- galaxy-user - lists.galaxyproject.org

<configfile> syntax
by Jesse Erdmann 19 Mar '10

19 Mar '10

I'm getting started with deploying tools to a galaxy site and I'm having a little trouble understanding the appropriate syntax for the <configfile> contents. I see there are a few examples in tools currently available within the galaxy distribution, but I'm wondering if there is a complete set of documentation somewhere? I'm a little confused as to when to use '#' tags in front of commands and how to specify what gets written to the config file rather than the code that is executed to build the config script. -- Jesse Erdmann Bioinformatics Analyst Masonic Cancer Center University of Minnesota jerdmann(a)umn.edu 612-626-3123 jesse(a)jesseerdmann.com Twitter: http://twitter.com/jesseerdmann

2 1

Small RNA gene, tRNA genes
by Kluger, Yuval 18 Mar '10

18 Mar '10

Hi, I would appreciate any suggestion how one can use Galaxy to obtain coordinates of human and mouse of all known tRNAs. Similarly how one can do that for other types such as miRNAs and other small RNAs . Thanks, Yuval ------------------------------------------------------------ This email message, including any attachments, is for the sole use of the intended recipient(s) and may contain information that is proprietary, confidential, and exempt from disclosure under applicable law. Any unauthorized review, use, disclosure, or distribution is prohibited. If you have received this email in error please notify the sender by return email and delete the original message. Please note, the recipient should check this email and any attachments for the presence of viruses. The organization accepts no liability for any damage caused by any virus transmitted by this email. =================================

5 4

Fastq manipulation tools in Galaxy
by Jose Huguet 18 Mar '10

18 Mar '10

I looked for the Fastq manipulation tools in Galaxy (public web site) but I could not find them. IS there any specific link in Galaxy where these new tools are located? Thanks JoseCarlos

2 1

Re: [galaxy-user] A question regarding sequence retrieval
by Guruprasad Ananda 18 Mar '10

18 Mar '10

Hi, Using the interval file which you used to fetch fasta sequences, you'll be able to fetch human-chimp alignments. Please use "Extract pairwise MAF blocks" tool under "Fetch alignments" and select "hg18,panTro2" as MAF source. If the MAF source field is empty, please make sure that the database build of your input interval file is set to 'hg18'. Please feel free to email us if you have any further questions. Thanks, Guru. On Mar 18, 2010, at 9:02 AM, pande wrote: > > > Thank you so much for your quick response..........and may I take the liberty of asking you another question ? > If I have sequences from the human genome and I want to see their alignment with the Chimp genome are there such pre-computed sets available at the UCSC genome browser or Galaxy ? > People have told me but till now I have not been successful. > > Please help me. > > warm regards > > Amit. > > > > > > Guruprasad Ananda wrote: >> Hello Amit, >> >> The genomic sequences hosted on Galaxy are from UCSC and according to their convention repeats from RepeatMasker and Tandem Repeats Finder (with a period of 12 or less) are shown in lower case and non-repeating sequence is shown in upper case. >> >> Hope this answers your question. >> Thanks for using Galaxy, >> Guru. >> >> >> On Mar 11, 2010, at 5:02 AM, pande wrote: >> >> >>> Dear Galaxy, >>> I have the results for the sequence retrieval for Insulator regions in the human genome and I am having difficulty in comprehending the upper and lower case associated with my sequences.I know it for sure that they are regions which do not in any way overlap with exons or introns and are that between any 2 genes. >>> I am attaching a small part of the sequence file for you to see and help me. >>> >>> >>> warm regards, >>> Amit. >>> >>>> hg19_chr14_100364027_100364047_+ >>>> >>> AAGGCTTCTAATTTGGGTCT >>> >>>> hg19_chr14_100364319_100364339_+ >>>> >>> TATTTTCCCAGCAGAGGATG >>> >>>> hg19_chr2_21174437_21174468_+ >>>> >>> NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >>> >>>> hg19_chr19_50965398_50965458_+ >>>> >>> TGTCTCAAGGGATTTAGTCACTTAAAAAAtttttttaattgatttttgat >>> tttttttttt >>> >>>> hg19_chr19_50965141_50965201_+ >>>> >>> ATCCTCTCTCCCCAGGAATCACCTTCAAACCGTTCGAGTATAAGGAGCAT >>> GACTTCCGGA >>> >>>> hg19_chr16_23597358_23597397_+ >>>> >>> acccctcagactcccgagtagctgggattataggcgtgc >>> >>>> hg19_chr11_5269210_5269281_+ >>>> >>> TCTTCCAAAACATCTGTTTCTGAGAAGTCCTGTCCTATAGAGGTCTTTCT >>> TCCCACCGGATTTCTCCTACA >>> >>>> hg19_chr11_5182745_5182816_+ >>>> >>> ggaggaccgtaagggatataaaggttttactgaatactaagagcctgaaa >>> aactgcttggctgatttgact >>> >>>> hg19_chr11_1947003_1947086_+ >>>> >>> CCAGGCCCCCTCACAGCCTTCTGCTATGAGACCCTTGAGGTGCACACAGG >>> CTGGGAGCAGATGGGAGGGCTGGGGTCCCATGC >>> >>>> hg19_chr11_1944457_1944540_+ >>>> >>> GGGCCTCGTCTTTTCCCCGAAGTGTGGCCACATGGTCCTGAGGGGCCTGC >>> AGGTCAGGCTCTGGGTCCTGTCTCTCTGCTTCT >>> >>>> hg19_chr17_38531956_38532012_+ >>>> >>> cctgggctcccacttcggtggcacttgaggagcccttcagcccaccgctg >>> cactgt >>> >>>> hg19_chr17_38531327_38531376_+ >>>> >>> gatggtaacttcccggtggttaggttgttgccatggaaaggggcggtaa >>> >>>> hg19_chr3_10181494_10181542_+ >>>> >>> taattctttcattttttatagagacaggacctcgctatgttgcccagg >>> >>>> hg19_chrX_23982287_23982341_+ >>>> >>> ATTAGTGCATTCTTTTTCAGAAATTTTTTCTGTGCAGATATACAATCTGT >>> ATAC >>> >>>> hg19_chrX_23982417_23982470_+ >>>> >>> TTAATAAACATGTCACTGCtgttgtgggtggggttgcccaggaaacagac >>> tct >>> >>>> hg19_chr11_2112020_2112170_+ >>>> >>> CACCTTGCAGGGTCCCACCAAGACCACTGCAGCCTGGAATTTCCTGCTGA >>> CACTGGACGTAGGAGGCCTGGAGGGCCTGCAGGGGTCAGCCAGCGCCTCC >>> AGGACCCTCACTCAAACCTTGTCCCACGCCTTACCACCTTGCACCTGGTC >>> _______________________________________________ >>> galaxy-user mailing list >>> galaxy-user(a)lists.bx.psu.edu >>> http://lists.bx.psu.edu/listinfo/galaxy-user >>> >> >> Guruprasad Ananda >> Graduate Student >> Bioinformatics and Genomics >> The Pennsylvania State University >> >> >> >> >> > Guruprasad Ananda Graduate Student Bioinformatics and Genomics The Pennsylvania State University

1 0

transfer_datasets.ini ?
by Erick Antezana 17 Mar '10

17 Mar '10

Hi, could you please tell me the purpose of the following file: transfer_datasets.ini thanks, Erick

2 1

Galaxy Outage: March 18, 3:30AM-7:30AM EDT
by Nate Coraor 17 Mar '10

17 Mar '10

Hello, Due to a scheduled power outage in our data center, Galaxy (Test and Main) will be unavailable on Thursday, March 18, 2010 from 3:30AM to 7:30AM EDT (UTC -0400). Jobs still running at 3:30AM Thursday will not be able to be completed (but can be restarted once Galaxy is up). --nate Galaxy Team

1 0

A question regarding sequence retrieval
by pande 11 Mar '10

11 Mar '10

Dear Galaxy, I have the results for the sequence retrieval for Insulator regions in the human genome and I am having difficulty in comprehending the upper and lower case associated with my sequences.I know it for sure that they are regions which do not in any way overlap with exons or introns and are that between any 2 genes. I am attaching a small part of the sequence file for you to see and help me. warm regards, Amit. >hg19_chr14_100364027_100364047_+ AAGGCTTCTAATTTGGGTCT >hg19_chr14_100364319_100364339_+ TATTTTCCCAGCAGAGGATG >hg19_chr2_21174437_21174468_+ NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >hg19_chr19_50965398_50965458_+ TGTCTCAAGGGATTTAGTCACTTAAAAAAtttttttaattgatttttgat tttttttttt >hg19_chr19_50965141_50965201_+ ATCCTCTCTCCCCAGGAATCACCTTCAAACCGTTCGAGTATAAGGAGCAT GACTTCCGGA >hg19_chr16_23597358_23597397_+ acccctcagactcccgagtagctgggattataggcgtgc >hg19_chr11_5269210_5269281_+ TCTTCCAAAACATCTGTTTCTGAGAAGTCCTGTCCTATAGAGGTCTTTCT TCCCACCGGATTTCTCCTACA >hg19_chr11_5182745_5182816_+ ggaggaccgtaagggatataaaggttttactgaatactaagagcctgaaa aactgcttggctgatttgact >hg19_chr11_1947003_1947086_+ CCAGGCCCCCTCACAGCCTTCTGCTATGAGACCCTTGAGGTGCACACAGG CTGGGAGCAGATGGGAGGGCTGGGGTCCCATGC >hg19_chr11_1944457_1944540_+ GGGCCTCGTCTTTTCCCCGAAGTGTGGCCACATGGTCCTGAGGGGCCTGC AGGTCAGGCTCTGGGTCCTGTCTCTCTGCTTCT >hg19_chr17_38531956_38532012_+ cctgggctcccacttcggtggcacttgaggagcccttcagcccaccgctg cactgt >hg19_chr17_38531327_38531376_+ gatggtaacttcccggtggttaggttgttgccatggaaaggggcggtaa >hg19_chr3_10181494_10181542_+ taattctttcattttttatagagacaggacctcgctatgttgcccagg >hg19_chrX_23982287_23982341_+ ATTAGTGCATTCTTTTTCAGAAATTTTTTCTGTGCAGATATACAATCTGT ATAC >hg19_chrX_23982417_23982470_+ TTAATAAACATGTCACTGCtgttgtgggtggggttgcccaggaaacagac tct >hg19_chr11_2112020_2112170_+ CACCTTGCAGGGTCCCACCAAGACCACTGCAGCCTGGAATTTCCTGCTGA CACTGGACGTAGGAGGCCTGGAGGGCCTGCAGGGGTCAGCCAGCGCCTCC AGGACCCTCACTCAAACCTTGTCCCACGCCTTACCACCTTGCACCTGGTC

2 1

Error from Histogram in local galaxy installation : 'x' must be numeric
by Jim Johnson 10 Mar '10

10 Mar '10

Using an upload of test-data/2.tabular as test dataset My local installations (Mac and Linux) of galaxy reports this error for Histogram: An error occurred running this job: Error in hist.default(list(68, 71, 62, 75, 58, 60, 67, 68, 71, 69), xlab = "V1", : 'x' must be numeric This works without error at: http://main.g2.bx.psu.edu/ I looked at the code in tools/plotting/histogram.py and it doesn't make sense to me. Why does it create matrix = [] which it seems to use as a 2-Dim array? R hist() seems to only take an R Vector. Are there any version changes to R, Rpy, or NumPy that might have changed how this operates? I executed some of that code interactively and got the same error message: $ python Python 2.6.4 (r264:75706, Mar 9 2010, 10:00:44) [GCC 4.2.1 (Apple Inc. build 5646) (dot 1)] on darwin Type "help", "copyright", "credits" or "license" for more information. >>> import sys >>> from rpy import * >>> matrix = [] >>> vals = ["23","14","32","25","12","9","35","18","24"] >>> for i in vals: ... row = [];row.append(float(i));matrix.append(row) ... >>> matrix [[23.0], [14.0], [32.0], [25.0], [12.0], [9.0], [35.0], [18.0], [24.0]] >>> a = array(matrix) >>> r.pdf("histtest.pdf", 8, 8) >>> title = "Histogram Test";xlab="Count";breaks="Sturges" >>> r.hist( a, probability=True, main=title, xlab=xlab, breaks=breaks ) Traceback (most recent call last): File "<stdin>", line 1, in <module> rpy.RPy_RException: Error in hist.default(list(23, 14, 32, 25, 12, 9, 35, 18, 24), xlab = "Count", : 'x' must be numeric >>> a array([[ 23.], [ 14.], [ 32.], [ 25.], [ 12.], [ 9.], [ 35.], [ 18.], [ 24.]]) >>> # Now JJ tries creating just a vector instead of using matrix ... >>> v = [] >>> for i in vals: ... v.append(float(i)) ... >>> v [23.0, 14.0, 32.0, 25.0, 12.0, 9.0, 35.0, 18.0, 24.0] >>> r.hist(v, probability=True, main=title, xlab=xlab, breaks=breaks ) {'density': [0.022222217777778667, 0.044444444444444446, 0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446], 'equidist': True, 'breaks': [5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0], 'intensities': [0.022222217777778667, 0.044444444444444446, 0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446], 'counts': [1, 2, 1, 3, 0, 2], 'xname': 'c(23, 14, 32, 25, 12, 9, 35, 18, 24)', 'mids': [7.5, 12.5, 17.5, 22.5, 27.5, 32.5]} >>> >>> a = array(v) >>> r.hist( a, probability=True, main=title, xlab=xlab, breaks=breaks ) {'density': [0.022222217777778667, 0.044444444444444446, 0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446], 'equidist': True, 'breaks': [5.0, 10.0, 15.0, 20.0, 25.0, 30.0, 35.0], 'intensities': [0.022222217777778667, 0.044444444444444446, 0.02222222222222223, 0.066666666666666666, 0.0, 0.044444444444444446], 'counts': [1, 2, 1, 3, 0, 2], 'xname': 'c(23, 14, 32, 25, 12, 9, 35, 18, 24)', 'mids': [7.5, 12.5, 17.5, 22.5, 27.5, 32.5]} >>> r.dev_off() {'null device': 1} >>>

1 0

Output files
by Stein, Olaf 10 Mar '10

10 Mar '10

Hi all, I have a tool setup (a small perl script) and it runs fine, I get the output I would usually see in shell in the history. The script also generates some output files (at least in a normal run in the shell), where within galaxy can I see those? Thanks Olaf ------------------------- Olaf Stein DBA Battelle Center for Mathematical Medicine Nationwide Children's Hospital, The Research Institute 700 Children's Drive 43205 Columbus, OH phone: 1-614-355-5685 cell: 1-614-843-0432 email: olaf.stein(a)nationwidechildrens.org "I consider that the golden rule requires that if I like a program I must share it with other people who like it." Richard M. Stallman

3 6

transfer infomation with file transfer when seqencing request
by nsfox＠uwaterloo.ca 10 Mar '10

10 Mar '10

Hi, Is there a way to transfer the sample description information to a library information template when transferring data from the sequencer in a sequencing request? Thanks, Natalie

2 1