March 2011 - galaxy-user - lists.galaxyproject.org

Galaxy down
by Felix Hammer 29 Mar '11

29 Mar '11

Dear Galaxy Team! When will Galaxy approximately be up again? Thx, Felix

2 1

Pseudo Autosomal regions in Chrs X and Y
by David Matthews 29 Mar '11

29 Mar '11

Hi All again, A separate point about the analysis of cufflinks data is the subject of the Pseudo Autosomal Regions in X and Y - this will make a mess of gene expression analysis in some cases especially because tophat will assign a read to both places which therefore makes it a multihit read (which you might then filter out) or it may double the true levels of reported expression. Anyone had experience/thoughts on this? Best Wishes, David. __________________________________ Dr David A. Matthews Senior Lecturer in Virology Room E49 Department of Cellular and Molecular Medicine, School of Medical Sciences University Walk, University of Bristol Bristol. BS8 1TD U.K. Tel. +44 117 3312058 Fax. +44 117 3312091 D.A.Matthews(a)bristol.ac.uk

4 5

Re: [galaxy-user] server error trying to DL data from galaxy on cloud
by Enis Afgan 28 Mar '11

28 Mar '11

You're almost there, the command should be executed from your local machine (home directory is fine) and it should look as follows: scp -i <path to keyfile> ubuntu@<publicDNS>:/mnt/galaxyData/files/000/dataset_11.dat . (note the 'ubuntu@' before the <public DNS> and a trailing dot (.) - the dot means your current directory on your current machine, i.e., your home dir if that's where you are executing the command from) I apologize for the trouble in getting the this data out and hope it does not keep you from using Galaxy Cloud in the future (we're looking into why the browser-based data copy didn't work and should have a fix shortly for the main app). Enis On Mon, Mar 28, 2011 at 6:16 PM, <karlerhard(a)berkeley.edu> wrote: > > Hi Enis > > I'm getting the following error at the bottom of the galaxy log: > > RuntimeError: Content returned before start_response called > > I have no idea how to fix this, but I'm trying to focus now on actually > getting the files, as I don't really need this galaxy instance anymore. I > have been able to locate where my files are and which are the ones I want. > > I've tried the following command: > > scp -i <path to keyfile> > <publicDNS>:/mnt/galaxyData/files/000/dataset_11.dat > > But I just get the scp usage statement coming back. Is there something > else I'm missing here? I was executing this command in my home directory, > do I need to be somewhere else? I feel like I'm so close!!! > > Thanks so much for your help so far, I'd be lost otherwise. > > karl > > > > > > > Hi Karl, > > Hmm, not having Galaxy accessible is definitely not a step in the right > > direction. > > Being signed into command line is not an issue; something else must have > > gone wrong. To start, please take a look at the (bottom of) galaxy log > > file > > (and email the relevant part if you don't see how to fix it immediately); > > the file is saved as /mnt/galaxyTools/galaxy-central/paster.log > > > > As far as the location of the files in data libraries, they should be > > stored > > in the same location as history datasets, namely > > /mnt/galaxyData/files/000/dataset_<ID>.dat > > Because all of the datasets are named simply based on the database ID, it > > won't necessarily be obvious which file to get without doing some > (python) > > coding or doing some guess work. If you know how large your files is, you > > can easily narrow your choices down by listing the contents of the given > > directory and sorting it by size (using command ls -lS), then pulling out > > the file(s) that you want. If several files are of approx. the same size, > > open them up and see which one you want. > > > > Good luck and let us know if you have any more trouble, > > Enis > > > > > > On Mon, Mar 28, 2011 at 3:35 PM, <karlerhard(a)berkeley.edu> wrote: > > > >> > >> Hello Enis, > >> > >> Thanks for the quick response and suggestions. I actually did have a > >> job > >> running while I tried to download a file the first time, that's the > >> first > >> time it gave the error message. But the jobs have long since finished > >> and > >> it's still giving the error message. > >> > >> I've been able to edit the universe_wsgi.ini file to "debug = False", > >> but > >> now I'm getting an "Internal server error" when I try to reload the > >> galaxy > >> instance. Should I be signed out at the command-line to reload galaxy > >> from a browser? Forgive my simplicity, I'm really not at all > >> command-line > >> savvy. > >> > >> Also, another extremely basic problem I have is I just don't know where > >> the data library that holds my files is located. Any help would be > >> greatly appreciated. > >> > >> best, > >> > >> karl > >> > >> > >> > Hi Karl, > >> > As you see from the error message, you seem to be getting this error > >> > because > >> > the machine is running out of memory. This can in part be caused by a > >> > configuration option that might be set in Galaxy's universe_wsgi.ini > >> file > >> > (see below). > >> > Did you have any jobs running while trying to download the file? > >> Waiting > >> > until those finish might free up some memory. > >> > > >> > A thing to try is to connect to the instance, edit Galaxy's > >> > universe_wsgi.ini file to se debug = False, restart Galaxy and try > >> > again. Are you familiar with that at all? > >> > The basic steps are as follows: > >> > [local]$ ssh -i <path to your AWS private key file> ubuntu@<instance > >> > public > >> > IP> > >> > [ec2]$ sudo su galaxy > >> > [ec2]$ cd /mnt/galaxyTools/galaxy-central > >> > [ec2]$ vi universe_wsgi.ini -- edit file (around line 226) to set: > >> debug > >> > = > >> > False > >> > [ec2]$ sh run.sh --stop-daemon > >> > [ec2]$ sh run.sh --daemon > >> > > >> > Yet another option is to connect the instance in the same way, look > >> > through > >> > the data library on the file system and manually copy the file out of > >> the > >> > instance. You can use the following command to copy the file to your > >> local > >> > instance: > >> > [local]$ scp -i <path to your AWS private key file> ubuntu@<instance > >> > public > >> > IP>:/mnt/galaxyData/files/000/dataset_<ID>.dat . > >> > > >> > Let us know if none of this works, > >> > Enis > >> > > >> > > >> > On Mon, Mar 28, 2011 at 12:02 PM, <karlerhard(a)berkeley.edu> wrote: > >> > > >> >> > >> >> Hello, > >> >> > >> >> I'm trying to download the library files I processed on my galaxy > >> cloud > >> >> instance, but I'm getting an error. At the top (on the right panel) > >> it > >> >> says "Server Error" and then lists the URL where the data should be > >> and > >> >> then lists: > >> >> > >> >> Module paste.exceptions.errormiddleware:143 in __call__ > >> >> << try: > >> >> __traceback_supplement__ = Supplement, self, environ > >> >> app_iter = self.application(environ, start_response) > >> >> return self.make_catching_iter(app_iter, environ) > >> >> except:>> app_iter = self.application(environ, > >> >> start_response) > >> >> Module paste.debug.prints:98 in __call__ > >> >> << try: > >> >> status, headers, body = wsgilib.intercept_output( > >> >> environ, self.app) > >> >> if status is None: > >> >> # Some error occurred>> environ, self.app) > >> >> Module paste.wsgilib:544 in intercept_output > >> >> << try: > >> >> for item in app_iter: > >> >> output.write(item) > >> >> finally: > >> >> if hasattr(app_iter, 'close'):>> output.write(item) > >> >> MemoryError: out of memory > >> >> > >> >> > >> >> > >> >> Is there some easy fix to this? I'd really like to get that data off > >> of > >> >> the cloud instance and be able to terminate it. > >> >> > >> >> thanks, > >> >> > >> >> karl > >> >> > >> >> ___________________________________________________________ > >> >> The Galaxy User list should be used for the discussion of > >> >> Galaxy analysis and other features on the public server > >> >> at usegalaxy.org. Please keep all replies on the list by > >> >> using "reply all" in your mail client. For discussion of > >> >> local Galaxy instances and the Galaxy source code, please > >> >> use the Galaxy Development list: > >> >> > >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev > >> >> > >> >> To manage your subscriptions to this and other Galaxy lists, > >> >> please use the interface at: > >> >> > >> >> http://lists.bx.psu.edu/ > >> >> > >> > > >> > >> > >> > > > > >

2 1

Re: [galaxy-user] server error trying to DL data from galaxy on cloud
by karlerhard＠berkeley.edu 28 Mar '11

28 Mar '11

Hello, I'm trying to download the library files I processed on my galaxy cloud instance, but I'm getting an error. At the top (on the right panel) it says "Server Error" and then lists the URL where the data should be and then lists: Module paste.exceptions.errormiddleware:143 in __call__ << try: __traceback_supplement__ = Supplement, self, environ app_iter = self.application(environ, start_response) return self.make_catching_iter(app_iter, environ) except:>> app_iter = self.application(environ, start_response) Module paste.debug.prints:98 in __call__ << try: status, headers, body = wsgilib.intercept_output( environ, self.app) if status is None: # Some error occurred>> environ, self.app) Module paste.wsgilib:544 in intercept_output << try: for item in app_iter: output.write(item) finally: if hasattr(app_iter, 'close'):>> output.write(item) MemoryError: out of memory Is there some easy fix to this? I'd really like to get that data off of the cloud instance and be able to terminate it. thanks, karl

2 3

A genbank to gtf converter
by David Matthews 28 Mar '11

28 Mar '11

Hi again, Does anyone know of a genbank to gtf converter? I have heard such things exist but never found one... Cheers David

2 2

Re: [galaxy-user] Problems using aaChanges tool
by Jennifer Jackson 28 Mar '11

28 Mar '11

Hi Evan, The update to include zebrafish (and a few other genomes) should roll out to Galaxy main in the next few days, if not sooner. Feel free to check back Friday for an update if you do not see it there by then. Thank you for your patience! Best, Jen Galaxy team On 3/28/11 8:01 AM, Evan Schwab wrote: > Hi Jen, > > The aaChanges tool is still not supporting the zebrafish Zv9 build. Can > you please fix this so that I am able to use the aaChanges tool. It's > very important. > > Thanks > > Evan > -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org

1 0

Re: [galaxy-user] galaxy-user Digest, Vol 57, Issue 26
by Brian Lam 28 Mar '11

28 Mar '11

galaxy-user-request(a)lists.bx.psu.edu wrote: >Send galaxy-user mailing list submissions to > galaxy-user(a)lists.bx.psu.edu > >To subscribe or unsubscribe via the World Wide Web, visit > http://lists.bx.psu.edu/listinfo/galaxy-user >or, via email, send a message with subject or body 'help' to > galaxy-user-request(a)lists.bx.psu.edu > >You can reach the person managing the list at > galaxy-user-owner(a)lists.bx.psu.edu > >When replying, please edit your Subject line so it is more specific >than "Re: Contents of galaxy-user digest..." > > >HEY! This is important! If you reply to a thread in a digest, please >1. Change the subject of your response from "Galaxy-user Digest Vol ..." to the original subject for the thread. >2. Strip out everything else in the digest that is not part of the thread you are responding to. > >Why? >1. This will keep the subject meaningful. People will have some idea from the subject line if they should read it or not. >2. Not doing this greatly increases the number of emails that match search queries, but that aren't actually informative. > >Today's Topics: > > 1. Convert SOLiD data (lishiyong) > 2. Re: biomart plugin (Greg Von Kuster) > 3. Re: Convert SOLiD data (Ryan Golhar) > 4. Re: Convert SOLiD data (Jennifer Jackson) > 5. Re: Sort & index SAM-files automatically (Ryan Golhar) > > >---------------------------------------------------------------------- > >Message: 1 >Date: Mon, 28 Mar 2011 11:35:15 +0800 >From: "lishiyong" <lishiyong(a)genomics.org.cn> >To: "galaxy-user" <galaxy-user(a)lists.bx.psu.edu> >Subject: [galaxy-user] Convert SOLiD data >Message-ID: <201103281135102031338(a)genomics.org.cn> >Content-Type: text/plain; charset="us-ascii" > >Hello! > I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with SOAPdenovo.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting . >for example: >T02023221102101032002002030011232121133222233311200 ��> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA > >But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. >2011-03-28 > > > >lishiyong >

2 1

Convert SOLiD data
by lishiyong 28 Mar '11

28 Mar '11

Hello! I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with SOAPdenovo.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting . for example: T02023221102101032002002030011232121133222233311200 ��> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 lishiyong

5 5

Sort & index SAM-files automatically
by Jochen Seggewiß 28 Mar '11

28 Mar '11

Hello! I convert SOLiD csfasta- and qual-files to fastq-files and map those against Hg19 (Bowtie). I would like to use the resulting sam-files in the IGV browser (Broad Institute). Therefore, the sam-file need to be sorted an indexed. This could be done using the igvtools. However, it would be nicer if this sorting and indexing could be done automatically using GALAXY. I guess that it is certainly possible but I do not know how. Could anybody let me know how it works and what function I have to use, respectively? How can I sort the sam-file the correct way? Thank you in advance. Best regards Jo

3 3

biomart plugin
by Andrea Edwards 28 Mar '11

28 Mar '11

Hello I have looked at the biomart plugin for Galaxy and this seems to allow access to marts on the biomart central server. Is there anyway to use this plugin to access a biomart on my server if I can't make my biomart available on the biomart central server. If not, would it be possible to achieve this with galaxy tools. I've heard of galaxy tools but never made one so I don;t know what is involved. Failing that would i be able to use the biomart plugin to access my server if I had a local installation of galaxy thanks

2 1