- galaxy-user - lists.galaxyproject.org

running R in Galaxy
by Bree, Freddy de 21 Sep '10

21 Sep '10

I've been trying to run R in Galaxy. 1. Running it as "R" is a hassle, because Galaxy cannot deal with source and input file and output file using "--args" and "<" (< in xml) and ">" (> in xml). 2. Running it through "perl" is also a hassle, because Galaxy needs to have an input file through the cmd line, whilst "R" needs: - input file (the location of it, not the content) - source file (.R file) - output file BUT you need to pipe -this- input for perl through to R VIA the system() call. Anybody any luck with this? (everything runs without Galaxy btw, but that is not the aim) Freddy

4 3

Re: [galaxy-user] running R in Galaxy
by Bree, Freddy de 21 Sep '10

21 Sep '10

Thanks again! This solves it I think. I re-directed this to galaxy-user, because it is clear that some of you do not know this either. ;) ________________________________________ From: James Taylor [james(a)jamestaylor.org] Sent: 21 September 2010 13:21 To: Bree, Freddy de Subject: Re: [galaxy-user] running R in Galaxy Yes, tools/stats/r_wrapper.sh On Sep 21, 2010, at 7:16 AM, Bree, Freddy de wrote: > Thanks for the tip, but do you mean in Galaxy? > > ________________________________________ > From: James Taylor [james(a)jamestaylor.org] > Sent: 21 September 2010 13:06 > To: Bree, Freddy de > Cc: galaxy-user(a)lists.bx.psu.edu > Subject: Re: [galaxy-user] running R in Galaxy > > On Sep 21, 2010, at 5:30 AM, Bree, Freddy de wrote: > >> 1. Running it as "R" is a hassle, because Galaxy cannot deal with >> source and input file and output file using "--args" and >> "<" (< in xml) and ">" (> in xml). > > We use a small shell script called r_wrapper.sh which is included in > the distribution.

1 0

Re: [galaxy-user] running R in Galaxy
by Bree, Freddy de 21 Sep '10

21 Sep '10

Dear all, In addition tot he previous. I can feed the source file (Rfile) and the data file to the system() call for R, but how do I capture the output back in perl? Freddy

1 0

Galaxy FASTA tool - Bug
by gireesh bogu 19 Sep '10

19 Sep '10

Dear Galaxy I found a bug in extracting FATSA sequence tool in galaxy. I extracted sequence of this location chr10 123229360 123229525 fgfr2 0 - >hg18_chr10_123229360_123229525_- GAATACTTGGACCTCAGCCAACCTCTCGAACAGTATTCACCTAGTTACCC TGACACAAGAAGTTCTTGTTCTTCAGGAGATGATTCTGTTTTTTCTCCAG ACCCCATGCCTTACGAACCATGCCTTCCTCAGTATCCACACATAAACGGC AGTGTTAAAACATGA And I checked back in UCSC browser by pasting the same location. The sequences are completely different (hg18). Could you please help me in this issue Thanx Gireesh

6 8

Re: [galaxy-user] mapping with fasta files
by Kelly Vincent 17 Sep '10

17 Sep '10

> > Hello, > > Yes, you can generate a FASTQ file with dummy quality scores from a > FASTA file. Use the Combine FASTA and QUAL into FASTQ tool under > NGS: QC and manipulation-->ROCHE-454 DATA. For the Quality Score > File, leave it set with the default option ("Selection is > Optional"). The quality value will be ~ for each base > > Regards, > Kelly > > > On Sep 17, 2010, at 4:10 PM, Ada Sedova wrote: > >> Dear galaxy, >> I have some sequence data that is in fasta format, and I would >> really like to run bowtie on it for mapping. The bowtie article >> claims that bowtie can map with fasta files, but galaxy does not >> allow it. Is there anything I can do to fix this? For instance, is >> there a way to add some kind of q values to the file so it will run? >> Thanks >> _______________________________________________ >> galaxy-user mailing list >> galaxy-user(a)lists.bx.psu.edu >> http://lists.bx.psu.edu/listinfo/galaxy-user >

1 0

mapping with fasta files
by Ada Sedova 17 Sep '10

17 Sep '10

Dear galaxy, I have some sequence data that is in fasta format, and I would really like to run bowtie on it for mapping. The bowtie article claims that bowtie can map with fasta files, but galaxy does not allow it. Is there anything I can do to fix this? For instance, is there a way to add some kind of q values to the file so it will run? Thanks

1 0

Solid 2 Fastq
by juan perin 15 Sep '10

15 Sep '10

I'm getting errors in running our solid to fastq conversion tool. I'm not sure why, we have sqlite installed... This is the error. Perhaps i'm overlooking another dependency? Traceback (most recent call last): File "/home/perin/galaxy/galaxy-dist/tools/next_gen_conversion/solid2fastq.py", line 7, in ? import sqlite3 ImportError: No module named sqlite3 Thanks in advance. Juan

2 1

PCA -- princomp or prcomp
by zod 14 Sep '10

14 Sep '10

Hi, Is it possible to add the R's 'prcomp' function to the PCA tool? Or just switch the tool to use 'prcomp' instead of 'princomp'? Thanks, David

2 2

subscription
by Inbar Plaschkes 14 Sep '10

14 Sep '10

inbar.plaschkes(a)gmail.com -- ______________________________________________________________ Inbar Plaschkes Bioinformatics Core Facility National Institute for Biotechnology in the Negev Building 51, room 314 Ben-Gurion University of the Negev Beer-Sheva 84105, Israel Email: inbar.plaschkes(a)gmail.com Tel: 08-6479034 054-7915931 Fax: 08-6472983 http://bioinfo.bgu.ac.il

1 0

Error after upgrade
by Farhat Habib 13 Sep '10

13 Sep '10

Dear All, After upgrading using hg pull -u -r f09915c8da94 then, hg diff after which it asked me to upgrade db which I did using, sh manage_db.sh upgrade Galaxy fails to start on my local install. galaxy.model.custom_types DEBUG 2010-09-13 11:41:18,475 pysqlite>=2 egg successfully loaded for sqlite dialect Traceback (most recent call last): File "/home/farhat/galaxy-central/lib/galaxy/web/buildapp.py", line 82, in app_factory app = UniverseApplication( global_conf = global_conf, **kwargs ) File "/home/farhat/galaxy-central/lib/galaxy/app.py", line 42, in __init__ self.tool_data_tables = galaxy.tools.data.ToolDataTableManager( self.config.tool_data_table_config_path ) File "/home/farhat/galaxy-central/lib/galaxy/tools/data/__init__.py", line 22, in __init__ self.add_from_config_file( config_filename ) File "/home/farhat/galaxy-central/lib/galaxy/tools/data/__init__.py", line 31, in add_from_config_file tree = util.parse_xml( config_filename ) File "/home/farhat/galaxy-central/lib/galaxy/util/__init__.py", line 101, in parse_xml tree = ElementTree.parse(fname) File "/home/farhat/galaxy-central/eggs/elementtree-1.2.6_20050316-py2.6.egg/elementtree/ElementTree.py", line 859, in parse tree.parse(source, parser) File "/home/farhat/galaxy-central/eggs/elementtree-1.2.6_20050316-py2.6.egg/elementtree/ElementTree.py", line 576, in parse source = open(source, "rb") IOError: [Errno 2] No such file or directory: './tool_data_table_conf.xml' Any help with rectifying this? Yours, -Farhat

2 2