- galaxy-user - lists.galaxyproject.org

unsubscribe
by Davide Corona 06 Apr '10

06 Apr '10

Could you please unsuscribe me? thank you best regards DAvide

5 4

unsuscribe
by Wood 06 Apr '10

06 Apr '10

Hi Could you please unsuscribe me? thank you best regards Olivier

2 1

"Edit Attributes" not working when logged in
by amit mandal 06 Apr '10

06 Apr '10

hello all, I've been using Galaxy for quite some time. Since last 2 weeks I'm unable to use the *Edit Attributes* (*pencil icon*) on the stored datasets when logged in my Galaxy account (this e-mail ID). If I use Galaxy without logging in, the *pencil icon* works fine. But as I log in and try to do the same, I get this message in the middle pane of the Galaxy site - " Server Error An error occurred. See the error logs for more information. (Turn debug on to display exception reports here) " I've attached a screenshot for reference. Recently I updated my account from an old ID to this e-mail ID. Could the error be linked to this? There are several histories stored in my account. I'm unable to use the *pencil icon* in neither of them. Kindly help, I'm confused. thank you. regards, -- Amit Mandal Graduate Student Genomics & Molecular Medicine IGIB igib.in

1 0

converting file to interval or bed in a workflow
by Michael Wilson 05 Apr '10

05 Apr '10

Dear Galaxy users/developers, I was wondering if anyone knows a way to take a tabular file (i.e. with four columns: chr start stop name) and convert it into a bed or interval file during a workflow (as opposed to doing it manually). I have a workflow which produces a four-column tabular file by extracting columns from an input file but I need it to be recognized as a bed or interval in order to then extract sequences in fasta format. There may be something obvious I am missing but I do not see any options in the Convert formats tools. Thanks in advance. Cheers, Mike

1 0

Col 4?
by Desmond Lim 02 Apr '10

02 Apr '10

Hi, I'm using galaxy to download data from UCSC. The data has 4 columns, what is the 4 column? It states name but has chromosome numbers on it. Thanks. Desmond

2 1

gz files
by Keith E. Giles 31 Mar '10

31 Mar '10

I apologize for the redundancy, I sent the previous email from the wrong account. I am trying to figure out why I can't upload the .gz compressed files from the broad institute into galaxy. any suggestions?

3 2

uploading gz files
by Keith Giles 31 Mar '10

31 Mar '10

I am unable to load the raw alignment data from the broad institute datasets available from the ucsc downloads section. the data is in the gz format. any suggestions on how to get it uploaded?

1 0

CASAVA in Galaxy
by Glen Otero 30 Mar '10

30 Mar '10

Hello- I'm about to embark on an effort to try and roll Illumina's CASAVA pipeline software--demultiplex.pl, GERALD.pl, run.pl and other scripts, into a local Galaxy install. I'd prefer not to reinvent the wheel, so I'd like to hear from anyone that's already done part or all of what I'm going to attempt. Any advice is greatly appreciated. Alternatively, if this is something that other developers are interested in, maybe it could be considered for a coding sprint during the breakout session at the developers' conference or during one of the BEER sessions? Thanks! Glen

3 4

New feature: reusing datasets / copying datasets to the current history
by Jeremy Goecks 30 Mar '10

30 Mar '10

Hi all, You might know that you can view all your datasets by visiting 'Datasets' under the User menu. There's now a new action that you can take from this view: You can copy any of your datasets to your current history, either individually or in bulk. This feature should make it easier for you to reuse datasets and move datasets between histories as you can search for datasets and then copy them. Let us know if you have questions. Thanks, J.

1 0

Re: [galaxy-user] A question regarding sequence retrieval
by Guruprasad Ananda 30 Mar '10

30 Mar '10

Hi Amit, I was not able to reproduce the issue reported by you. I downloaded the BED file from the website pointed by you, and fetched sequences successfully. I'm sharing my history with you: http://main.g2.bx.psu.edu/u/guru/h/test-for-amit Please make sure that you have the correct BED file, and correct metadata settings (chr,start,end columns and genome build). Also, in future, can you please report your questions/issues to one of our mailing lists: galaxy-user(a)bx.psu.edu, galaxy-bugs(a)bx.psu.edu? Thanks, Guru. On Mar 30, 2010, at 7:43 AM, pande wrote: > Hello GURU, > I am having problems with retrieving the FASTA sequences in the genomic interval that I took from > http://dir.nhlbi.nih.gov/Papers/lmi/epigenomes/hgtcell.aspx for the CTCF binding site. > The sequence file that I am getting is empty. > > Please help. > > warm regards, > Amit. > > > Guruprasad Ananda wrote: >> Hello Amit, >> >> The genomic sequences hosted on Galaxy are from UCSC and according to their convention repeats from RepeatMasker and Tandem Repeats Finder (with a period of 12 or less) are shown in lower case and non-repeating sequence is shown in upper case. >> >> Hope this answers your question. >> Thanks for using Galaxy, >> Guru. >> >> >> On Mar 11, 2010, at 5:02 AM, pande wrote: >> >> >>> Dear Galaxy, >>> I have the results for the sequence retrieval for Insulator regions in the human genome and I am having difficulty in comprehending the upper and lower case associated with my sequences.I know it for sure that they are regions which do not in any way overlap with exons or introns and are that between any 2 genes. >>> I am attaching a small part of the sequence file for you to see and help me. >>> >>> >>> warm regards, >>> Amit. >>> >>>> hg19_chr14_100364027_100364047_+ >>>> >>> AAGGCTTCTAATTTGGGTCT >>> >>>> hg19_chr14_100364319_100364339_+ >>>> >>> TATTTTCCCAGCAGAGGATG >>> >>>> hg19_chr2_21174437_21174468_+ >>>> >>> NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >>> >>>> hg19_chr19_50965398_50965458_+ >>>> >>> TGTCTCAAGGGATTTAGTCACTTAAAAAAtttttttaattgatttttgat >>> tttttttttt >>> >>>> hg19_chr19_50965141_50965201_+ >>>> >>> ATCCTCTCTCCCCAGGAATCACCTTCAAACCGTTCGAGTATAAGGAGCAT >>> GACTTCCGGA >>> >>>> hg19_chr16_23597358_23597397_+ >>>> >>> acccctcagactcccgagtagctgggattataggcgtgc >>> >>>> hg19_chr11_5269210_5269281_+ >>>> >>> TCTTCCAAAACATCTGTTTCTGAGAAGTCCTGTCCTATAGAGGTCTTTCT >>> TCCCACCGGATTTCTCCTACA >>> >>>> hg19_chr11_5182745_5182816_+ >>>> >>> ggaggaccgtaagggatataaaggttttactgaatactaagagcctgaaa >>> aactgcttggctgatttgact >>> >>>> hg19_chr11_1947003_1947086_+ >>>> >>> CCAGGCCCCCTCACAGCCTTCTGCTATGAGACCCTTGAGGTGCACACAGG >>> CTGGGAGCAGATGGGAGGGCTGGGGTCCCATGC >>> >>>> hg19_chr11_1944457_1944540_+ >>>> >>> GGGCCTCGTCTTTTCCCCGAAGTGTGGCCACATGGTCCTGAGGGGCCTGC >>> AGGTCAGGCTCTGGGTCCTGTCTCTCTGCTTCT >>> >>>> hg19_chr17_38531956_38532012_+ >>>> >>> cctgggctcccacttcggtggcacttgaggagcccttcagcccaccgctg >>> cactgt >>> >>>> hg19_chr17_38531327_38531376_+ >>>> >>> gatggtaacttcccggtggttaggttgttgccatggaaaggggcggtaa >>> >>>> hg19_chr3_10181494_10181542_+ >>>> >>> taattctttcattttttatagagacaggacctcgctatgttgcccagg >>> >>>> hg19_chrX_23982287_23982341_+ >>>> >>> ATTAGTGCATTCTTTTTCAGAAATTTTTTCTGTGCAGATATACAATCTGT >>> ATAC >>> >>>> hg19_chrX_23982417_23982470_+ >>>> >>> TTAATAAACATGTCACTGCtgttgtgggtggggttgcccaggaaacagac >>> tct >>> >>>> hg19_chr11_2112020_2112170_+ >>>> >>> CACCTTGCAGGGTCCCACCAAGACCACTGCAGCCTGGAATTTCCTGCTGA >>> CACTGGACGTAGGAGGCCTGGAGGGCCTGCAGGGGTCAGCCAGCGCCTCC >>> AGGACCCTCACTCAAACCTTGTCCCACGCCTTACCACCTTGCACCTGGTC >>> _______________________________________________ >>> galaxy-user mailing list >>> galaxy-user(a)lists.bx.psu.edu >>> http://lists.bx.psu.edu/listinfo/galaxy-user >>> >> >> Guruprasad Ananda >> Graduate Student >> Bioinformatics and Genomics >> The Pennsylvania State University >> >> >> >> >> > Guruprasad Ananda Graduate Student Bioinformatics and Genomics The Pennsylvania State University

1 0