- galaxy-user - lists.galaxyproject.org

Re: [galaxy-user] galaxy-user Digest, Vol 57, Issue 26
by Brian Lam 28 Mar '11

28 Mar '11

galaxy-user-request(a)lists.bx.psu.edu wrote: >Send galaxy-user mailing list submissions to > galaxy-user(a)lists.bx.psu.edu > >To subscribe or unsubscribe via the World Wide Web, visit > http://lists.bx.psu.edu/listinfo/galaxy-user >or, via email, send a message with subject or body 'help' to > galaxy-user-request(a)lists.bx.psu.edu > >You can reach the person managing the list at > galaxy-user-owner(a)lists.bx.psu.edu > >When replying, please edit your Subject line so it is more specific >than "Re: Contents of galaxy-user digest..." > > >HEY! This is important! If you reply to a thread in a digest, please >1. Change the subject of your response from "Galaxy-user Digest Vol ..." to the original subject for the thread. >2. Strip out everything else in the digest that is not part of the thread you are responding to. > >Why? >1. This will keep the subject meaningful. People will have some idea from the subject line if they should read it or not. >2. Not doing this greatly increases the number of emails that match search queries, but that aren't actually informative. > >Today's Topics: > > 1. Convert SOLiD data (lishiyong) > 2. Re: biomart plugin (Greg Von Kuster) > 3. Re: Convert SOLiD data (Ryan Golhar) > 4. Re: Convert SOLiD data (Jennifer Jackson) > 5. Re: Sort & index SAM-files automatically (Ryan Golhar) > > >---------------------------------------------------------------------- > >Message: 1 >Date: Mon, 28 Mar 2011 11:35:15 +0800 >From: "lishiyong" <lishiyong(a)genomics.org.cn> >To: "galaxy-user" <galaxy-user(a)lists.bx.psu.edu> >Subject: [galaxy-user] Convert SOLiD data >Message-ID: <201103281135102031338(a)genomics.org.cn> >Content-Type: text/plain; charset="us-ascii" > >Hello! > I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with SOAPdenovo.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting . >for example: >T02023221102101032002002030011232121133222233311200 ��> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA > >But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. >2011-03-28 > > > >lishiyong >

2 1

Convert SOLiD data
by lishiyong 28 Mar '11

28 Mar '11

Hello! I convert SOLiD csfasta- and qual-files to fastq-files ,I want to use the fastq-files to do denovo with SOAPdenovo.because the SOLiD de novo accessory tools Require large memory .But ,I find that there're some question for the converting . for example: T02023221102101032002002030011232121133222233311200 ��> AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTGGGGTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 lishiyong

5 5

Sort & index SAM-files automatically
by Jochen Seggewiß 28 Mar '11

28 Mar '11

Hello! I convert SOLiD csfasta- and qual-files to fastq-files and map those against Hg19 (Bowtie). I would like to use the resulting sam-files in the IGV browser (Broad Institute). Therefore, the sam-file need to be sorted an indexed. This could be done using the igvtools. However, it would be nicer if this sorting and indexing could be done automatically using GALAXY. I guess that it is certainly possible but I do not know how. Could anybody let me know how it works and what function I have to use, respectively? How can I sort the sam-file the correct way? Thank you in advance. Best regards Jo

3 3

biomart plugin
by Andrea Edwards 28 Mar '11

28 Mar '11

Hello I have looked at the biomart plugin for Galaxy and this seems to allow access to marts on the biomart central server. Is there anyway to use this plugin to access a biomart on my server if I can't make my biomart available on the biomart central server. If not, would it be possible to achieve this with galaxy tools. I've heard of galaxy tools but never made one so I don;t know what is involved. Failing that would i be able to use the biomart plugin to access my server if I had a local installation of galaxy thanks

2 1

Re: [galaxy-user] dataflow using Galaxy on Amazon EC2
by Enis Afgan 28 Mar '11

28 Mar '11

Hi Luqman, I was suggesting to visit Galaxy Main to get an idea of what is possible within Galaxy and get familiar with how tools interact with each other, what kind of input/output the expect/provide so that you could draw parallels and get a better idea of how to integrate your own tools in a local instance of Galaxy. As I mentioned earlier, you will have to create a tool wrapper as described on this page https://bitbucket.org/galaxy/galaxy-central/wiki/AddToolTutorial that describes (in terms Galaxy can understand) how to run the tool. Then, if the tool handles multiple steps within itself (i.e., a single command results in multiple transformations of the data), all of the handling of the dataflow will be handled just as if the tool was invoked from the command line. If one command is all that is needed to run multiple java classes (i.e., the tool is equivalent of a workflow), you may now need to create a Galaxy workflow but run your set of java classes a single Galaxy tool. In principle, if a Galaxy workflow is to be created, the data between individual steps within a workflow are passed as files that Galaxy manages. Hope this helps, Enis On Fri, Mar 25, 2011 at 9:24 PM, Luqman Hodgkinson <luqman(a)berkeley.edu>wrote: > > > > > Hi Enis, > > I went to Galaxy Main: there are many built-in tools, but I did not see how > to add my own tools. > > Currently I am using my own custom software to manage a configurable > dataflow through my Java classes. I was interested in transitioning to > Galaxy: however if I remove my custom software for the dataflow, would I > need to create a separate executable for each class? When connecting these > executables into a workflow, how is the data passed from one executable to > the other? In RAM or on disk? > > With best wishes, > Luqman > > > > > On Mar 25, 2011, at 2:27 PM, Enis Afgan wrote: > > Hi Luqman, > Take a look a my comments below. > > On Fri, Mar 25, 2011 at 5:06 PM, Luqman Hodgkinson <luqman(a)berkeley.edu>wrote: > >> >> >> >> >> Hi Enis, >> >> Thank you for your detailed reply. After playing with Galaxy, there are >> some questions I have. >> >> 1. All my Java classes are in the same project. There is only a single >> Main class. In order to use Galaxy, must each class be converted to a .jar >> file individually? If so, the disadvantage to this is then that only >> command-line parameters can be passed in. How does the data flow between the >> classes? Must each class read input from files and write input to files? >> That is, what is the nature of your type system for passing data between >> components. Can data be passed directly through RAM or must it go through >> the file system? >> >> If you are able to perform your complete analysis using a combination of > your Java classes by simply executing a single command (i.e, invoking a > single main class), the same can be achieved through Galaxy. You would > create a galaxy tool wrapper that allows Galaxy to invoke that same command > and the rest (i.e.., executing the tool) is going to be the same (i.e., the > same set of methods will get invoked and you should get the same output). > Once Galaxy invokes a tool, any form of data flow within that tool is up to > the tool itself so if the classes share data between each other, the same > will happen once they are invoked through Galaxy. > > >> 2. Provenance is very important for my workflow. The workflow will be run >> multiple times and a large number of versions will be created. These should >> be organized somewhere on the file system with timestamps and descriptions >> of the versions of the workflows that were used. How much support does >> Galaxy have for this? >> >> Galaxy keeps track of all the parameters and input data used to run a tool > or a workflow so, once the tool is integrated with Galaxy, keeping up with > the details is trivial - that's a big part of why Galaxy exists to begin > with. > > > 3. Have you seen the new Conveyor paper? >> http://www.ncbi.nlm.nih.gov/pubmed?term=21278189 My requirements are very >> similar to those addressed in this paper. However, the current version of >> Conveyor does not seem very stable: I was even unable to get their graphical >> user interface running from their Java files. What are the capabilities of >> Galaxy for this use case? >> >> Unfortunately I have not read this paper yet so I cannot comment much. > If you have not yet, I would suggest you give Galaxy Main (usegalaxy.org) > a shot and try to run some jobs and create a few workflows to get an idea of > what can be done with tools once they are integrated with Galaxy as well as > the type of data and information Galaxy keeps. That should give you a good > indication of whether available functionality can be applied in your > scenario as well. > > Enis > > > >> Sincerely, with best wishes, >> Luqman >> >> >> On Mar 25, 2011, at 10:21 AM, Enis Afgan wrote: >> >> Hi Luqman, >> Were you planning on using Galaxy CloudMan (usegalaxy.org/cloud) and >> integrating your tool (i.e., Java classes) into the Galaxy that it deploys >> or simply starting a new EC2 instance and setting up a Galaxy instance from >> scratch? >> Either way, I would suggest trying the process out on your local system >> first. Adding new tools to Galaxy is pretty straightforward once you have >> the tool installed on the system, see >> https://bitbucket.org/galaxy/galaxy-central/wiki/AddToolTutorial. That >> will also allow you to test the overall functionality offered by Galaxy in >> the context of your own tool before trying to deploy the whole thing on the >> cloud. >> >> Once you transition to the cloud though, you would have to repeat the >> process of installing the tool on the created instance as you have done on >> the local system followed by copying the tool wrapper created to integrate >> it with Galaxy. If you started with a clean instance (i.e., not Galaxy >> CloudMan), after you've installed your tool and integrated it with Galaxy, >> you could simply use the AWS web console to create an AMI automatically. >> Then, you would start the newly created AMI, start Galaxy and start >> processing your data. Note that any data you upload to an instance will be >> lost once you terminate the instance though, unless you associate an EBS >> volume with it and have Galaxy store analysis data there (this is easily >> configured in Galaxy's universe_wsgi.ini file). >> >> Alternatively, you could use CloudMan and add your tool to the set of >> already existing tools as described here: >> https://bitbucket.org/galaxy/galaxy-central/wiki/Cloud/CustomizeGalaxyCloud >> If using CloudMan, all of the details regarding data persistance and >> Galaxy setup are automatically managed for you (excluding the addition of >> your own tool). >> >> Hope this helps, >> Enis >> >> On Mon, Mar 21, 2011 at 6:56 PM, Luqman Hodgkinson <luqman(a)berkeley.edu>wrote: >> >>> >>> >>> >>> >>> Dear Galaxy developers, >>> I have a collection of Java classes linked by a custom dataflow >>> architecture. All classes are in a single project but some of these classes >>> call executables written in languages other than Java. I am investigating >>> the possibility of transitioning to Galaxy. Essentially my desires are to >>> link these Java classes in a DAG representing the dataflow and to execute >>> the dataflow in Amazon EC2. The data flowing along the edges are arbitrary >>> custom Java classes. Additionally it is important to cache intermediate >>> results. The data is acquired from a few web services: iRefIndex, IntAct, >>> UniProt, and Gene Ontology. There are complex software dependencies so after >>> setting up the dataflow I would like to save the entire system as an >>> abstract machine image (AMI). How difficult would this transition be, and >>> would it be worth the effort? >>> Sincerely, with best wishes, >>> Luqman Hodgkinson, >>> Ph.D. student, UC-Berkeley >>> >>> >>> >>> >>> >>> ___________________________________________________________ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >>> >> >> >> > >

1 0

biomart plugin
by Andrea Edwards 26 Mar '11

26 Mar '11

Hello If i had a local installation of galaxy is it possible to access a biomart database on my local server. It is my understanding that a dataset has to be available on the biomart central server to be accessible via the galaxy biomart plugin. thanks

1 0

Re: [galaxy-user] dataflow using Galaxy on Amazon EC2
by Enis Afgan 25 Mar '11

25 Mar '11

Hi Luqman, Take a look a my comments below. On Fri, Mar 25, 2011 at 5:06 PM, Luqman Hodgkinson <luqman(a)berkeley.edu>wrote: > > > > > Hi Enis, > > Thank you for your detailed reply. After playing with Galaxy, there are > some questions I have. > > 1. All my Java classes are in the same project. There is only a single Main > class. In order to use Galaxy, must each class be converted to a .jar file > individually? If so, the disadvantage to this is then that only command-line > parameters can be passed in. How does the data flow between the classes? > Must each class read input from files and write input to files? That is, > what is the nature of your type system for passing data between components. > Can data be passed directly through RAM or must it go through the file > system? > > If you are able to perform your complete analysis using a combination of your Java classes by simply executing a single command (i.e, invoking a single main class), the same can be achieved through Galaxy. You would create a galaxy tool wrapper that allows Galaxy to invoke that same command and the rest (i.e.., executing the tool) is going to be the same (i.e., the same set of methods will get invoked and you should get the same output). Once Galaxy invokes a tool, any form of data flow within that tool is up to the tool itself so if the classes share data between each other, the same will happen once they are invoked through Galaxy. > 2. Provenance is very important for my workflow. The workflow will be run > multiple times and a large number of versions will be created. These should > be organized somewhere on the file system with timestamps and descriptions > of the versions of the workflows that were used. How much support does > Galaxy have for this? > > Galaxy keeps track of all the parameters and input data used to run a tool or a workflow so, once the tool is integrated with Galaxy, keeping up with the details is trivial - that's a big part of why Galaxy exists to begin with. 3. Have you seen the new Conveyor paper? > http://www.ncbi.nlm.nih.gov/pubmed?term=21278189 My requirements are very > similar to those addressed in this paper. However, the current version of > Conveyor does not seem very stable: I was even unable to get their graphical > user interface running from their Java files. What are the capabilities of > Galaxy for this use case? > > Unfortunately I have not read this paper yet so I cannot comment much. If you have not yet, I would suggest you give Galaxy Main (usegalaxy.org) a shot and try to run some jobs and create a few workflows to get an idea of what can be done with tools once they are integrated with Galaxy as well as the type of data and information Galaxy keeps. That should give you a good indication of whether available functionality can be applied in your scenario as well. Enis > Sincerely, with best wishes, > Luqman > > > On Mar 25, 2011, at 10:21 AM, Enis Afgan wrote: > > Hi Luqman, > Were you planning on using Galaxy CloudMan (usegalaxy.org/cloud) and > integrating your tool (i.e., Java classes) into the Galaxy that it deploys > or simply starting a new EC2 instance and setting up a Galaxy instance from > scratch? > Either way, I would suggest trying the process out on your local system > first. Adding new tools to Galaxy is pretty straightforward once you have > the tool installed on the system, see > https://bitbucket.org/galaxy/galaxy-central/wiki/AddToolTutorial. That > will also allow you to test the overall functionality offered by Galaxy in > the context of your own tool before trying to deploy the whole thing on the > cloud. > > Once you transition to the cloud though, you would have to repeat the > process of installing the tool on the created instance as you have done on > the local system followed by copying the tool wrapper created to integrate > it with Galaxy. If you started with a clean instance (i.e., not Galaxy > CloudMan), after you've installed your tool and integrated it with Galaxy, > you could simply use the AWS web console to create an AMI automatically. > Then, you would start the newly created AMI, start Galaxy and start > processing your data. Note that any data you upload to an instance will be > lost once you terminate the instance though, unless you associate an EBS > volume with it and have Galaxy store analysis data there (this is easily > configured in Galaxy's universe_wsgi.ini file). > > Alternatively, you could use CloudMan and add your tool to the set of > already existing tools as described here: > https://bitbucket.org/galaxy/galaxy-central/wiki/Cloud/CustomizeGalaxyCloud > If using CloudMan, all of the details regarding data persistance and Galaxy > setup are automatically managed for you (excluding the addition of your own > tool). > > Hope this helps, > Enis > > On Mon, Mar 21, 2011 at 6:56 PM, Luqman Hodgkinson <luqman(a)berkeley.edu>wrote: > >> >> >> >> >> Dear Galaxy developers, >> I have a collection of Java classes linked by a custom dataflow >> architecture. All classes are in a single project but some of these classes >> call executables written in languages other than Java. I am investigating >> the possibility of transitioning to Galaxy. Essentially my desires are to >> link these Java classes in a DAG representing the dataflow and to execute >> the dataflow in Amazon EC2. The data flowing along the edges are arbitrary >> custom Java classes. Additionally it is important to cache intermediate >> results. The data is acquired from a few web services: iRefIndex, IntAct, >> UniProt, and Gene Ontology. There are complex software dependencies so after >> setting up the dataflow I would like to save the entire system as an >> abstract machine image (AMI). How difficult would this transition be, and >> would it be worth the effort? >> Sincerely, with best wishes, >> Luqman Hodgkinson, >> Ph.D. student, UC-Berkeley >> >> >> >> >> >> ___________________________________________________________ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ >> > > >

1 0

dataflow using Galaxy on Amazon EC2
by Luqman Hodgkinson 25 Mar '11

25 Mar '11

Dear Galaxy developers, I have a collection of Java classes linked by a custom dataflow architecture. All classes are in a single project but some of these classes call executables written in languages other than Java. I am investigating the possibility of transitioning to Galaxy. Essentially my desires are to link these Java classes in a DAG representing the dataflow and to execute the dataflow in Amazon EC2. The data flowing along the edges are arbitrary custom Java classes. Additionally it is important to cache intermediate results. The data is acquired from a few web services: iRefIndex, IntAct, UniProt, and Gene Ontology. There are complex software dependencies so after setting up the dataflow I would like to save the entire system as an abstract machine image (AMI). How difficult would this transition be, and would it be worth the effort? Sincerely, with best wishes, Luqman Hodgkinson, Ph.D. student, UC-Berkeley

2 1

is galaxy down?
by Keith E. Giles 25 Mar '11

25 Mar '11

I keep getting a "SERVER ERROR" message. Is galaxy down, or is this on my end?

2 1

Re: [galaxy-user] history
by Anton Nekrutenko 24 Mar '11

24 Mar '11

Tanita: Histories are saved automatically, but you need to be logged in to your Galaxy account. Thanks, anton On Mar 24, 2011, at 3:13 PM, Fuchs, Tania wrote: > Hi Anton, > > Thanks for the tip. I did not save my history, so I guess it was not saved automatically, since the "saved histories" is empty. I still have everything open at my home computer. Do you think I still can save it there? > > Thanks a lot again for your help, > > Tania > From: Anton Nekrutenko [mailto:anton@bx.psu.edu] > Sent: Thursday, March 24, 2011 12:44 PM > To: Fuchs, Tania > Cc: galaxy-user(a)bx.psu.edu > Subject: Re: [galaxy-user] history > > > Tanita: > > Click "Options" at the top of the history pane and choose "Saved histories". You will see your old history listed in the middle pane. > > Thanks, > > anton > galaxy team > > > On Mar 24, 2011, at 12:15 PM, Fuchs, Tania wrote: > >> Hello, >> >> I worked on my home computer with Galaxy online and next day when I came to the lab I hoped to be able to access everything I did at home through history, but it does not show up in history. I was logged in both times into my account. >> >> What did I do wrong? >> >> Thanks! >> >> Tania >> >> ___________________________________________________________ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ > > Anton Nekrutenko > http://nekrut.bx.psu.edu > http://usegalaxy.org > > > Anton Nekrutenko http://nekrut.bx.psu.edu http://usegalaxy.org

1 0