- galaxy-user - lists.galaxyproject.org

FASTQ to FASTQSanger using Groomer question
by David K Crossman 22 Mar '11

22 Mar '11

Hello! I am fairly new to using Galaxy and have a question about the FASTQ Groomer feature. I have 4 RNA-Seq raw data files that were just recently generated from Illumina's NGS instruments. I am aware that the first step to perform in Galaxy is FASTQ Groomer to convert the format to FASTQ Sanger. I presume that I would choose Illumina 1.3+ in the "Input FASTQ quality scores type" box. However, if I look at the raw data reads, I notice that Line 4 (which encodes the quality values for sequence in Line 2) has values outside of the Illumina 1.3+ range (some of them fall into the Sanger format. I am enclosing the Quality Score Comparison figure along with some of the raw RNA-Seq data): Quality Score Comparison SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ | | | | | | 33 59 64 73 104 126 S - Sanger Phred+33, 93 values (0, 93) (0 to 60 expected in raw reads) I - Illumina 1.3 Phred+64, 62 values (0, 62) (0 to 40 expected in raw reads) X - Solexa Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw reads) Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format RNA-Seq raw data @HWI-ST156_294:7:1:1058:2165:0/1 CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC + HHHHFGGHHHGFHHFHHEGHC<GGGEB.EE9D?DDEEEE4FFFCBB/.C=D @HWI-ST156_294:7:1:1184:2191:0/1 CGTAAATCCATGTCTGACTTCTGGATAGCAAACACCAGCACCGCGTGGATG + EE;E=ECEEBE@EEEE=GBFGF/GFFC<FA;:@<8AEABB>A######### @HWI-ST156_294:7:1:1018:2200:0/1 NCTGATTAAGGATAATGAGTTTTTAGTAGAACTAATGATGTTATTCCTTGG + ################################################### @HWI-ST156_294:7:1:1225:2217:0/1 GTTTTTGACTACACAAAGCACCCTTCTAAACCAGACCATTCTGGAGAATGA + FFCEFFFE?FEBDC?987::,3:<-9145,DA<:C9;+?############ As a test in FASTQ Groomer, I chose either the Sanger or Illumina 1.3+ as the input quality scores type and these are the results I got: FASTQ Groomer on tn-read1 (using Sanger as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 sanger reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: 2 - 40 FASTQ Groomer on tn-read1 (using Illumina1.3+ as input) 6.1 Gb format: fastqsanger, database:mm9 Info: Groomed 45868679 illumina reads into sanger reads. Based upon quality and sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 'I'(73) Input decimal range: -29 - 9 Which one is right (I presume the Illumina 1.3+ one, but I can't find any sort of explanation)? I noticed that the "input decimal range" had different values (although they spanned the same length) in relation to which input was chosen. What would happen downstream in TopHat if Sanger was used instead of Illumina 1.3+ for these files? Is there any other reading material/websites/etc... out there that might help me better understand the quality score and which to use? Any info/help would be greatly appreciated. Thanks, David David K. Crossman, Ph.D. Systems Biologist/Analyst/Statistician Heflin Center for Genomic Science University of Alabama at Birmingham 720 20th Street South Kaul Room 420 Birmingham, AL 35294-0024 (205) 996-4045 (205) 996-4056 (fax) David K. Crossman, Ph.D.<mailto:dkcrossm@uab.edu> Heflin Center for Genomic Science<http://www.heflingenetics.uab.edu/>

4 3

Galaxy down?
by Felix Hammer 21 Mar '11

21 Mar '11

Hi, is there currently a problem with the Galaxy Server? When will it be up again? thx, Felix

2 1

postgres version 9.0.3
by Martin Senger 19 Mar '11

19 Mar '11

Hi, Our system changed from postgres 8.3 to postgres 9.0.3 - and since I am getting Server error on Galaxy. I am still investigating (because the server error is not there always, specifically it does not occur for an anonymous user) but I wonder if there are some known issues with Galaxy running with postgres > 8.3. It would definitely help in my error tracking. Thanks, Martin -- Martin Senger email: martin.senger@gmail.com,martin.senger@kaust.edu.sa skype: martinsenger

1 0

Workshop on Comparative Genomics, North America 2011
by Dave Clements 18 Mar '11

18 Mar '11

Hello all, Galaxy has been a part of the Workshop on Comparative Genomics held in the Czech Republic for the past several years. This two week workshop is now being offered in North America for the first time, and Galaxy will be participating again: Workshop on Comparative Genomics, North America 2011 Fort Collins, Colorado, United States July 10-22 http://www.molecularevolution.org/workshops/WCG The workshop focuses on comparative genomics using next generation sequencing data. Software packages including ABySS, Bowtie, Velvet, BioPerl, Scripture, GMOD, GBrowse_syn, PyCogent and QIME will be covered. Dan Blankenberg of the Galaxy team will teach the Galaxy sessions. There is also a Workshop on Molecular Evolution being offered immediately after the Comparative Genomics workshop. PDFs describing both events are attached. Applications for both workshops are due May 15. Thanks, Dave C -- http://galaxy.psu.edu/gcc2011/ http://getgalaxy.org http://usegalaxy.org/

1 0

CpG Masking changing alignment length?
by Michael E. Steiper 18 Mar '11

18 Mar '11

Hi All, I have a general question about CpG masking. I have a .maf file, when I use the maf to fasta tool, it gives me an alignment of 2,735,329 bp. But if I CpG mask the .maf file (restricted definition) then I use the maf to fasta tool, I get a very different alignment length, 5,572,544 bp. It would be great to know what is the cause of these differences. THANKS! Mike

3 4

Indel Output - what is this mystery column?
by John David Osborne 18 Mar '11

18 Mar '11

Hi, I was running an indel analysis on galaxy and I got a file as output that has rows that look like this: fly2 9829 9830 I ATACTCCAA 79 Can anybody tell me what the last column (79) means? There is obviously an insertion at 9829 with those nucleotides, but I'm not sure what the 79 refers to even after reading the linked documentation. Is it the number of reads that had this? A quality score? -John

2 1

showing content of 2 columns in select
by andrew stewart 17 Mar '11

17 Mar '11

Hi, I would like to be able to show the content of 2 columns from a file as the name of options in a select. Example : I have a file with: Column_1 Column_2 Column_3 I have a select field which feeds its values from this file The value for each choice is Column_1, but I would like the name (i.e. what the user sees) to be a combination of Column_2 and Column_3 (in this case, Column_3 contains a count, which would be shown between parenthesis) Is there a way to do that without resorting to the deprecated <code> tag ? (with actions maybe ?) Thanks

1 0

extracting raw count data from mapping
by Austin Paul 17 Mar '11

17 Mar '11

Hi, I would like to extract raw counts from tophat output. Does anyone know a way to do this in Galaxy? Thanks!

2 1

Fwd: [galaxy-bugs] to view raw data in ucsc browser
by Anton Nekrutenko 16 Mar '11

16 Mar '11

Begin forwarded message: > From: Anne LE MOUEL <alemouel13(a)gmail.com> > Date: March 16, 2011 10:57:42 AM EDT > To: galaxy-bugs(a)bx.psu.edu > Subject: [galaxy-bugs] to view raw data in ucsc browser > > > When I wanted to view the reads in ucsc browser 2 month ago (1st upload on the power point) , it was possible and now (2nd upload on the powerpoint) it is not proposed : ? > I'd like to view the reads in order to compare them with the MACS peaks. > Thank you for your answer, > Best regards > Anne Le Mouël > > -- > ***************************************************** > UMR7216 Epigénétique et Destin Cellulaire > Interface entre Développement et Environnement (Valérie Mezger) > Université Paris Diderot, 35 rue Hélène Brion, case 7042 > 75205 Paris Cedex 13 > Tel: +33 (0)1 57 27 89 25 > Fax: +33 (0)1 57 27 89 11 > ************************************************* > On ne fait jamais assez provision de ceux qu'on aime (Anatole Le Braz) > > > > -- > ***************************************************** > UMR7216 Epigénétique et Destin Cellulaire > Interface entre Développement et Environnement (Valérie Mezger) > Université Paris Diderot, 35 rue Hélène Brion, case 7042 > 75205 Paris Cedex 13 > Tel: +33 (0)1 57 27 89 25 > Fax: +33 (0)1 57 27 89 11 > ************************************************* > On ne fait jamais assez provision de ceux qu'on aime (Anatole Le Braz) > _______________________________________________ > galaxy-bugs mailing list > galaxy-bugs(a)lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-bugs

1 0

Re: [galaxy-user] [galaxy-bugs] raw data reads in Galaxy
by Anton Nekrutenko 16 Mar '11

16 Mar '11

Anne: 1. This question is more appropriate for galaxy-user list, so I'm forwarding this e-mail. 2. When you map reads against a reference these initial dataset is your raw reads (or perhaps I do not fully understand your question). Thanks! anton galaxy team On Mar 16, 2011, at 10:58 AM, Anne LE MOUEL wrote: > How to see the raw data of the reads mapped on galaxy, > Thank you > Best regards > Anne Le Mouël > > -- > ***************************************************** > UMR7216 Epigénétique et Destin Cellulaire > Interface entre Développement et Environnement (Valérie Mezger) > Université Paris Diderot, 35 rue Hélène Brion, case 7042 > 75205 Paris Cedex 13 > Tel: +33 (0)1 57 27 89 25 > Fax: +33 (0)1 57 27 89 11 > ************************************************* > On ne fait jamais assez provision de ceux qu'on aime (Anatole Le Braz) > _______________________________________________ > galaxy-bugs mailing list > galaxy-bugs(a)lists.bx.psu.edu > http://lists.bx.psu.edu/listinfo/galaxy-bugs

1 0