- galaxy-user - lists.galaxyproject.org

Problem loading BAM into IGV browser - invalid GZIP header error message
by Vosberg, Sebastian 29 Nov '13

29 Nov '13

Dear all, sometimes I encouter a problem trying to load BAM files directly from Galaxy into the IGV browser. First I am starting the IGV browser locally, then clicking on the appropriate BAM file and on "display with IGV _local_" in Galaxy. In most cases it works, but for some reasons not with specific files. The error message says "Error loading http://_URL-to-file_/galaxy_example.bam: An error occured while accessing http://_URL-to-file_/galaxy_example.bam Invalid GZIP header" What does it mean? And why am I able to download the BAM file and load it from HDD into the IGV? The problem comes with all BAM files of one sample cohort, but not with another (but same sample design and workflow used). Rerunning the workflow doesn't help... I would be very thankful for every kind of help! Best, Sebastian Helmholtz Zentrum München Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) Ingolstädter Landstr. 1 85764 Neuherberg www.helmholtz-muenchen.de Aufsichtsratsvorsitzende: MinDir´in Bärbel Brumme-Bothe Geschäftsführer: Prof. Dr. Günther Wess, Dr. Nikolaus Blum, Dr. Alfons Enhsen Registergericht: Amtsgericht München HRB 6466 USt-IdNr: DE 129521671

2 1

human genome latest annotaiton
by Irene Bassano 28 Nov '13

28 Nov '13

Hi Jen, I uploaded some fastq files and selected as Genome from the drop down list ""Homo sapiens b37(hg_g1k_v37). Is this the same as the genome listed in UCSC "February 2009 (GRCh37/hg19)"? I am using iGenomes to get the gene names rather than annotation such as NM_00xxxx and I fused the UCSC website choosing the newest genome, February 2009 Thanks, (sorry, I think i sent a mail to bugs report by mistake) best, Irene

2 1

Problems with Picard and GATK tools
by garzetti 27 Nov '13

27 Nov '13

Dear all, I have been trying to analyze some recently acquired WGS reads (re-sequencing with MiSeq) but I am having problems with both Picard and GATK tools and I don't know where the problem is. My fastq reads are already in the sanger/illumina 1.9 format, as recognized by the FastQC tool. I have modified the attributes of the read files from fastq to fastqsanger and successfully performed a BWA mapping against my reference sequence. I have then filtered the resulting SAM file with "NGS: SAM Tools, Filter SAM" to have only paired-mapped reads and reordered the file with "NGS: Picard, Reorder SAM/BAM", allowing the option Truncate sequence names after first whitespace. Since my reads are highly duplicated (from the FastQC output), I have run the "NGS: Picard, Mark Duplicate reads" tool, obtaining the removal of only 2 duplicated reads. I went on adding a Read Group with "NGS: Picard, Add or Replace Groups" and starting the SNP calling with GATK using the tool Realigner Target Creator. And here I have obtained an empty file and I have started thinking something is wrong. So, I have tried to perform the mapping again (as suggested by the GATK wiki when someone got an empty file like me), running the same steps on different sample reads, but I have always the same strange results from the De-duplication step and the Realigner tool. I think there is something wrong during the BWA mapping step, or even in my fastq reads, but I cannot understand what it is. Any idea? And what is the read quality format accepted by Galaxy tools? I know it's the PHRED+33, but how does it look like? Example 1: ??A????BDDDEDDDDGGGGGGGHHHF##77AEFHIIHIHIIIH##77ACFFHHHIHIIHH#5AEFHHHHHHF#55AFHEAEDHHHHHHFFCFHHH#######64#66=+@DDEGGGGDEDEEBEECCECEEGGEGGGGGGGGEEGGA5C0 or Example 2: !!"!!!!#%%%&%%%%((((((()))'!!!!"&')**)*)***)!!!!"$'')))*)**))!!"&'))))))'!!!"')&"&%))))))''$')))!!!!!!!!!!!!!!!%%&((((%&%&&#&&$$&$&&((&((((((((&&(("!$! I did BWA mapping with both types and it worked, but maybe the problems lies somewhere here. I hope someone can help me! Thank you!!!! Debora

1 0

Re: [galaxy-user] Cufflinks returned 0 value in all RPKMs
by Jennifer Jackson 27 Nov '13

27 Nov '13

Hi Dao, To run the analysis correctly on SOLiD data, a local or cloud Galaxy would be needed. A cloud Galaxy is web based and if you follow the links below, you will find exact instructions for getting set up. There are Amazon fees, but they do have various grant programs that you can review at their site for help with that. Galaxy itself is always free!! About tools on the Test server .. these are constantly in flux in terms of dependencies and such, and we don't support them because this is truly a development environment for us. You may find that certain tools, including this one, work on smaller datasets at some point in the future, but for the public this shouldn't be used for serious work. One last option, and I don't know for certain if there is one in here that will accept your datatype and enough quota to do significant work (these also change over time), are other public Galaxy servers. Each is supported by the hosting group. A list is here and you can look through/review the sites to see what is available: http://wiki.galaxyproject.org/PublicGalaxyServers Take care, Jen Galaxy team On 11/26/13 7:43 AM, Ly, Dao wrote: > > Hi > > Thank you very much for your reply. For the time being, I just wanted > to be familiarized with the workflow and the open resource of galaxy > main to analyze NGS. If you could advise me how I can obtain the RPKM > that will be great. I have tried many ways to map but no luck so far. > I think I’m at the end of my wits. > > I did try tophat2 with ion torrent data and it worked fine. This solid > SRA format is giving me a hard time and I can only work on webbase > program. I also try tophat for solid on test server but it failed! > Many thanks again > > Best regards > > Dao > > *From:*Jennifer Jackson [mailto:jen@bx.psu.edu] > *Sent:* November 20, 2013 8:46 PM > *To:* Ly, Dao; galaxy-user(a)lists.bx.psu.edu > *Subject:* Re: [galaxy-user] Cufflinks returned 0 value in all RPKMs > > Hello, > > If the data is RNA from rat, then you will want to be using Tophat > instead of Bowtie. Otherwise the data will not be mapped as spliced > the results will be off in many ways (the fragments counts are a small > symptom of a larger problem). > > You can use 'Tophat for SOLiD' on a suitable local or cloud Galaxy > instance. It is available on the Test server, but tools are not > supported here (we test/break things!) and the quotas are just 10G > with an account. But maybe is a place to do a small trial run before > committing to a cloud server. > http://getgalaxy.org > http://usegalaxy.org/cloud > http://usegalaxy.org/toolshed > > More about RNA-seq is in our wiki and public server, including > link-outs and tutorials, you can get started here: > Example → RNA-seq analysis tools: > http://wiki.galaxyproject.org/Support#Interpreting_scientific_results > See RNA-seq examples: http://wiki.galaxyproject.org/Learn#Other_Tutorials > > Best, > > Jen > Galaxy team > > On 11/20/13 6:09 AM, Ly, Dao wrote: > > Hi > > I have been trying to analyze a rat Solid SRA but I encountered a > problem: cufflinks gave me 0 RPKM in all genes. Here is my workflow > > 1.Get data with EBI SRA: sent the fastaq file directly to galaxy > > 2.Fastaq groomer > > 3.Mapped with bowtie for Solid (paire-ended) with the built- in > index rat rn5 as reference genome > > 4.Sam to Bam the bowtie mapping result > > 5.Cufflinks the bam file > > All RPKMs of gene expression and transcript expression have a 0 > value even thought the RPKM status is OK. I used default setting > for all jobs. Am I missing something? Any help, suggestion will be > greatly appreciated. Thank you very much > > Best regards > > Dao > > > > > ___________________________________________________________ > > The Galaxy User list should be used for the discussion of > > Galaxy analysis and other features on the public server > > at usegalaxy.org. Please keep all replies on the list by > > using "reply all" in your mail client. For discussion of > > local Galaxy instances and the Galaxy source code, please > > use the Galaxy Development list: > > > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > > > To manage your subscriptions to this and other Galaxy lists, > > please use the interface at: > > > > http://lists.bx.psu.edu/ > > > > To search Galaxy mailing lists use the unified search at: > > > > http://galaxyproject.org/search/mailinglists/ > > > > -- > Jennifer Hillman-Jackson > http://galaxyproject.org -- Jennifer Hillman-Jackson http://galaxyproject.org

1 0

Transcriptome Hypericum perforatum
by miroslav.sotak 26 Nov '13

26 Nov '13

To whom it may concern I would like to kindly ask you if you do have any experience in de-novo transcriptomic analysis (no reference genome available) who might give us some advice. Our main question is how to create the best set of cDNA contigs, on which we can map our RNAseq reads for the analysis of differential expression. Currently 4 larger sets of of RNAseq reads are available from different genotypes as well as draft genome assembly for one of the genotypes. We worry about the SNPs in different genotypes affecting the assembly, if we combine all the RNAseq datasets and using assemblers such as Trinity, Oases, Velvet. Might it be better to use the draft genomic assembly to obtain cDNA contigs using Tophat/cufflinks via all available RNAseq data or only using the RNAseq data from the same genotype as the genome draft? Thank you in advance Best wishes Miro Sotak

3 2

Re: [galaxy-user] help for trim sequences
by Jennifer Jackson 25 Nov '13

25 Nov '13

Hi Seung Hee, You can request that this tool be added to the public Main server at usegalaxy.org through Trello and the team will consider it. For right now, the options are local or cloud. (as in my other reply) Or, you can look around the the other public servers hosted by our community - each is run by a distinct group with their own contact/help/public-use criteria: http://wiki.galaxyproject.org/PublicGalaxyServers It may be simplest to see if a local will do the job, then upload the results to the public server for downstream analysis. Just do the very basics of a "production server" install and then add the tool to test it out. This will take some line commands to set up, but shouldn't be too much of an investment. The links are: http://getgalaxy.org http://usegalaxy.org/toolshed http://wiki.galaxyproject.org/Tool%20Shed#Installing.2C_maintaining_and_uni… Local install help/discussion: galaxy-dev(a)bx.psu.edu Subscribe or search prior Q/A: http://wiki.galaxyproject.org/MailingLists Take care, Jen Galaxy team On 11/25/13 11:29 AM, Seung Hee Cho wrote: > Thank you for much for your great help! > I am trying to use this tool but I am wondering if I can use this > CutAdapt tools on the public server. I was working on my job on the > public server, so if not I need download it for use. > I truly appreciate your help! > > Best, > > *Seung Hee Cho* > Contreras Research Group, CPE 5.416 > The University of Texas at Austin > Department of Chemical Engineering > 200 E Dean Keeton St. Stop C0400 > Austin, TX 78712-1589 > > > On Mon, Nov 25, 2013 at 10:08 AM, Jennifer Jackson <jen(a)bx.psu.edu > <mailto:jen@bx.psu.edu>> wrote: > > Thanks Peter for another option! > > Jen > Galaxy team > > > On 11/23/13 6:19 AM, Peter Cock wrote: > > On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson > <jen(a)bx.psu.edu <mailto:jen@bx.psu.edu>> wrote: > > Hi Seung Hee, > > I know we discussed this on the other list, but I didn't > point you to the > open development ticket to (potentially) extend the > functions of the "Cut" > tool. This is not being actively worked on right now, but > you can follow it > for updates if you want. > https://trello.com/c/CbFSHrU5 > > Others are still welcome to comment about what types of > solutions they might > have to offer. There is no specific tool to do this on > Main right now (or in > the Tool Shed, from my checks). http://usegalaxy.org/toolshed > > This tool of mine might do what Seung Hee wanted, > but I have not tried it on very large Illumina datasets: > > http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip > > Regards, > > Peter > > > -- > Jennifer Hillman-Jackson > http://galaxyproject.org > > -- Jennifer Hillman-Jackson http://galaxyproject.org

1 0

Identifying Genes
by Loupe, Jacob M. 25 Nov '13

25 Nov '13

I am very new to Galaxy. We have performed a comparative analysis between the transcriptomes of different samples. We performed the analysis using Galaxy software (Tophat; CuffDiff; etc). What my PI has done is compiled a list of all the genes differentially expressed between each set, each in a separate excel sheet. So what I have is an excel spreadsheet with a list (usually around 300) of test id, gene id, and locus (ChrX:111111111-22222222222). Initially, we have been identifying each gene individually, one at a time, by pasting the locus into the UCSC browser. This works, but is incredibly tedious. There has to be a better way in Galaxy. I have tried making BED files out of the loci, but so far I have been unable to identify genes using galaxy. Can someone please explain how I can take my long list of loci and get gene names, ID, function, and possibly some downstream comparative ontologies to begin analyzing. Like I said, very new to Galaxy and genomics. Thanks very much

2 1

help for trim sequences
by Seung Hee Cho 25 Nov '13

25 Nov '13

Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGCGACCACCG **AACACTGCGTTTGCTGGCTTTG*ATG >From this sequence, I want to remove *AATGATACGGCGACCACCG,* *so I can get "**AACACTGCGTTTGCTGGCTTTG*ATG" only. If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much! Best, *Seung Hee *

4 5

Read_group_tracking files are not enough for cummerbund visualisations on replicates?
by Aranday Cortes, Elihu 21 Nov '13

21 Nov '13

Hi, Cuffdiff in Galaxy produces "read_group_tracking" files. However, I wonder if these files are enough when using 'replicates=T' in cummeRbund or I also need "read_groups.info" and "run.info" files in myDir. I've tried 'replicates(cuff)' with the 'read_group_tracking' files in my directory and I get back an empty set, means that cummerbund is not using replicates (or I'm doing something wrong!). At this time I don't see other option that run cuffdiff locally. At least you have any suggestion or advice about how I can get 'info.files' from Galaxy. Any particular reason why Cuffdiff output files in Galaxy are not ALL the files described in the manual tool? Thanks for you help. Elihu

2 1

Cufflinks returned 0 value in all RPKMs
by Ly, Dao 21 Nov '13

21 Nov '13

Hi I have been trying to analyze a rat Solid SRA but I encountered a problem: cufflinks gave me 0 RPKM in all genes. Here is my workflow 1. Get data with EBI SRA: sent the fastaq file directly to galaxy 2. Fastaq groomer 3. Mapped with bowtie for Solid (paire-ended) with the built- in index rat rn5 as reference genome 4. Sam to Bam the bowtie mapping result 5. Cufflinks the bam file All RPKMs of gene expression and transcript expression have a 0 value even thought the RPKM status is OK. I used default setting for all jobs. Am I missing something? Any help, suggestion will be greatly appreciated. Thank you very much Best regards Dao

2 1