August 2013 - galaxy-user - lists.galaxyproject.org

Tophat2 not working?
by Delong, Zhou 29 Aug '13

29 Aug '13

Hello, I've been trying tophat 2 on the public server since last week but I don't get any results. I got one empty output for " the output datasets were deleted while the job was running, the job was manually dequeued or there was a cluster error." one error with " Unable to queue job for execution. Resubmitting the job may succeed." and one empty output with no error message. It seems that tophat 2 is new on the server, has anyone run it with success yet? Thanks, Delong

3 3

CloudMan console not responding
by Deniz Erezyilmaz 29 Aug '13

29 Aug '13

Over the past couple weeks I have had multiple problems using the CloudMan/AWS using a custom pipeline, and I have been unable to complete an instance while racking up large charges from Amazon. There have been three types of problems: 1) Autoscaling and manual changes to the nodes are not showing. Although the EC2 console shows that they are active, the Cloudman console does not, and the performance of the instance suggests that they have not been activated. 2) Share string is not loading. 3) Disk will not resize. Here again, the change appears on the EC2 console, but not on the Cloudman console. The fact that I am unable to load large files suggests that the disk is truly not resized. It seems to me that there is some disconnect between Amazon and Galaxy. Thanks, Deniz

2 2

Galaxy Tool Version Question
by Nixon, Scott Evan 28 Aug '13

28 Aug '13

To Whom it May Concern, I was trying to find the version information regarding certain RNA-Seq analysis (Tophat, Tophat2, Cufflinks), and have had difficulty finding the versions for either Tophat instance. Is there a way to find out what version of Tophat is being used? Thank you for your time, Scott Nixon

2 1

Uploading files to Cloudman by FTP
by Anto Praveen Rajkumar Rajamani 28 Aug '13

28 Aug '13

Hello, I have started a new cloudman instance. Now, I am trying to upload my fastq files to FTP server using Filezilla. The upload file page instructs "To upload some files, log in to the FTP server at localhost using your Galaxy credentials (email address and password)". I typed my ec2... address as the host and entered my Galaxy registered email address and password. Filezilla connects to 220-Galaxy Cloudman FTP but then rejects my password and displays "Could not connect to server". Should I try a different host name? Where do I go wrong? Kindly help me to solve this problem. Thanking you in advance. Best wishes, Anto

3 2

Connecting to new Galaxy Cloudman by FTP
by Mohammad Heydarian 27 Aug '13

27 Aug '13

Hi, I am having trouble setting up a FTP connection with the recently released version of Galaxy Cloudman (ami-118bfc78). I have instantiated the new version of Galaxy Cloudman with CloudLaunch<http://usegalaxy.org/cloudlaunch> and also through the AWS EC2 wizard (using the same security group settings as the previous versions) and neither instance will connect to my FTP connection. Has anyone else had this problem? Does anyone know what is preventing the FTP connection? Any help would be greatly appreciated. Cheers, Mo Heydarian

4 4

Re: [galaxy-user] problem with bowtie
by Ido Tamir 27 Aug '13

27 Aug '13

the file looks good to me (illumina 1.8 because of the ?). I might have misunderstood the error message. If it comes from galaxy when you try to use this file, then you have not specified the correct file format to galaxy. You have to change its type to fastqsanger by clicking on the pencil. HTH, ido On Aug 27, 2013, at 5:05 PM, "Law, Michael J." <lawmj(a)rowan.edu> wrote: > Of course....Here is an example: > @HWI-ST1160:394:C1J65ACXX:7:1101:1520:2235 1:N:0:TTAGGC > CTGACATAGTCTGGTGCGGCAACAATCATTCTTGCCATGAGCCCACCTAG > + > @CCDFFFDHDHHGIFHIIJJJJJIGIJ9FIHIBHIIECE@EGGJGHJJBH > @HWI-ST1160:394:C1J65ACXX:7:1101:1946:2192 1:N:0:TTAGGC > GCGGATATTGGTACAATAGGAGCACCGTCAGCAATGGTACCTCTGATGAA > + > @CCFDDFFHHHHHJIJJJJJHIJGJJJJJGIJIJJJJ?DGGIJJJGIIIJ > @HWI-ST1160:394:C1J65ACXX:7:1101:1851:2248 1:N:0:TTAGGC > CTTTGAGTGAACCTCGTCCGGTACTGCTTTTTATTGCCATGTATTATGTG > + > @CCFDEFDFHHGHJJJHJJJJCGHIJJJIJJI@FIJJJHIJIIIIDGGFF > @HWI-ST1160:394:C1J65ACXX:7:1101:2249:2219 1:N:0:TTAGGC > TCCTCAACCAGTCTTCCTTTTCATCATTTGACTCCAGTGCAGTGAAATCG > + > CCCFFFFFGHHFHJJJJJJJJJIJIIIJIEHHGIIFHHIIIJHGIJJIJJ > Also, whenever I send an email, it says I am not a member, but I have a login (clearly since I have used ftp for data upload). How do I fix this? > Thanks so much, > Mike > > Michael Law > lawmj(a)rowan.edu > > > > On Aug 27, 2013, at 4:44 AM, Ido Tamir wrote: > >> You should add 10 lines from one of your files. >> Then its easier to understand the problem. >> >> best, >> ido >> >> >> On Aug 26, 2013, at 5:17 PM, "Law, Michael J." <lawmj(a)rowan.edu> wrote: >> >>> Hello, >>> I am completely new to using galaxy. I have a quick question. I have uploaded my fastq files generated from my experiment for alignments using bowtie. I try to set up the alignment, only to receive the error message that I don't have any sequences with ASCII encoded quality scores. However, when I contact my sequencing facility, they say that the scores are present in the files and that it may be an issue with galaxy. >>> Any help you can provide would be appreciated! >>> Thanks, >>> Mike >>> >>> >>> Michael Law >>> lawmj(a)rowan.edu >>> >>> >>> >>> ___________________________________________________________ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >>> >>> To search Galaxy mailing lists use the unified search at: >>> >>> http://galaxyproject.org/search/mailinglists/ >> > >

1 0

URL problem
by Kucukural, Alper 26 Aug '13

26 Aug '13

Hi, I have a problem in galaxy to get host/domain name in two different pages. First one is in the tool installation from toolshed, I got the error below, ##### Not Found The requested URL /admin_toolshed/prepare_for_install was not found on this server. ##### The second one is in the saved histories. When I click the buttons of the saved histories. I got the similar error like below. ##### Not Found The requested URL /history/list was not found on this server. ##### I haven't seen these any other pages yet. My installation is working on LDAP authentication with Proxy. So, I could not find a place to set the domain or host name in these two places that they can actually find the requested URLs. In the paster.log file. I don't get any error when I install a tool or go to another history. It doesn't report any error. Thanks for your help, Alper Kucukural

1 0

cloudman console not responding add/remove nodes
by Deniz Erezyilmaz 25 Aug '13

25 Aug '13

Hi- I am using cloudman/Amazon EC2 to run a custom application. I have encountered a problem that appears to be communication between Galaxy and AWS. When I try to add nodes from the galaxy console, they never register as "available" and the icons never switch from blue to yellow to green. The cluster status log shows that they have been added. However, when I try to use the "remove nodes" option, the cluster status log tells me:"no idle instances found", and I cannot remove the extra instances. The amazon EC2 cloud is showing that the added instances are running, and I am being charged for them. I believe the nodes are not actually working because the program is running at a snail's pace. Thanks very much for your help. Deniz

2 1

Very very slow response when a class is using Galaxy from a computer room in the university
by Ido Carmel 23 Aug '13

23 Aug '13

Dear Sir/Madam, My Name is Ido Carmel, I am teaching the course titled "Advanced bioinformatics" in the Faculty of Agriculture in the Hebrew University (Israel). This year (around May), I used the Galaxy platform on the internet in a hands-on session about NGS data analysis. The session took place in one of the University computer classes with six students participating. For some reason, the Galaxy response was very very slow. It was slow when the students were signing up and also when the students were practicing very lightweight jobs that usually perform immediately such as "Fastq trimmer" or "fastq summary" statistics. Does the slow response was something seasonal or temporal? Alternatively, does the response is related to the fact that the students were in one computer room (and possibly all the queries were sent from the same proxy server)? I am teaching this course next year, do you have any advice/solution for me? Best Regards, Ido Carmel -- Ido Carmel, Dr. Yael Heifetz Lab, Robert H. Smith Faculty of Agriculture Food and Environment, The Hebrew University, POB 12, Rechovot, Israel. Tel: (+)972-8-9489222

2 2

Cuffdiff changes
by Johanna Sandgren 23 Aug '13

23 Aug '13

Hi, I am wondering why Cuffdiff suddenly gives many more significant DE genes? I have used same input data and now get approx 5x more significant genes, settings is same with the exception that you now included library normalization and dispersion estimation. See below for parameters. I have rerun several analysis, also with more samples in each group, all give much more significant genes. Why? Also, will replicate information soon be included in output files? Kind regards, Johanna Tool: Cuffdiff Tool: Cuffdiff Name: Cuffdiff on data 225, data 236, and others: splicing differential expression testing Name: Cuffdiff on data 225, data 236, and others: splicing differential expression testing Created: 4-Apr-13 Created: 21-Aug-13 Filesize: 10.3 MB Filesize: 10.2 MB Dbkey: hg19 Dbkey: hg19 Format: tabular Format: tabular Galaxy Tool Version: 0.0.5 Galaxy Tool Version: 0.0.5 Tool Version: Tool Version: Tool Standard Output: stdout<https://main.g2.bx.psu.edu/datasets/bbd44e69cb8906b5355e4a035e92cd84/stdout> Tool Standard Output: stdout<https://main.g2.bx.psu.edu/datasets/bbd44e69cb8906b524bcf7e585f495b1/stdout> Tool Standard Error: stderr<https://main.g2.bx.psu.edu/datasets/bbd44e69cb8906b5355e4a035e92cd84/stderr> Tool Standard Error: stderr<https://main.g2.bx.psu.edu/datasets/bbd44e69cb8906b524bcf7e585f495b1/stderr> Tool Exit Code: 0 Tool Exit Code: 0 API ID: bbd44e69cb8906b5355e4a035e92cd84 API ID: bbd44e69cb8906b524bcf7e585f495b1 Input Parameter Value Note for rerun Input Parameter Value Transcripts 261: Cuffmerge on data 258, data 135, and others: merged transcripts Transcripts 261: Cuffmerge on data 258, data 135, and others: merged transcripts Perform replicate analysis Yes Perform replicate analysis Yes Group name s202 Group name s202 Add file 194: Galaxy883-[MarkDups_Dupes_Marked_882_202.bam].bam Add file 194: Galaxy883-[MarkDups_Dupes_Marked_882_202.bam].bam Group name Ctrls Group name Ctrls Add file 236: MarkDups_Dupes Marked216.bam Add file 236: MarkDups_Dupes Marked216.bam Add file 225: MarkDups_Dupes Marked206.bam Add file 225: MarkDups_Dupes Marked206.bam Library normalization method not used (parameter was added after this job was run) Library normalization method geometric Dispersion estimation method not used (parameter was added after this job was run) Dispersion estimation method pooled False Discovery Rate 0.05 False Discovery Rate 0.05 Min Alignment Count 2 Min Alignment Count 2 Perform quartile normalization No Perform quartile normalization No Use multi-read correct Yes Use multi-read correct Yes Perform Bias Correction Yes Perform Bias Correction Yes Reference sequence data cached Reference sequence data cached Set Additional Parameters? (not recommended) Yes Set Additional Parameters? (not recommended) Yes Average Fragment Length 200 Average Fragment Length 200 Fragment Length Standard Deviation 80 Fragment Length Standard Deviation 80 ...................................................................................................................................................... Johanna Sandgren, PhD Department of Oncology-Pathology CCK, Karolinska Institutet SE-171 76 Stockholm, Sweden +46-8-517 721 35 (office), +46-8- 321047(fax), +46-708 388476 (mobile)

2 3