October 2008 - galaxy-user - lists.galaxyproject.org

restart server
by very 28 Oct '08

28 Oct '08

Do you provide any program to restart the galaxy server? Currently, I just Ctrl+z to exit the run.sh, but some time it kept the port binding, so I have to restart the computer to release the port to start the server. If I work remotely, this put me into trouble.

5 4

falling back to text for tool descriptions
by James Casbon 27 Oct '08

27 Oct '08

Hi guys, I would like to be able to copy in a man page (or similar) to a tool's help file. At the moment, this fails due to the requirement for ReST. How falling back to wrapping the text in a <pre> ?: galaxy-dist james$ hg diff lib/galaxy/tools/__init__.py diff -r d2c5b964e635 lib/galaxy/tools/__init__.py --- a/lib/galaxy/tools/__init__.py Fri Oct 24 16:06:13 2008 -0400 +++ b/lib/galaxy/tools/__init__.py Mon Oct 27 11:28:01 2008 +0000 @@ -419,6 +419,7 @@ self.help = util.rst_to_html(self.help.text) except: log.exception( "error in help for tool %s" % self.name ) + self.help = "<pre>%s</pre>" % self.help.text # Multiple help page case if help_pages: for help_page in help_pages: cheers, James

2 1

add a tool
by very 24 Oct '08

24 Oct '08

Hi, Currently, my tool only print out the result on screen. When I add it into galaxy I can't see the result. Do I have to write the result into a file and make the file name as one parameter when invoking the tool, so I can see result in galaxy?

2 1

Setting galaxy up behind apache, not on server-root
by Sean Davis 23 Oct '08

23 Oct '08

I am trying to move galaxy to a non-server root location behind apache. I have set up the proxy-request stuff in the .ini file. The appropriate rewrite stuff is going on in apache, as I get a page. However, the links on those pages all refer to the server root. For example, the login link has url: http://apacheserver.example.com/user/login I would have expected to have: http://apacheserver.example.com/galaxy/user/login Any suggestions as to what I am doing wrong? Thanks, Sean

2 1

merging intervals within genes?
by Denis BAURAIN 21 Oct '08

21 Oct '08

Hello, I use the remote version of Galaxy to extract aligned blocks of 3'-UTRs. For performance reasons, I would like to merge the 3'-UTR exons that overlap before fetching MAF blocks. The 'merge overlapping intervals' option is nearly what I need except that it discards any id information attached to the exons (see below). Therefore, I wonder if it would be difficult to implement a 'gene-aware' version of the merge operation. In particular, it should not try to merge overlapping exons from overlapping genes (e.g., one on each strand). I have my own implementation of this in Perl, but it is a bit tedious to export and re-import interval files just to perform this 'compression'. # input: chr10 100133312 100133544 - ENSG00000119943 chr10 100165944 100167310 - ENSG00000107521 chr10 100165945 100167310 - ENSG00000107521 chr10 100166796 100167310 - ENSG00000107521 chr10 100208864 100209320 - ENSG00000172987 chr10 100208866 100209320 - ENSG00000172987 chr10 100209320 100209486 - ENSG00000172987 chr10 100211496 100211532 - ENSG00000172987 ... chr10 12235787 12235825 + ENSG00000065665 chr10 12237333 12237409 + ENSG00000065665 chr10 12246459 12246832 + ENSG00000065665 chr10 12246459 12247368 + ENSG00000065665 chr10 12251332 12251962 + ENSG00000065665 chr10 12248507 12248728 - ENSG00000165609 chr10 12249580 12249706 - ENSG00000165609 chr10 12249581 12249706 - ENSG00000165609 chr10 12251726 12252150 - ENSG00000165609 chr10 12252236 12252857 - ENSG00000165609 ... # current output: chr10 100133312 100133544 chr10 100165944 100167310 chr10 100208864 100209486 chr10 100211496 100211532 ... chr10 12235787 12235825 chr10 12237333 12237409 chr10 12246459 12247368 chr10 12248507 12248728 chr10 12249580 12249706 chr10 12251332 12252150 chr10 12252236 12252857 ... # desired output: chr10 100133312 100133544 - ENSG00000119943 chr10 100165944 100167310 - ENSG00000107521 chr10 100208864 100209486 - ENSG00000172987 chr10 100211496 100211532 - ENSG00000172987 ... chr10 12235787 12235825 + ENSG00000065665 chr10 12237333 12237409 + ENSG00000065665 chr10 12246459 12247368 + ENSG00000065665 chr10 12251332 12251962 + ENSG00000065665 chr10 12248507 12248728 - ENSG00000165609 chr10 12249580 12249706 - ENSG00000165609 chr10 12251726 12252150 - ENSG00000165609 chr10 12252236 12252857 - ENSG00000165609 ... Best regards, Denis BAURAIN

1 0

new local install and MySQL
by Chris Cole 15 Oct '08

15 Oct '08

Hi, Galaxy looks like a really cool tool and I'm very keen to try it out on our local set-up (Linux, BTW). This is probably the first of many questions... ;) I've got the basic setup up and running, but I saw somewhere (can't find it now) that you recommend using mysql or postgres for a live set-up. Can you point me to instructions or tell me how I can get galaxy talking to our mysql server? Cheers, Chris

2 1

Command line access to galaxy tools
by Tim Yu 15 Oct '08

15 Oct '08

hi! First, kudos to the galaxy team, it is really fantastic, and I'm really enjoying using it. Auestion: are any of the tools that are available in galaxy available for download (or extraction from the galaxy distribution), to be used from the command line? The Operate on Genomic Intervals: intersect and subtract tools are proving very useful, and I'd like to integrate them into some custom workflows we are running in our lab. Thank you very much! T Tim Yu, MD, PhD Assistant in Neurology, MGH Research Fellow, Neurogenetics, BIDMC and CHB

2 1

questions during using the local Galaxy
by Xianjun Dong 15 Oct '08

15 Oct '08

2 1

running galaxy with SGE
by Chris Cole 14 Oct '08

14 Oct '08

Hi, I'm getting the following error when trying to run galaxy over our cluster (using the unified method): Exception: SGEJobRunner requires DRMAA_python which was not found I've got what I think is the right package from here: http://gridengine.sunsource.net/howto/drmaa_python.html But I'm getting a bit out of my depth here and it's asking about 'swig'. Can I just check that I'm not doing anything stupid and that I can run this DRMAA_python in user-space rather than globally while I get to grips with the set-up? Cheers, Chris.

3 2

Query on UCSC Genome Browser software
by akatiyar＠iitk.ac.in 12 Oct '08

12 Oct '08

> Respected Sir / Ma'am, > > I want to bring forth a humble request. I am a Undergraduate > student at Indian Institute of Technology , Kanpur , India; > majoring in Biological Sciences & Bio-Engineering. > During the process of using Galaxy bio - tools I was stuck up how to > proceed in a systematic fashion so as to get an adequate solution. > I have a database of queries in the following format. > > A NM_001100917 > 0-74,1-167,2-240,3-365,4-440,5-551,6-695,7-779,8-1020, > C AAACAATCTCGATTCTAAATTGAAACGAACGCAGCATTTCAGGGACTGGATGAGGAG > 1.4 TCATTAATGGAGCTTTCTTG-GGTTCAGCAACTATGGCATG > 1.5 TCATTAATGGAGCTTTCTTG-ATTACAGTGTTGTGGCCAAC > 1.6 TCATTAATGGAGCTTTCTTG-GGGTTGTGAAAATAAAATCA > 1.7 TCATTAATGGAGCTTTCTTG-GGTTTTCCAAGTCTCATTAA > 2.3 TAATTTTTTAACAGCTTTTG-GTATGCAGTATTGATAACAT > 2.4 TAATTTTTTAACAGCTTTTG-GGTTCAGCAACTATGGCATG > 2.5 TAATTTTTTAACAGCTTTTG-ATTACAGTGTTGTGGCCAAC > 2.6 TAATTTTTTAACAGCTTTTG-GGGTTGTGAAAATAAAATCA > 2.7 TAATTTTTTAACAGCTTTTG-GGTTTTCCAAGTCTCATTAA > 3.4 TCAGATGGCTCCTAATTGTG-GGTTCAGCAACTATGGCATG > > Now I wanted them in Fasta format in the following fashion: > >> NM_001100917_1.4 > TCATTAATGGAGCTTTCTTG-GGTTCAGCAACTATGGCATG >> NM_001100917_1.5 > TCATTAATGGAGCTTTCTTG-ATTACAGTGTTGTGGCCAAC >> NM_001100917_1.6 > TCATTAATGGAGCTTTCTTG-GGGTTGTGAAAATAAAATCA > > so on.. > Therefore I humbly wanted to inquire how to get to such format through the > use of galaxy bio-tools. > I would be waiting for your reply. > > Thanking you > Your's Sincerely > Anoop Katiyar > akatiyar(a)iitk.ac.in > 4th year UnderGraduate > Dept. of B.S.B.E. > IIT Kanpur ,India. > > "Throughout the centuries there were men who took first steps, down new > roads, armed with nothing but their own vision." > > _______________________________________________

1 0