- galaxy-user - lists.galaxyproject.org

Problems Adding a Custom Build
by Mackenzie Gavery 26 Apr '13

26 Apr '13

Hi, I am having problems that I think are related: *1. * I have not been able to visualize (in Trackster) a custom build that I recently added (Trackster says: "Could not load chroms for this dbkey:"). In addition, when I try to Operate on Genomic Intervals using bed files associated with that particular build I get an error: Error executing tool: maximum recursion depth exceeded while calling a Python object 2. Now I am trying to add a new custom build to see if there was something wrong with the previous build, and I get an error right after I click on "Add a new Custom Build" in the New Visualization menu (*The error has been logged to our team.* If you want to contact us about this error, please reference the following *GURU MEDITATION: #9e466e8a843e4ce9be878f3223bb0be4)* * * I am just wondering if anyone is having similar issues? Or if this is a temporary problem? Thanks, Mackenzie

2 1

Join, Subtract and Group PLUS large GOA files
by Colleen Burge 25 Apr '13

25 Apr '13

Hello all, I've been using the "Join, Subtract and Group" to join my transcriptome/annotation data to GO and GO Slim for some time (in the Main galaxy). I just updated my GO files as I've run a a new data set, and have been having trouble with the joining function, it never seems to complete (while before it would be done in just a few minutes). It works just fine joining my "new data" with my "old" GO files (which of course are now out of date) but not the new GO files from both my collaborator and from EBI (specifically the unipro). Not sure if its a file size limitation? Thanks, Colleen

3 3

ImportError: Unable to run arch-specific checks
by Shun Liang 25 Apr '13

25 Apr '13

Dear Galaxy Developers, I am trying to run Galaxy on ARM architecture. I am able to scramble the eggs locally. However, I am unable to run Galaxy on my machine as "run.sh" gives an error after some initialization steps: galaxy@arm01-48:/mnt/ceph/galaxy/galaxy-dist$ ./run.sh Initializing datatypes_conf.xml from datatypes_conf.xml.sample Initializing external_service_types_conf.xml from external_service_types_conf.xml.sample Initializing migrated_tools_conf.xml from migrated_tools_conf.xml.sample Initializing reports_wsgi.ini from reports_wsgi.ini.sample Initializing shed_tool_conf.xml from shed_tool_conf.xml.sample Initializing tool_conf.xml from tool_conf.xml.sample Initializing shed_tool_data_table_conf.xml from shed_tool_data_table_conf.xml.sample Initializing tool_data_table_conf.xml from tool_data_table_conf.xml.sample Initializing tool_sheds_conf.xml from tool_sheds_conf.xml.sample Initializing data_manager_conf.xml from data_manager_conf.xml.sample Initializing shed_data_manager_conf.xml from shed_data_manager_conf.xml.sample Initializing openid_conf.xml from openid_conf.xml.sample Initializing tool-data/shared/ncbi/builds.txt from builds.txt.sample Initializing tool-data/shared/ensembl/builds.txt from builds.txt.sample Initializing tool-data/shared/ucsc/builds.txt from builds.txt.sample Initializing tool-data/shared/ucsc/publicbuilds.txt from publicbuilds.txt.sample Initializing tool-data/shared/igv/igv_build_sites.txt from igv_build_sites.txt.sample Initializing tool-data/shared/rviewer/rviewer_build_sites.txt from rviewer_build_sites.txt.sample Initializing tool-data/add_scores.loc from add_scores.loc.sample Initializing tool-data/alignseq.loc from alignseq.loc.sample Initializing tool-data/all_fasta.loc from all_fasta.loc.sample Initializing tool-data/annotation_profiler_options.xml from annotation_profiler_options.xml.sample Initializing tool-data/annotation_profiler_valid_builds.txt from annotation_profiler_valid_builds.txt.sample Initializing tool-data/bfast_indexes.loc from bfast_indexes.loc.sample Initializing tool-data/binned_scores.loc from binned_scores.loc.sample Initializing tool-data/blastdb.loc from blastdb.loc.sample Initializing tool-data/blastdb_p.loc from blastdb_p.loc.sample Initializing tool-data/bowtie2_indices.loc from bowtie2_indices.loc.sample Initializing tool-data/ccat_configurations.loc from ccat_configurations.loc.sample Initializing tool-data/codingSnps.loc from codingSnps.loc.sample Initializing tool-data/encode_datasets.loc from encode_datasets.loc.sample Initializing tool-data/faseq.loc from faseq.loc.sample Initializing tool-data/funDo.loc from funDo.loc.sample Initializing tool-data/gatk_annotations.txt from gatk_annotations.txt.sample Initializing tool-data/gatk_sorted_picard_index.loc from gatk_sorted_picard_index.loc.sample Initializing tool-data/liftOver.loc from liftOver.loc.sample Initializing tool-data/maf_index.loc from maf_index.loc.sample Initializing tool-data/maf_pairwise.loc from maf_pairwise.loc.sample Initializing tool-data/microbial_data.loc from microbial_data.loc.sample Initializing tool-data/mosaik_index.loc from mosaik_index.loc.sample Initializing tool-data/ngs_sim_fasta.loc from ngs_sim_fasta.loc.sample Initializing tool-data/perm_base_index.loc from perm_base_index.loc.sample Initializing tool-data/perm_color_index.loc from perm_color_index.loc.sample Initializing tool-data/phastOdds.loc from phastOdds.loc.sample Initializing tool-data/picard_index.loc from picard_index.loc.sample Initializing tool-data/quality_scores.loc from quality_scores.loc.sample Initializing tool-data/regions.loc from regions.loc.sample Initializing tool-data/sam_fa_indices.loc from sam_fa_indices.loc.sample Initializing tool-data/sequence_index_base.loc from sequence_index_base.loc.sample Initializing tool-data/sequence_index_color.loc from sequence_index_color.loc.sample Initializing tool-data/sift_db.loc from sift_db.loc.sample Initializing tool-data/srma_index.loc from srma_index.loc.sample Initializing tool-data/twobit.loc from twobit.loc.sample Initializing static/welcome.html from welcome.html.sample Traceback (most recent call last): File "/mnt/ceph/galaxy/galaxy-dist/lib/galaxy/webapps/galaxy/buildapp.py", line 36, in app_factory from galaxy.app import UniverseApplication File "/mnt/ceph/galaxy/galaxy-dist/lib/galaxy/app.py", line 17, in <module> from galaxy.visualization.data_providers.registry import DataProviderRegistry File "/mnt/ceph/galaxy/galaxy-dist/lib/galaxy/visualization/data_providers/registry.py", line 2, in <module> from galaxy.visualization.data_providers import genome File "/mnt/ceph/galaxy/galaxy-dist/lib/galaxy/visualization/data_providers/genome.py", line 13, in <module> import numpy File "/mnt/ceph/galaxy/galaxy-dist/eggs/numpy-1.6.0-py2.7-linux-armv7l-ucs4.egg/numpy/__init__.py", line 137, in <module> import add_newdocs File "/mnt/ceph/galaxy/galaxy-dist/eggs/numpy-1.6.0-py2.7-linux-armv7l-ucs4.egg/numpy/add_newdocs.py", line 9, in <module> from numpy.lib import add_newdoc File "/mnt/ceph/galaxy/galaxy-dist/eggs/numpy-1.6.0-py2.7-linux-armv7l-ucs4.egg/numpy/lib/__init__.py", line 4, in <module> from type_check import * File "/mnt/ceph/galaxy/galaxy-dist/eggs/numpy-1.6.0-py2.7-linux-armv7l-ucs4.egg/numpy/lib/type_check.py", line 8, in <module> import numpy.core.numeric as _nx File "/mnt/ceph/galaxy/galaxy-dist/eggs/numpy-1.6.0-py2.7-linux-armv7l-ucs4.egg/numpy/core/__init__.py", line 5, in <module> import multiarray ImportError: /mnt/ceph/galaxy/galaxy-dist/eggs/numpy-1.6.0-py2.7-linux-armv7l-ucs4.egg/numpy/core/multiarray.so: Unable to run arch-specific checks May I ask if anyone has any idea about this error? Many thanks. Best regards, Shun

2 2

Teaching using Galaxy
by David Joly 25 Apr '13

25 Apr '13

Hi everybody! I am currently creating a "bioinformatics" course for undergraduate (biology students with no knowledge of programming). I would like to use Galaxy as their everyday platform where they would learn the basics and use the appropriate tools (BLAST and databases, multiple alignment, phylogenetics, dealing with "omics" data, and so on). Is there any available resources about using Galaxy for teaching (undergraduates)? Any suggestions of good textbooks? Not a Galaxy textbook of course, but a "bioinformatics textbook" that would be a good companion to help the students understand the basics behind the tools. Thanks, DJ

3 5

preprocessing gDNA illumina paired end data for mapping/snp calling
by Timothy Brennan 24 Apr '13

24 Apr '13

This question is w/ regards to pre-processing whole genome resequencing data for mapping data to a reference yeast strain. I'm having trouble joining paired end data. I have two files per sample (read1 and read2). I've successfully uploaded my fastq.gz files into galaxy using FTP. I have two fastq files for each direction per strain labelled for example: (for the left hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.1.fastq (for the right hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.2.fastq Now once I groom each using FASTQ Groomer I'm trying to join them to get a single file and I'm joining 0% of the reads. So I think the header or directory is not in the correct format. E.g., the raw groomed reads for the left hand and right hand look like: (for the left hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.1.fastq @HWI-ST1240:133:H0854ADXX:2:1101:2716:1998 1:N:0:CCGTCC NGTATGGAAGACGTAGAGTGGATGAAAATTTTGTGAAAAAAAAAAGCTTATAGGAACAAAAACATCCTTACATCTTCGGGTATTTCTTCTAGGGTTGAAGT + !!!%%%%%)))))**(*(!$()(((***(***')(**********)'))%!!%&%$$$$$####$$$$$$"$!!""!!##!!!!$$%$""!!"#$#!!!!! @HWI-ST1240:133:H0854ADXX:2:1101:5045:1994 1:N:0:CCGTCC NCCAGACACAGTTAACGCAACCTGACATGCAACAGTTATCGGGTTCTTGTGGTTTTGCAGGCACTTGGACACCTGCTATTTTCTTCGTTCCGCCGCTAAGC (for the right hand dir) 130104_7001240_0133_AH0854ADXX.lane_2.CCGTCC.2.fastq @HWI-ST1240:133:H0854ADXX:2:1101:2716:1998 2:N:0:CCGTCC GCATAGTTACTTTTTGATCACTAACAACGATATATTATCGTTGAACAATTTACTACGCAAAACAGTTCACGTGATGTACGTCAGATAATTCACTGAAGGTA + $$$''''')))))++++++(+++++++++++++++++*+*++*++++++++++*++++*+++++*))))))''''&'&'%&%%%%$%%%'&%%%%%$%%$! @HWI-ST1240:133:H0854ADXX:2:1101:5045:1994 2:N:0:CCGTCC ATGTATTATAAGCCCGAATCAGATACTCAAATTTGAAAAAAGATATCTTTCTCCTCCGACATGGCCGAACTCATTTACATAAATAGCATAAATTAAACAGA According to the wiki I think the fastq format should look something like this with /1 and /2 corresponding the each paired file. @61CC3AAXX100125:7:118:2538:5577/1 GACACCTTTAATGTCTGAAAAGAGACATTCACCATCTATTCTCTTGGAGGGCTACCACCTAAGAGCCTTCATCCCC + ?>CADFEEEBEDIEHHIDGGGEEEEHFFGIGIIFFIIEFHIIIIHIIFFIIIDEIIGIIIEHFFFIIEHIFA@?== @61CC3AAXX100125:7:1:17320:13701/1 CTCAGAAGACCCTGAGAACATGTGCCCAAGGTGGTCACAGTGCATCTTAGTTTTGTACATTTTAGGGAGATATGAG + ?BCAAADBBGGHGIDDDGHFEIFIIIIFGEIFIIFIGIGEFIIGGIIHEFFHHHIHEIFGHHIEFIIEECE?>@89 Any suggestions on how to get the files in the correct format/header to be able to join them? Last question, what is the tool to trim reads based on quality again? Thanks very much gentle people Tim

2 1

Uses for Galaxy
by Priya Bhatt 23 Apr '13

23 Apr '13

Hi Galaxy Users, I'm very new to galaxy and have read/watched MANY galaxy tutorials but I have some questions for other users out there: What are the top 10 ways that you find most useful for your analysis, especially to those who work with whole genome sequencing data? Thanks for your help and insight, in advance! Best, Priya

1 0

trouble using bcf tools.
by Patrick Leahy 23 Apr '13

23 Apr '13

Dear galaxy help, Devon new user making good headway on galaxy cloud here at Case Western Reserve university in Cleveland Ohio. I have a small project. 10 human samples. I did a custom capture of exons from 171 genes. Total target size is ~ 0.5 Gb. PE reads from Illumina HighScan. See attached screenshots. I uploaded one fastq file (1.2Gb). I succeeded in doing fastQC, groomer, trimmer, allignment with Bowtie, SAM to BAM, mpileup. Now, I want to convert to .vcf. for downstream work. I got stuck at bcf tools ( see second slide). It is as if bcf tools doesn't recognize the output from mpileup. Note how the option windows in bcf tools are all collapsed. I used default parameters throughout the workflow. Any Ideas. Patrick -- Patrick Leahy, Ph.D. *Asst. Professor, General Medical Sciences- Oncology* Scientific Coordinator, Integrated Genomics Shared Resource (IGSR) Scientific Managing Director Microarray Core Facility Director, Laser Capture Microdissection Service Case Western Reserve University Room 3541 Wolstein Research Building 2103 Cornell Rd Cleveland, OH 44106 t: 216 368 0761 f: 216 368 8919 http://cancer.case.edu/members/gms_onc/leahy.html

2 1

problem with the joining of two interval dataset
by Milad Bastami 23 Apr '13

23 Apr '13

Hi every body I tried to perform a joining task on two interval dataset. The 1st had 1500 region and the second one about 2 million region.The job is still running (more than 4 hours) and it has affected system performance. I'm not sure it is normal or not. If not, I don't know it's the matter ofgalaxy limitations or my pc's hardware configurations. Any help would be appreciated. I am running galaxy local on bio-linux7 (win8 / bio-linux7 dual boot system) system configurations : CPU : core i7 9610 (6M) RAM : 8 G linux swap : 8 G linux root : >700 G Milad Bastamis, Department of Medical Genetics Shahid Beheshti's university of Medical Science

2 1

Jobs waiting to run over a week
by Benard Lab 22 Apr '13

22 Apr '13

Hi, I hope this message finds you well. I started a workflow in the public galaxy main instance on April 14th (a week ago) and I am still waiting for it to run. This has never happened before in the past two months. Is there anything I can do on my end or is it just an unusually long queue? If it is a long queue, could you give me an estimate of when my jobs will run? Thank you. I look forward to your response. Jim

2 1

Re: [galaxy-user] Regarding a cuffdiff output
by Jennifer Hillman-Jackson 19 Apr '13

19 Apr '13

Hi Yona Kim, On 4/18/13 9:54 PM, Yona Kim wrote: > Dear Jennifer > > Thank you very much for your help for my analysis. > I'm still stuck on getting the final data from Cuffdiff analysis. > As you have mentioned, I've obtained the correct GTF file (mm9 gene > annotation), and also made sure that the reference genome and GTF file > are an exact match - they both are mm9. Are you using the iGenomes version of the GTF file? With the attributes Cuffdiff requires for generating all of the additional statistics? It appears that this is the case, but I just wanted to double check. If not using it, you can find a copy to load and use on the public server (if this is where you are working) in Shared Data -> Data Libraries -> iGenomes. Otherwise, it can be found at the Cufflinks web site. These are the two attributes that are important to have, when available: http://cufflinks.cbcb.umd.edu/manual.html#cuffdiff_input > > When I view the output of transcript differential expression testing > (one of the outputs of cuffdiff) in excel, the names of the genes seem > to be properly annotated according to their location on chromosome, but > I have no values recorded for any of the calculations (I'm attaching > this file just in case you want to take a look at it). > The results you are getting indicate the data coverage is sparse, which aligns with your thoughts about this mapping not being as successful as prior runs: NOTEST and LOWDATA are explained here with advice about parameter tuning: http://wiki.galaxyproject.org/Support#Tools_on_the_Main_server follow links to Cufflinks FAQ to find: http://cufflinks.cbcb.umd.edu/faq.html#notest > Do you think that the problem might have been originated from fastq > files itself? > > And also I was wondering about the reduce in the size of the files. > Comparing with one of my other analysis in galaxy, I realized that the > size of the file was significantly reduced from 6.1GB (fastq groomer) to > 1006.9KB (Tophat accepted hits), whereas in my other analysis, the size > was reduced from 5.9GB (fastq groomer) only to 1.6 GB(Tophat accepted > hits). > > Do you think there might have been an error occurred when Tophat was > running on the groomed data, and thus, providing an erroneous data to > Cufflinks, and eventually to Cuffdiff? This could be the source of the problem. Making sure that the data was groomed correctly would be a good place the start. The comments from the first run will note the detected input type (but there can be some overlap), so also use the tool "FastQC" to help determine the proper settings for "FASTQ Groomer". And if necessary, re-run from this step to see if that improves the mapping. http://wiki.galaxyproject.org/Support#Dataset_special_cases See the second bullet under "FASTQ" If your query data is short (less than around 40 bases), then tuning Tophat could also improve mapping, see the tool's web page for advice regarding mapping shorter sequences. Then test out a few different parameter options to see what produces the best results for your particular datasets/samples. There is a balance between being too sensitive and too stringent - and this is a judgement call in most cases. Trimming the reads may help if quality is an issue ("FastQC" will also give information about this). The RNA-seq example tutorial has an example of how to do basic QC: https://main.g2.bx.psu.edu/u/jeremy/p/galaxy-rna-seq-analysis-exercise Hopefully this helps to give some new options to test out that improve the result! Jen Galaxy team > > Thank you very very much for your time and help > > Sincerely yours, > > Yona Kim > Department of Genetics > Rutgers University > > > > > On Mon, Apr 8, 2013 at 4:54 PM, Jennifer Jackson <jen(a)bx.psu.edu > <mailto:jen@bx.psu.edu>> wrote: > > Hi Yona, > > Yes, the GTF file is most likely the problem due to it lacking > certain attributes that Cuffdiff requires to perform these > calculations. You will also want to double check that the reference > genome and GTF file (where you source it next) are an exact match - > both the genome build and the identifier format. If either are not a > match, you will not get the expected or full results that Cuffdiff > can produce. > > This wiki has some help; > http://wiki.galaxyproject.org/Support#Interpreting_scientific_results > See "Tools on the Main server: Example → RNA-seq analysis tools." > > The links to the Cufflinks web site explains the attributes that > Cuffdiff is looking for, links to the iGenomes datasets available > (best to use if your genome is represented), and a pointer to the > tool's user group. Two iGenomes GTF files are also already available > in Galaxy (hg19, mm9) in "Shared Data -> Data Libraries -> > iGenomes". The link to our tutorial and FAQ has help about how the > GTF files are used along with troubleshooting advice. > > Best, > > Jen > Galaxy team > > > On 4/3/13 8:28 AM, Yona Kim wrote: >> Dear galaxy users >> >> Hello. I have a quick question about Cuffdiff analysis. >> I have obtained two SRA files and converted them to fastq files >> which were uploaded to Galaxy via FTP server. My analysis was >> followed by Fastq groomer, Tophat, Cufflinks, Cuffcompare, and >> eventually Cuffdiff. (Gene annotation was also downloaded from >> UCSC table browser in GTF format) I've downloaded gene >> differential expression testing, one of the output files of >> Cuffdiff, and viewed it in excel sheet. However, I have only zeros >> recorded for value_1, value_2, log2, test_stat and only ones >> recorded for p_value and q_value. >> >> Is it likely that I might have obtained wrong gene annotation file >> and caused this problem? >> >> Thank you >> >> Yona Kim >> Department of Genetics >> Rutgers University - New Brunswick Campus -- Jennifer Hillman-Jackson Galaxy Support and Training http://galaxyproject.org

1 0