- galaxy-user - lists.galaxyproject.org

Question about fetching sequence from genome
by Qianli Shen 01 Jun '12

01 Jun '12

Hi I want to fetch sequence from soybean genome, according to a gff file. My gff3 file and genome file are attached to the email, because it is not easy to recongnize the format if I paste it in the email. And it keeps reporting the error: An error occurred running this job: Traceback (most recent call last): File "/galaxy/home/g2main/galaxy_main/tools/extract/extract_genomic_dna.py", line 288, in <module> if __name__ == "__main__": __main__() File "/galaxy/home/g2main/galaxy_main/tools/extract/extract_genomic_dna.py" Could you please tell me where is the problem? Best Qianli

2 1

Genome Browser Histogram Visualization of Accepted Hits
by Fowler, Trent 31 May '12

31 May '12

Hello, I am attempting to run accepted hit data from Tophat output into the UCSC Genome Web Browser for visualization of sequencing hits in specific genes. However, the BAM files yield tiles and are too large to present through the browser. Is there a better file format to convert to that would allow better visualization such as histograms? >From word of mouth, I have been told to convert BAMs to BEDs and put BED files through the browser. However, I notice that Galaxy does not have an option for this and the oft used BEDtools appears to involve writing code, which is above my computer abilities. Any tips or solutions on how to obtain histograms from sequencing data would be very welcome. Thanks Trent Fowler

3 3

Re: [galaxy-user] How to control registration
by Zeeshan Ali Shah 31 May '12

31 May '12

what about chaning cm.tar.gz in S3 ? Zeeshan On Thu, May 31, 2012 at 9:34 AM, Jorrit Boekel <jorrit.boekel(a)scilifelab.se>wrote: > Hej Zeeshan > > Rebooting leads to upstart running /opt/cloudman/pkg/ec2autorun.py. > This downloads a boot script, which downloads a cloudman package > (cm.tar.gz), unpacks it and starts cloudman from there. This will mean a > new /mnt/cm/universe.wsgi will be in place. > > When cloudman starts, it attaches EBS volumes to /mnt/galaxyTools and > other mount points from snapshots. The snapshots will include > /mnt/galaxyTools/galaxy-central/universe_wsgi.ini. > > Restarting the node will thus eradicate changes. You will have to use the > persist changes-functionality to create a file persistent_data.yaml in an > S3 bucket and saved snapshots. AFAIK, it saves when you terminate the > session in cloudman. When instantiating a new cluster with the *same name* > (important) as the old one, it will pick the persistent data from the > bucket and mount your saved snapshots. > > good luck, > jorrit > > > > On 05/30/2012 04:34 PM, Zeeshan Ali Shah wrote: > > I tried changing > both files > /mnt/galaxyTools/galaxy-central/universe_wsgi.ini > > and > > /mnt/cm/universe_wsgi.ini.cloud > > > but after reboot of headnode the changes are gone . > > > any hint ? > > > Zeeshan > > On Thu, May 24, 2012 at 10:30 AM, Roman Valls Guimera < > brainstorm(a)nopcode.org> wrote: > >> Zeeshan, AFAIK the only settings you can set regarding this are in >> universe_wsgi.ini through the directives: >> >> >> # Allow unregistered users to create new accounts (otherwise, they will >> have to >> # be created by an admin). >> allow_user_creation = True >> >> # Email administrators when a new user account is created >> # You also need to have smtp_server set for this to work. >> new_user_email_admin = False >> >> I have not seen a moderation system in place, but maybe you can use PDC's >> Plone forms for this moderation ? >> >> Hope that helps ! >> Roman >> >> 24 maj 2012 kl. 10:18 skrev Zeeshan Ali Shah: >> >> > Hi, Is there any way to moderate Registration on Galaxy portal ? We are >> setting up a cluster for internal users but it seems that by default >> registration is open for all. >> > >> > Can any way we disable the registration and Moderator create users >> separately ? OR Moderate the registration process ? >> > >> > >> > Zeeshan >> > ___________________________________________________________ >> > The Galaxy User list should be used for the discussion of >> > Galaxy analysis and other features on the public server >> > at usegalaxy.org. Please keep all replies on the list by >> > using "reply all" in your mail client. For discussion of >> > local Galaxy instances and the Galaxy source code, please >> > use the Galaxy Development list: >> > >> > http://lists.bx.psu.edu/listinfo/galaxy-dev >> > >> > To manage your subscriptions to this and other Galaxy lists, >> > please use the interface at: >> > >> > http://lists.bx.psu.edu/ >> >> > > > ___________________________________________________________ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > >

2 2

Bowtie mapping problem
by Kelkar, Hemant 30 May '12

30 May '12

It is possible that this question has been asked/answered before. I tried searching through the galaxy-user list archives on nabble but could not find an applicable answer. ----------------------- Bowtie alignments done using a de-multiplexed Illumina sequence data set (CASAVA v.1.8.2) appear to be leading to alignment problem in our local galaxy install. At first glance this appears to be because of the " @SOMETHING<space>READINFO" read names not being handled correctly by bowtie. This is not a galaxy issue per se but what are other users doing to avoid this problem. We are using bowtie v. 0.12.7 (going to upgrade soon) at the moment. Posting a snippet from the alignment file below: MACHINE_NAME:2:1101:1533:1944 1:N:0:CGATGT 4 * 0 0 * * 0 0 NACGAAACGGGTCGGTCCGTCGGCATAGCGCGCCACGGCCTGCGGATCGG #4=DDFFFHHHFHIJHIJIHIIJJJIIIIIJJIHHFFDDDDDDDDDDDDD XM:i:0 MACHINE_NAME:2:1101:2523:1962 16 chr5 80936209 255 50M * 0 0 CTAAAAGGAAAAATTCCAGGGATTAAGGAACTTGAAGTTAGAAAAACTAN IIJJJIHHJJJIHFEIHIJIIJIJJJJIIJIIGJJIJFGHHHFEDAD=4# XA:i:1 MD:Z:49C0 NM:i:1 MACHINE_NAME:2:1101:1596:1971 16 chr13 41692461 255 50M * 0 0 GCTGAATAATAGTCCATTGTGAACATATACCATGTTTTCTTTATTTTTAN JJJJJJJJJIJJIJJJJJJJJJJJJJJHFJJJJJJJJHHHHHFFFFD=4# XA:i:1 MD:Z:49T0 NM:i:1 MACHINE_NAME:2:1101:2670:1962 1:N:0:CGATGT 4 * 0 0 * * 0 0 NTGCACTCGCCTGGATACCGTCGCCGGTGAGGTGGCATTCGAACACACCC --Hemant

2 1

How to control registration
by Zeeshan Ali Shah 30 May '12

30 May '12

Hi, Is there any way to moderate Registration on Galaxy portal ? We are setting up a cluster for internal users but it seems that by default registration is open for all. Can any way we disable the registration and Moderator create users separately ? OR Moderate the registration process ? Zeeshan

2 2

How to transfer files between two galaxy instances
by shamsher jagat 29 May '12

29 May '12

I have uploaded files in citsrome/ Gunner Ratch lab Galaxy instances which allow users to use their tool. I want to either share work flow from these instances or atleast transfer FAstq files to penn state open source galaxy severer. Is it possible or not? I have another question in this regard when I tried to upload the FASTq files via web link or FTP the job is never completed. I have tried it couple of times. This problem is there from last couple of months. Are there so me changes which have been implemented recently which is not allowing me to upload the files. Indeed I have seen from last month or so too many messages suggesting either Tophat job stuck or job is not completed or unable to upload the file. I am not if all tehse problems are related (storage) or not. Can someone from Galaxy team advice.

3 6

How To Keep Original Sample Names in Galaxy through Cufflinks pipeline?
by Christopher M. Weber 28 May '12

28 May '12

Hello, Overall Problem: Given sample names are not carried through Cufflinks pipeline. Instead, they are referenced with a number and in final Cuffdiff output are referred to as Sample 1/Q1, Sample 2/Q2 etc., instead of given name which requires tedious re-labeling. Is there a way to implement -L function in Galaxy so that sample names are carried through from Cufflinks to Cuffdiff? Originally posted in Seqanswers: http://seqanswers.com/forums/showthread.php?t=20338, where commenter suggested using -L as a fix but I don't see this option in Galaxy.

2 1

GATK workshop survey
by Geraldine Van der Auwera 26 May '12

26 May '12

For Galaxy users who use the GATK tools: The GATK team at the Broad Institute is planning a workshop for users this Fall. If you're interested in attending the workshop, you can vote on the topics and activities that you'd like the workshop to include by filling in this survey: GATK workshop survey <http://www.surveymonkey.com/s/T799FQK>

1 0

Bam to Fastq conversion
by William M. Strauss 26 May '12

26 May '12

I have a bunch of BAM files that I need to convert to FASTQ, are there such tools in Galaxy?

2 1

Runtime on public Galaxy and current version of Galaxy on the Cloud?
by Diana Cox-Foster 24 May '12

24 May '12

Hi, I am finding that the run time on the public galaxy is exceptionally long, with job submitted yesterday still waiting to start. Given that I need to have analyses performed more quickly, I have tried to use Galaxy on the Cloud. Is this the following still the current version of cloudman to use? Current AMI: AMI: ami-da58aab3 Name: 861460482541/galaxy-cloudman-2011-03-22 I have set up instances for this version and have waited for over an hour for them to load, with multiple attempts to get the websites to open. All status indicators say that the instance is running. Any insight welcomed--- thanks--- Diana ********************************** Diana Cox-Foster, Professor office: 536 ASI Bldg MAIL: 501 ASI Bldg Department of Entomology Penn State University University Park, PA, USA 16802 email: dxc12(a)psu.edu office phone: 814-865-1022 dept. phone: 814-865-1895

2 3