galaxy-user March 2011

galaxy-user@lists.galaxyproject.org

75 participants
96 discussions

BED-to-GFF: option for gff3 format
by Karen Tang 23 Mar '11

23 Mar '11

Hi Galaxy developers, Any plans on adding a gff3 format option to BED-to-GFF? I found a BED-to-GFF3 converter at the Rätsch lab's instance of Galaxy (http://galaxy.tuebingen.mpg.de/). Any plans on making this converter more widely available? Karen :) Dept of Plant Biology University of Minnesota

5 5

fastq / nucleotides distribution graph
by Christophe Klopp 22 Mar '11

22 Mar '11

Hi, Nucleotide distribution is much easier to read when it is drawn as lines : http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/good_sequence_short_f… instead of bars : http://main.g2.bx.psu.edu/static/fastx_icons/fastq_nucleotides_distribution… Is there a way to produce a line graph in http://main.g2.bx.psu.edu/ ? Cheers Christophe -- ==================================================================== = Christophe KLOPP BIA INRA Toulouse 31326 Castanet-Tolosan = = Tel: 33 5 61 28 50 36 Email: christophe.klopp(a)toulouse.inra.fr = = http://www.sigenae.org/ = = http://bioinfo.genotoul.fr/ = ====================================================================

2 1

postgreSQL 9.0.3 / JSONDecodeError error
by Vincent Le Texier 22 Mar '11

22 Mar '11

Hello everyone, I am having trouble to save/edit a workflow with postgreSQL 9.0.3. (It works fine if I use MySQL) Any idea of the problem ? I get the following error (*JSONDecodeError: No JSON object could be decoded: line 1 column 0 (char 0)*) : URL: http://localhost:8080/workflow File '/data-ddn/home/galaxy/galaxy-dist/eggs/WebError-0.8a-py2.6.egg/weberror/evalexception/middleware.py', line 364 in respond app_iter = self.application(environ, detect_start_response) File '/data-ddn/home/galaxy/galaxy-dist/eggs/Paste-1.6-py2.6.egg/paste/debug/prints.py', line 98 in __call__ environ, self.app) File '/data-ddn/home/galaxy/galaxy-dist/eggs/Paste-1.6-py2.6.egg/paste/wsgilib.py', line 539 in intercept_output app_iter = application(environ, replacement_start_response) File '/data-ddn/home/galaxy/galaxy-dist/eggs/Paste-1.6-py2.6.egg/paste/recursive.py', line 80 in __call__ return self.application(environ, start_response) File '/data-ddn/home/galaxy/galaxy-dist/eggs/Paste-1.6-py2.6.egg/paste/httpexceptions.py', line 632 in __call__ return self.application(environ, start_response) File '/data-ddn/home/galaxy/galaxy-dist/lib/galaxy/web/framework/base.py', line 145 in __call__ body = method( trans, **kwargs ) File '/data-ddn/home/galaxy/galaxy-dist/lib/galaxy/web/controllers/workflow.py', line 114 in index return self.list( trans ) File '/data-ddn/home/galaxy/galaxy-dist/lib/galaxy/web/framework/__init__.py', line 84 in decorator return func( self, trans, *args, **kwargs ) File '/data-ddn/home/galaxy/galaxy-dist/lib/galaxy/web/controllers/workflow.py', line 139 in list .order_by( desc( model.StoredWorkflow.table.c.update_time ) ) \ File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/query.py', line 1267 in all return list(self) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/query.py', line 1422 in instances rows = [process[0](context, row) for row in fetch] File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/query.py', line 2032 in main return _instance(row, None) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/mapper.py', line 1729 in _instance populate_state(state, dict_, row, isnew, only_load_props) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/mapper.py', line 1614 in populate_state populator(state, dict_, row, isnew=isnew, **flags) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/strategies.py', line 762 in execute dict_[key] = _instance(row, None) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/mapper.py', line 1729 in _instance populate_state(state, dict_, row, isnew, only_load_props) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/mapper.py', line 1614 in populate_state populator(state, dict_, row, isnew=isnew, **flags) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/strategies.py', line 781 in execute _instance(row, result_list) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/mapper.py', line 1729 in _instance populate_state(state, dict_, row, isnew, only_load_props) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/mapper.py', line 1614 in populate_state populator(state, dict_, row, isnew=isnew, **flags) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/orm/strategies.py', line 120 in new_execute dict_[key] = row[col] File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py', line 1348 in __getitem__ return self.__parent._get_col(self.__row, key) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py', line 1620 in _get_col return processor(row[index]) File '/data-ddn/home/galaxy/galaxy-dist/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/types.py', line 288 in process return self.process_result_value(value, dialect) File '/data-ddn/home/galaxy/galaxy-dist/lib/galaxy/model/custom_types.py', line 32 in process_result_value return json_decoder.decode( str( value ) ) File '/data-ddn/home/galaxy/galaxy-dist/eggs/simplejson-2.1.1-py2.6-linux-x86_64-ucs2.egg/simplejson/decoder.py', line 402 in decode File '/data-ddn/home/galaxy/galaxy-dist/eggs/simplejson-2.1.1-py2.6-linux-x86_64-ucs2.egg/simplejson/decoder.py', line 420 in raw_decode JSONDecodeError: No JSON object could be decoded: line 1 column 0 (char 0) -- Vincent Le Texier Senior Software Engineer Synergie Lyon Cancer Leon Berard Center, Cheney C 28, rue Laennec 69373 LYON Cedex 08 +33 4 26 55 67 85 letexier(a)lyon.fnclcc.fr

2 1

Upload file size and user authorization
by Paul-Michael Agapow 22 Mar '11

22 Mar '11

Two questions, either of which may belong more on the developers list. But lets try here first: 1. As we migrate services to Galaxy, a stakeholder expressed concern at uploading large datafiles of "several gigabytes". Given that we can require users to upload from an ftp site or something similar, does anyone have experience with how well this works with gigabyte-size files? I figure I can always write a tool to upload masses of data via a slow but robust method, but it would be good to know if this is required. 2. Similarly, someone else wanted to know if Galaxy authorization could be plugged into another system, such as Active Directory. Any pointers on this, or will I have to cut some code? thanks ---- Paul Agapow (paul-michael.agapow(a)hpa.org.uk) Bioinformatics, Centre for Infections, Health Protection Agency ----------------------------------------- ************************************************************************** The information contained in the EMail and any attachments is confidential and intended solely and for the attention and use of the named addressee(s). It may not be disclosed to any other person without the express authority of the HPA, or the intended recipient, or both. If you are not the intended recipient, you must not disclose, copy, distribute or retain this message or any part of it. This footnote also confirms that this EMail has been swept for computer viruses, but please re-sweep any attachments before opening or saving. HTTP://www.HPA.org.uk **************************************************************************

2 3

LASTZ: Controlling Length of Hits
by JASON G. BANKERT 22 Mar '11

22 Mar '11

We're trying to only get hits of certain lengths. Is there a setting to use that sets the minimum length for each hit?

3 3

Recall: Upload file size and user authorization
by Paul-Michael Agapow 22 Mar '11

22 Mar '11

Paul-Michael Agapow would like to recall the message, "[galaxy-user] Upload file size and user authorization". ----------------------------------------- ************************************************************************** The information contained in the EMail and any attachments is confidential and intended solely and for the attention and use of the named addressee(s). It may not be disclosed to any other person without the express authority of the HPA, or the intended recipient, or both. If you are not the intended recipient, you must not disclose, copy, distribute or retain this message or any part of it. This footnote also confirms that this EMail has been swept for computer viruses, but please re-sweep any attachments before opening or saving. HTTP://www.HPA.org.uk **************************************************************************

1 0

FASTQ to FASTQSanger using Groomer question
by David K Crossman 22 Mar '11

22 Mar '11

Hello! I am fairly new to using Galaxy and have a question about the FASTQ Groomer feature. I have 4 RNA-Seq raw data files that were just recently generated from Illumina's NGS instruments. I am aware that the first step to perform in Galaxy is FASTQ Groomer to convert the format to FASTQ Sanger. I presume that I would choose Illumina 1.3+ in the "Input FASTQ quality scores type" box. However, if I look at the raw data reads, I notice that Line 4 (which encodes the quality values for sequence in Line 2) has values outside of the Illumina 1.3+ range (some of them fall into the Sanger format. I am enclosing the Quality Score Comparison figure along with some of the raw RNA-Seq data): Quality Score Comparison SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ | | | | | | 33 59 64 73 104 126 S - Sanger Phred+33, 93 values (0, 93) (0 to 60 expected in raw reads) I - Illumina 1.3 Phred+64, 62 values (0, 62) (0 to 40 expected in raw reads) X - Solexa Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw reads) Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format RNA-Seq raw data @HWI-ST156_294:7:1:1058:2165:0/1 CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC + HHHHFGGHHHGFHHFHHEGHC<GGGEB.EE9D?DDEEEE4FFFCBB/.C=D @HWI-ST156_294:7:1:1184:2191:0/1 CGTAAATCCATGTCTGACTTCTGGATAGCAAACACCAGCACCGCGTGGATG + EE;E=ECEEBE@EEEE=GBFGF/GFFC<FA;:@<8AEABB>A######### @HWI-ST156_294:7:1:1018:2200:0/1 NCTGATTAAGGATAATGAGTTTTTAGTAGAACTAATGATGTTATTCCTTGG + ################################################### @HWI-ST156_294:7:1:1225:2217:0/1 GTTTTTGACTACACAAAGCACCCTTCTAAACCAGACCATTCTGGAGAATGA + FFCEFFFE?FEBDC?987::,3:<-9145,DA<:C9;+?############ As a test in FASTQ Groomer, I chose either the Sanger or Illumina 1.3+ as the input quality scores type and these are the results I got: FASTQ Groomer on tn-read1 (using Sanger as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 sanger reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: 2 - 40 FASTQ Groomer on tn-read1 (using Illumina1.3+ as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 illumina reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: -29 - 9 Which one is right (I presume the Illumina 1.3+ one, but I can't find any sort of explanation)? I noticed that the "input decimal range" had different values (although they spanned the same length) in relation to which input was chosen. What would happen downstream in TopHat if Sanger was used instead of Illumina 1.3+ for these files? Is there any other reading material/websites/etc... out there that might help me better understand the quality score and which to use? Any info/help would be greatly appreciated. Thanks, David David K. Crossman, Ph.D. Systems Biologist/Analyst/Statistician Heflin Center for Genomic Science University of Alabama at Birmingham 720 20th Street South Kaul Room 420 Birmingham, AL 35294-0024 (205) 996-4045 (205) 996-4056 (fax) David K. Crossman, Ph.D.<mailto:dkcrossm@uab.edu> Heflin Center for Genomic Science<http://www.heflingenetics.uab.edu/>

4 3

Galaxy down?
by Felix Hammer 21 Mar '11

21 Mar '11

Hi, is there currently a problem with the Galaxy Server? When will it be up again? thx, Felix

2 1

postgres version 9.0.3
by Martin Senger 19 Mar '11

19 Mar '11

Hi, Our system changed from postgres 8.3 to postgres 9.0.3 - and since I am getting Server error on Galaxy. I am still investigating (because the server error is not there always, specifically it does not occur for an anonymous user) but I wonder if there are some known issues with Galaxy running with postgres > 8.3. It would definitely help in my error tracking. Thanks, Martin -- Martin Senger email: martin.senger@gmail.com,martin.senger@kaust.edu.sa skype: martinsenger

1 0

Workshop on Comparative Genomics, North America 2011
by Dave Clements 18 Mar '11

18 Mar '11

Hello all, Galaxy has been a part of the Workshop on Comparative Genomics held in the Czech Republic for the past several years. This two week workshop is now being offered in North America for the first time, and Galaxy will be participating again: Workshop on Comparative Genomics, North America 2011 Fort Collins, Colorado, United States July 10-22 http://www.molecularevolution.org/workshops/WCG The workshop focuses on comparative genomics using next generation sequencing data. Software packages including ABySS, Bowtie, Velvet, BioPerl, Scripture, GMOD, GBrowse_syn, PyCogent and QIME will be covered. Dan Blankenberg of the Galaxy team will teach the Galaxy sessions. There is also a Workshop on Molecular Evolution being offered immediately after the Comparative Genomics workshop. PDFs describing both events are attached. Applications for both workshops are due May 15. Thanks, Dave C -- http://galaxy.psu.edu/gcc2011/ http://getgalaxy.org http://usegalaxy.org/

1 0

← Newer
1
2
3
4
5
6
7
8
9
10
Older →

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user March 2011