galaxy-user August 2013

galaxy-user@lists.galaxyproject.org

58 participants
85 discussions

History & Visualization list empty
by Benjamin Schuster-Boeckler 07 Aug '13

07 Aug '13

Hi there, I've set up a local galaxy installation that so far is working very nicely. However one little issue that I'm having is that the "Saved Visualizations" and "Saved Histories" lists are empty, even though I have multiple histories and multiple visualizations. In fact, when I choose to visualize a dataset in Trackster and select "View in saved visualization", I DO see the list of existing visualizations. Pictures attached. The identical problem appears with Histories. Any idea what the problem might be? I tried in Chrome and Safari, I logged out and back in, I restarted the server, but nothing fixed the issue... Thanks in advance for the help, Ben -- Benjamin Schuster-Böckler Leadership Fellow for Bioinformatics Ludwig Institute for Cancer Research University of Oxford Old Road Campus Research Building Oxford OX3 7DQ United Kingdom [cid:CD86F63E-0203-45D3-8802-328573CCB3B1][cid:BECC9A41-D145-4D11-A38A-485DAAB3997E]

2 1

after 'trim sequences', 'map w/Bowtie' job has been waiting for days to run
by Theresa Stueve 06 Aug '13

06 Aug '13

Greetings, I am using Galaxy Main; On 8/1/2013, and after 'trimming sequences' on my 'FASTQ groomed' data, I attempted to align my (single-end) 'trimmed sequences' output data to 'hg19 Canonical male' with 'Map with Bowtie for Illumina' It is now 8/3/2013, and the 'Map with Bowtie for Illumina' job has been 'waiting to run' >+48hrs. I have 're-newed' the history several times, but have not deleted or re-run the original job for fear of losing my place in the queue. To check if 'canonical male' was the problem, I queued a second alignment to be 'mapped w/bowtie for Illumina' against hg19 (no sex); this job has also not run after being queued mor than 24 hours ago. Can you tell me if the delay is because I've done something incorrectly or if there's some action I can take to speed things? your help is deeply and sincerely appreciated https://main.g2.bx.psu.edu/u/theresa-stueve/h/1stunsupctcfupload-1 -- (Theresa) Ryan Stueve Department of Preventive Medicine Ite Laird-Offringa Lab NTT 6420

2 1

slow Galaxy server
by Politz, Samuel M. 06 Aug '13

06 Aug '13

This is a followup to my previous post on this topic. The exact message (in red) that I see after a long delay in running a tool is "An error occurred while getting updates from the server. Please contact a Galaxy administrator if the problem persists." I have seen this message twice while waiting for two unrelated tools to run. There is no green'bug' icon so I could not report this to an administrator. Another main server user reported this error message to the user mailing list as well. The response to their post was to wait a few minutes. Well, in this case I have been waiting overnight. Best regards, Sam Politz

2 1

very slow server
by Politz, Samuel M. 06 Aug '13

06 Aug '13

Hello, for the last week or so the main Galaxy server has not completed any of my jobs. These were jobs that were successfully queued, but I deleted them after 48 hours passed without completion. I started a job last night (BEDtools BedGraph of genome coverage on a BAM file). This morning I got an error message, something to the effect that my account was having difficulty receiving updates from the Galaxy server. I am not sure this latest message had anything to do with the previous delays, but the current job is still queued up. Over the past month or two, the Galaxy server has been slow to complete jobs at times, but never more than a few hours, or at most, overnight. I wonder if the current problem is a symptom of increased use of the server, or if something is wrong with my particular usage. Either way, it is currently preventing me from getting any analysis done on the server. Best regards, Sam Politz

2 1

after 'trim sequences', 'map w/Bowtie' job has been waiting for hours
by Theresa Stueve 06 Aug '13

06 Aug '13

Greetings, I am using Galaxy Main On 8/1/2013, and after 'trimming sequences' on my 'FASTQ groomed' data, I attempted to align my (single-end) 'trimmed sequences' output data to 'hg19 Canonical male' with 'Map with Bowtie for Illumina' It is now 8/2/2013, and the 'Map with Bowtie for Illumina' job has been 'waiting to run' all night, over night. I have 're-newed' the history several times, but have not deleted or re-run the job for fear of losing my place in the queue. Can you tell me if the delay is because I've done something incorrectly? https://main.g2.bx.psu.edu/u/theresa-stueve/h/1stunsupctcfupload -- (Theresa) Ryan Stueve Department of Preventive Medicine USC

2 1

Loading Neurospora crassa genome database onto Galaxy.
by Mr. Lai U Ming, Julian 06 Aug '13

06 Aug '13

Hi, I'm working on the filamentous fungi, Neurospora crassa and would like to use Galaxy to do some RNASeq analysis. Could you please load the Neurospora crassa genome into the reference data base on Galaxy. The sequences can be found at EnsemblFungi and at the Broad Intitute site. Could you please let me know which of the data set is used so that I can get the .gtf file. Thanks. Best regards, Julian Lai Junior Research Fellow Jedd Group Temasek Life Sciences Laboratory 1 Research Link National University of Singapore Singapore 117604 TLL is organizing an international conference on Next Generation Genomic View on Plants, Animals and Microbes on March 5th to 7th, 2014. For more information, please visit http://conference.tll.org.sg. Information in this email is confidential and may also be privileged. It is intended solely for the person to whom it is addressed. If you are not the intended recipient, please notify the sender, and please delete the message and any other record of it from your system immediately.

2 1

Inquiry on FastQC report
by Ng Kiaw Kiaw 06 Aug '13

06 Aug '13

Dear Galaxy Officer, Good day. I am a new user of Galaxy main server. The tools provided are very user-friendly. Thanks for the establishment of these. I just new to the RNA-seq analysis and now in the learning process of Bioinformatics. I would like to inquire on the FastaQC report generated on my data. For your information: Samples: Plant (dicotyledon) Type of data: RNA-seq (Illumina HiSeq 2000 with CASAVA v 1.8.2) Paired ends Adapter sequence: RPI 15 ( 5’ CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA) Main purpose of my analysis: Identification of novel transcript and gene expression studies I run FastQC on my raw RNA-seq data both forward and reverse. I attach the FastQC report in this email. My questions are: 1) The basic statistics shows that my data encoding is Sanger/illumina 1.9. When I grooming my data for downstream analysis in Galaxy, is that correct I choose "Sanger" for the input FASTQ quality score type? 2) Based on the per base sequence quality, the quality scores are above 20.0 for both forward and reverse data. Do I still need to trim off my data? 3) The result for "Per base sequence content", "Per base GC content", "sequence duplication level" are fail. What are these three results indicate? What are the solution for these problems? 4) What the overrepresented sequence indicate? Do I need to trim off the overrepresented sequence? 5) Based on the K-mer content, how could I analyse and justify whether this is good data or not? 6) In the reverse data FastQC report, "per sequence GC content" seem not good. What do this indicate? 7) How could I identify the adapter sequence in my RNA-seq data and how could could I remove? 8) After grooming data, running FastQC on data, adapter removal, is there any other pre-processing steps need to be done before running bowtie and top hat? Many Thanks in advance for your kind assistance and supports. Best regards Ng Kiaw Kiaw PhD student RIKEN Yokohama Campus Japan.

2 1

rattus norvegicus reference genome
by Matthew Girgenti 06 Aug '13

06 Aug '13

Hi I'm currently using the Galaxy pipeline to analyze my illumina chip-seq data. When I try to use "NGA: Mapping>Map with Bowtie for Illumina" to map my reads there is no rat reference genome. I says I should contact galaxy. Should I simply upload the genome to proceed with analysis? Thanks Matt

2 1

Problem with ftp connexion to Galaxy
by Fabrice BESNARD 06 Aug '13

06 Aug '13

Hello, I registered some time ago to Galaxy. >From the very beginning, my ftp connexion is not working. I am using Filezilla, on a windows operating system. More precisely, the connexion can be established, but the process fail when it is asking for the password. Statut : Résolution de l'adresse de main.g2.bx.psu.edu Statut : Connexion à 128.118.250.4:21... Statut : Connexion établie, attente du message d'accueil... Réponse : 220 ProFTPD 1.3.4b Server (Galaxy Main Server FTP) [::ffff:128.118.250.4] Commande : USER fbesnard(a)biologie.ens.fr Réponse : 331 Password required for fbesnard(a)biologie.ens.fr Commande : PASS *************** Réponse : 530 Login incorrect. Erreur : Erreur critique Erreur : Impossible d'établir une connexion au serveur I sent an email two month ago to report this problem. I was answered that this was an issue happening with the new accounts created. Obviously, this issue has not been fixed yet, has it? If yes, could you indicate me to make my ftp connexion works now ? Thank you for your help !! -- Fabrice Besnard Institute of Biology of the Ecole Normale Supérieure (IBENS) 46 rue d'Ulm, 75230 Paris cedex 05, France 8th floor. Office: Room 802. Lab: Room 817. mail: fbesnard(a)biologie.ens.fr Tel: +33-1-44-32-39-44

2 2

Problem with downloading
by GANDRILLON OLIVIER 06 Aug '13

06 Aug '13

Hi I am trying to download the results of my analysis (.sam files) from Galaxy main. The download gets interrupted about halfway, with no error message, as if the full file had been downloaded (but has not). Thank's for your help Best Olivier Gandrillon

2 1

← Newer
1
2
3
4
5
6
7
8
9
Older →

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user August 2013