hpc2712 TMPDIR: /tmp/9935868.hpc-pbs.usc.edu End PBS Prologue Thu Dec 23 16:29:09 PST 2010 ---------------------------------------- Warning: no access to tty (Bad file descriptor). Thus no job control in this shell. ---------------------------------------- Begin PBS Epilogue Thu Dec 23 16:29:21 PST 2010 Job ID: 9935868.hpc-pbs.usc.edu Username: ramjan Group: hsc-ar Job Name: 84_cuffcompare_ramjan(a)usc.edu Session: 29712 Limits: neednodes=1:ppn=8,nodes=1:ppn=8,walltime=100:00:00 Resources: cput=00:00:09,mem=62512kb,vmem=288372kb,walltime=00:00:12 Queue: laird End PBS Epilogue Thu Dec 23 16:29:21 PST 2010 ----------------------------------------

3 2

Re: [galaxy-user] Question about using replicate samples and Refrence Ensembl
by Jeremy Goecks 23 Dec '10

23 Dec '10

Hi Vasu, Please cc the galaxy-user email list so that everyone can benefit from this discussion and so that it is archived. On to your questions: >> OK I have two replicates of sample. My question is when I have to run Cuffcompare or cuffdiff I have to use them as single file in RNA seq analysis. Either I can combine bam files or combine before running Tophat. What is suggested. The answer depends on what you're looking for. There are two options: (1) If you're looking for differences between the two samples--e.g. the samples came from two different tissues or from two different time periods in the same tissue--you should run each sample through Tophat & Cufflinks and then run Cuffcompare and Cuffdiff on the GTF files generated by Cufflinks. (2) If you're looking for differences within the two samples--e.g. the samples are two lanes of sequencing data from the same biological replicate--then you should combine all your reads before running Tophat-->Cufflinks-->Cuffcompare. >> >> Secondly I have downloaded Ensembl file as suggested by You but than how to make it happen that when I do the analysis Cufflink or cuffcompare read this file. The Ensemble gene annotation GTF should be used as the "reference" for Cuffcompare; optionally, you can also use the GTF as a reference for Cufflinks as well. Best, J.

1 0

Question about using replicate samples and Refrence Ensembl
by vasu punj 22 Dec '10

22 Dec '10

I am running RNA seq and while I have to run Tophat how can I include replicates of samples than secondly I need to include Ensembl reference database for getting IDs in Cufflinker I don’t see any option in Galaxy? Any suggestion please.

2 1