- galaxy-user - lists.galaxyproject.org

GATK best practices with local installation of Galaxy
by Camille Stephan 04 Aug '11

04 Aug '11

Hello guys, I'm trying to run a pipeline of the best practices for snp and indel discovery as described by the people at Broad and I'm running into troubles with the GATK tools in a local installation of Galaxy. The main problem I have is that merging bam files with the samtools merge tool doesn't keep read group for each sample, causing "Count Covariates" to crash. The pipeline works fine with a single bam file, but I need to realign at least two files at a time. Is there a way to set the read group of a merged bam inside Galaxy? Are there plans to include the "merge" tool from Picard in Galaxy? Is there an easy way for me to do this locally? (Although I would like to run this in the cloud later on when the workflow is ready). Thanks! Camille -- *** Camille Stephan-Otto Attolini, PhD Senior Research Officer, Bioinformatics and Biostatistics unit IRB Barcelona Tel (+34) 93 402 0553

2 4

(no subject)
by tarek addwebi 03 Aug '11

03 Aug '11

Hi Dear Is there anybody whom I can share my data with? I have an important question that I tried to answer, but I could not. Please see the attachment first, and let us see the first read in the first row. I need to know how many times I have this read in the whole data. Do I have to count all reads manually to know the number of this read? It would take a long time to count 11 million reads. Thank you

2 1

GATK best practices in local installation of Galaxy
by Camille Stephan 03 Aug '11

03 Aug '11

Hello guys, I'm trying to run a pipeline of the best practices for snp and indel discovery as described by the people at Broad and I'm running into troubles with the GATK tools in a local installation of Galaxy. The main problem I have is that merging bam files with the samtools merge tool doesn't keep read group for each sample, causing "Count Covariates" to crash. The pipeline works fine with a single bam file, but I need to realign at least two files at a time. Is there a way to set the read group of a merged bam inside Galaxy? Are there plans to include the "merge" tool from Picard in Galaxy? Is there an easy way for me to do this locally? (Although I would like to run this in the cloud later on when the workflow is ready). Thanks! Camille -- *** Camille Stephan-Otto Attolini, PhD Senior Research Officer, Bioinformatics and Biostatistics unit IRB Barcelona Tel (+34) 93 402 0553

1 0

(no subject)
by Addwebi, Tarek 03 Aug '11

03 Aug '11

Hi Dear Is there anybody whom I can share my data with? I have an important question that I tried to answer, but I could not. Please see the attachment first, and let us see the first read in the first row. I need to know how many times I have this read in the whole data. Do I have to count all reads manually to know the number of this read? It would take a long time to count 11 million reads. Thank you

2 1

Cuffcompare .tmap file
by Aleks Schein 03 Aug '11

03 Aug '11

Dear all, I am trying to run Cufflinks installation in Galaxy on Solexa RNAseq samples from HeLa cells. Running Cuffcompare, according to the manual, should produce a tmap file, listing FMI values for detected isoforms. However, my files only have either "100" or "0" in FMI field. And FPKM column contains only zeros. Is there something wrong with my input files, or parameter settings? Or is it rather a specific issue with Galaxy Cufflink's installation? The data in question is available here: http://main.g2.bx.psu.edu/u/aleks/h/guided-assemblyadvanced Thanks, Aleks Schein

3 4

question about using bowtie
by William Light 02 Aug '11

02 Aug '11

I am trying to use bowtie to assign reads to the s. Cerevisiae genome. I have data from paired end SOLiD sequencing with two unique six base pair barcodes. Can I use bowtie to make csfasta and qual files from my mixed original data split by bar code? I know I can use the trim option to remove the barcode, but how do I specify one only?

2 2

calculating percent coverage over the target genome
by David Matthews 01 Aug '11

01 Aug '11

Hi Does anyone know how to calculate how much of a genome was covered by an alignment irrespective of the depth at each base? Cheers David

6 10

TopHat
by Luciano Cosme 01 Aug '11

01 Aug '11

Hi, I am running galaxy locally and when I perform alignments with TopHat I get the following error: Error in tophat: [Fri Jul 29 17:55:47 2011] Beginning TopHat run (v1.3.1) ----------------------------------------------- [Fri Jul 29 17:55:47 2011] Preparing output location ./tophat_out/ [Fri Jul 29 17:55:47 2011] Checking for Bowtie index files [Fri Jul 29 17:55:47 2011] Checking for reference FASTA file Warning: Could not find FASTA file /tmp/tmp1dXHLG/dataset_26.dat.fa [Fri Jul 29 17:55:47 2011] Reconstituting reference FASTA file from Bowtie index Executing: /bin/bowtie-inspect /tmp/tmp1dXHLG/dataset_26.dat > ./tophat_out/tmp/dataset_26.dat.fa [Fri Jul 29 17:56:39 2011] Checking for Bowtie Bowtie version: 0.12.7.0 [Fri Jul 29 17:56:39 2011] Checking for Samtools Error locating program: samtools I installed the samtools (in several places already), but it seems I did not put it in the right place. So where galaxy search for it? Thank you. Luciano

2 1

filtering fastq file according to qual score
by Haluk Dogan 01 Aug '11

01 Aug '11

Hi, I am trying to filter my fastq file with the condition of if quality score of reads is less then min score. So far, I have tried both *fastq_quality_filter* and *Filter FASTQ under NGS: QC and manipulation** *but I was not be able to do it. In the following you can see my fastq file. @F4HZV5G02CX6WP rank=0000096 x=1092.0 y=1767.0 length=45 TTGAGCAGCGGCGTCACGGCGGCGGCCTCGGCGGCCGCATAGGCG + FFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIIIIIHFFDDBDA> And these are quality scores. [37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 40, 39, 37, 37, 35, 35, 33, 35, 32, 29] I want to filter bases if their quality scores are less than 33. Any help would be greatly appreciated. -- HD

2 3

Re: [galaxy-user] Ngs Mapping using LASTZ
by Thomas Jenner Pulikotial Augustine 30 Jul '11

30 Jul '11

Hi, I'm trying to map a data set containing 454 reads to a reference genome using LASTZ alignment package in Galaxy. I'm following a workflow used for Illumina reads with the only change in the alignment package, i'm using LASTZ instead of bowtie/bwa. The following is the procedure please correct me if it's wrong and do suggest any additional procedure to make the workflow better. In addition to this i'm, trying to do metagenomics analysis as well by following the procedure given in one of the video tutorials. I've submitted the files for alignment and its been a day since the submission and the process has not yet started, could you tell me what could be the reason. The file size is 110Mb, under history the package indicate "Job is waiting run" how long does it usually take to initiate the process in the queue. Your suggestion's are valuable, thanks for developing Galaxy. Kindly help, thank you. 1.Uploaded a FASTA file as input 2.Align using LASTZ 3.Filtering SAM files on bit-wise flag values 4.Finding how many reads are mapped to each chromosome 5.Sort the read counts 6.convert sam to bam 7.perform flagstat operation Br, Thomas

2 1