- galaxy-user - lists.galaxyproject.org

Bam QC and coverage
by shamsher jagat 05 Sep '13

05 Sep '13

I am looking for a tool to perform QC of Bam file especially following functions: 1. BAsic information and stat. 2. Coverage across reference features- gene/ transcripts. Is it possible to do it in Galaxy? Thanks

2 2

For constructing workflow of workflows
by patra 05 Sep '13

05 Sep '13

Hi, This is Deblina. I am working as a PhD student in Martin Luther University Wittenberg, Halle, Germany. For a project I want to use Galaxy. I need to construct a master workflow with sub-workflows connected to each other. Is it possible to construct "workflows of workflows" in galaxy? Best Regards, Deblina.

2 1

Fwd: About empty no peek problem
by XiaoTao Jiang 03 Sep '13

03 Sep '13

---------- Forwarded message ---------- From: XiaoTao Jiang <biofuture.jiang(a)gmail.com> Date: 2013/9/2 Subject: About empty no peek problem To: galaxy-user-request(a)lists.bx.psu.edu Dear all Today I embed one of my R script into local galaxy, I have encountered a strange problem. The script can successfully in local. However, when I run it online in galaxy, the output file is empty and in history panel, it display empty and no peek. I searched the mailing list, but still can not find solutions to solve it. The command display in sever is : *key part * galaxy.jobs.runners.local DEBUG 2013-09-02 17:29:49,297 *executing:* R CMD BATCH --slave "--args /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_44.dat /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat" barchart.r galaxy.jobs.runners.local DEBUG 2013-09-02 17:29:49,493 *execution finished: * R CMD BATCH --slave "--args /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_44.dat /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat" barchart.r galaxy.jobs DEBUG 2013-09-02 17:29:49,538 Tool did not define exit code or stdio handling; checking stderr for success galaxy.tools DEBUG 2013-09-02 17:29:49,697 Error opening galaxy.json file: [Errno 2] No such file or directory: '/Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/job_working_directory/000/71/galaxy.json' galaxy.jobs DEBUG 2013-09-02 17:29:49,759 job 71 ended I check the generated output file /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat It is empty zero in size and then I run the command in local command R CMD BATCH --slave "--args /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_44.dat /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat" barchart.r The output is correct. Any suggestions will be appreciated !! Xiaotao JIANG Regards, The University of HongKong Department of Civil Engineering

3 5

About tool classify in the tool box panel
by XiaoTao Jiang 31 Aug '13

31 Aug '13

Dear all I want to know how to part the tool panel into several group just like the public Galaxy. It classify the tools into NGS Tools Box and RECENTS. I can not find tag that up <section> tag in the wiki document. Anyone can tell me how to configure to classify tools? Thank you for all your help Regards, Xiaotao JIANG The University of HongKong

2 1

Tophat Error: segment-based junction search failed with err
by Delong, Zhou 30 Aug '13

30 Aug '13

Hello, I have run several analysis with Tophat 2 on my local instance of galaxy and I get this error for all of them.. segment-based junction search failed with err = 1 or -9 Here is an example of full error report: Error in tophat: [2013-08-23 11:56:58] Beginning TopHat run (v2.0.6) ----------------------------------------------- [2013-08-23 11:56:58] Checking for Bowtie Bowtie version: 2.0.2.0 [2013-08-23 11:56:58] Checking for Samtools Samtools version: 0.1.18.0 [2013-08-23 11:56:58] Checking for Bowtie index files [2013-08-23 11:56:58] Checking for reference FASTA file [2013-08-23 11:56:58] Generating SAM header for /usr/local/data/bowtie2/hg19/hg19 format: fastq quality scale: phred33 (default) [2013-08-23 11:58:04] Preparing reads left reads: min. length=50, max. length=50, 145339247 kept reads (34946 discarded) right reads: min. length=50, max. length=50, 145340153 kept reads (34040 discarded) [2013-08-23 14:16:21] Mapping left_kept_reads to genome hg19 with Bowtie2 [2013-08-24 01:04:37] Mapping left_kept_reads_seg1 to genome hg19 with Bowtie2 (1/2) [2013-08-24 03:38:22] Mapping left_kept_reads_seg2 to genome hg19 with Bowtie2 (2/2) [2013-08-24 05:29:58] Mapping right_kept_reads to genome hg19 with Bowtie2 [2013-08-24 19:50:22] Mapping right_kept_reads_seg1 to genome hg19 with Bowtie2 (1/2) [2013-08-24 22:36:38] Mapping right_kept_reads_seg2 to genome hg19 with Bowtie2 (2/2) [2013-08-25 01:40:37] Searching for junctions via segment mapping Coverage-search algorithm is turned on, making this step very slow Please try running TopHat again with the option (--no-coverage-search) if this step takes too much time or memory. [FAILED] Error: segment-based junction search failed with err =-9 Collecting potential splice sites in islands cp: cannot stat `/home/galaxy/galaxy-dist/database/job_working_directory/000/515/tophat_out/deletions.bed': No such file or directory cp: cannot stat `/home/galaxy/galaxy-dist/database/job_working_directory/000/515/tophat_out/insertions.bed': No such file or directory I did some research on the internet and it seems to be a memory problem to me, is there any solution other than rerun these jobs on a more powerful machine? And why has Bowtie/Tophat discard different numbers of reads? What will be the impact? Does it means that if I don't have exact matches between the paired end input, it is still be possible to run the job? Thanks, Delong

2 1

watching command line to a query
by lilach noy 30 Aug '13

30 Aug '13

Hello, How can i see the command line a query executes? To be more specific i am new to the Galaxy and plan to use as a way to learn how to run queries locally. In order to understand not only the functions available but also the way i can write it on my own i'd be happy to be able to see the command line that execute my queries. How can I see this? Thank you

4 7

August 2013 Galaxy Update Newsletter is out
by Dave Clements 30 Aug '13

30 Aug '13

1 0

Subtract Whole Dataset
by lilach noy 30 Aug '13

30 Aug '13

Hello all, I am having troubles with the Subtract Whole Dataset function - i've tried subtracting one BAM file from another and got as an output a bai file. I need it to be a BAM file so i can convert it to SAM and see the data in a none binary form. Anyone have any thoughts on the issue? Thank you for trying :) Lilach

2 1

Which Input FASTQ quality scores type should I choose when run FASTQ Groomer?
by Du, Jianguang 30 Aug '13

30 Aug '13

Hi All, I downloaded some RNA-seq datasets from NCBI. The datasets were generated by Illumina Hiseq 2000. I am not sure which "Input FASTQ quality scores type" I should choose when run FASTQ Groomer. Below shows the scores of 2 reads of a dataset, I renamed them as "read 1" and "read 2". 1) Sequence and quality score displayed in Galaxy @read 1 length=51 NTGAGATTCTTGACTAGTTATTTCTGCTTTCAGGGAAGAAATCAGCTGGGC +read 1 length=51 #1=ADADEHHHHHIIGIHJGJJJHJIIJJJH@HEGBFH;FHEH>@HIJJJJ @read 2 length=51 NGAAGAGTCAGTTTTTTGTTTCCCTCATAACTTGCTAGATTCCGGATTGCT +read 2 length=51 #1=DDDEDHHFHHJJJJJIJJHIIIJJJIJJJJJJJIJIJJJJJJIJJJJI 2) Sequence and one chanel quality score shown in SRA of NCBI when I downloaded the dataset. >gnl|SRA|read 1 NTGAGATTCTTGACTAGTTATTTCTGCTTTCAGGGAAGAAATCAGCTGGGC One channel quality score 2 16 28 32 35 32 35 36 39 39 39 39 39 40 40 38 40 39 41 38 41 41 41 39 41 40 40 41 41 41 39 31 39 36 38 33 37 39 26 37 39 36 39 29 31 39 40 41 41 41 41 >gnl|SRA|read 2 NGAAGAGTCAGTTTTTTGTTTCCCTCATAACTTGCTAGATTCCGGATTGCT One channel quality score 2 16 28 35 35 35 36 35 39 39 37 39 39 41 41 41 41 41 40 41 41 39 40 40 40 41 41 41 40 41 41 41 41 41 41 41 40 41 40 41 41 41 41 41 41 40 41 41 41 41 40 Looks like the dataset is generated by illumina that is later than version 1.8 because some of the reads are at score quality of 41. Can I choose "sanger" as "Input FASTQ quality scores type" when I run FASTQ Groomer? Thanks. Jianguang Du

2 1

Barcode Splitter Problem
by Priyanka Vengurlekar 30 Aug '13

30 Aug '13

Hi all, I need some serious help i got output from the Miseq machine in fastq file format. My supevisor asked me to separate barcodes, so since monday i have been struggling to use this in command- line and executed it but either there is some mistake that it doesnt recognize any barcodes at all and does not give me out text file just puts it all in one file called unmatched.I then just to try tried the convert the fastq to fasta command and it said cannot execute the binary file....i broke my head so i tried other commands all said cannot execute binary file... Q1..so first kindly tell me why any of these binary files cant be executed from the root directory? and what extra software do i have to download more then what was within the installation instructions. So i turned to the galaxy web based usage which was all the more harder i could not figure out in the barcode splitter program what the library to split actually require at first i thought the document with barcodes so i uploaded but this thing just does not show anything in the pulldown for library to split. Its thursday and i have to still trim the fastq sequences and nothing seems to work at all with what i am working ....can some body please help me...... Sincerely, Piyu

2 1