- galaxy-user - lists.galaxyproject.org

Re: [galaxy-user] Identifying Tags - Galaxy Question
by Jennifer Jackson 19 Sep '13

19 Sep '13

Hi Dominique, Glad that helped. And yes, you can merge many file types that are text-based with the tool 'Text Manipulation -> Concatenate datasets". Sometimes you will need to convert to format tabular first, and then back to the desired format (fasta, gtf, etc.) after. Take care, Jen Galaxy team On 9/19/13 5:51 AM, D. A. Cowart wrote: > Thank you Jennifer, this helped tremendously. I completely missed the > barcode splitter too. > One other question: do you know if it is possible to merge different > fasta files on Galaxy? Say, I wanted to merge those tagged files back > to one complete fasta file. > > Best, > Dominique Cowart > > > On Thu, Sep 19, 2013 at 12:19 AM, Jennifer Jackson <jen(a)bx.psu.edu > <mailto:jen@bx.psu.edu>> wrote: > > Hello Dominique, > > Yes, this can be done. Here is the process -> > > Start by splitting up the data by using the 'NGS: QC and > manipulation -> Barcode Splitter" tool. The result files will be > available as links. These can be copied and added to the "Get Data > -> Upload File" tool in the text box, in batch, and each will > loaded as a dataset. Copying them into a simple text file, then > pasting into the Upload tool all at once is a quick way to do > this, or you can do one by one. > > Once you have the individual files as datasets, you probably will > want to rename them to better keep track of which barcode/tag they > represent. Click on the pencil icon in the upper right corner of > each dataset to do this on the Edit Attributes form. > > Next, the idea is to convert the fasta dataset to tabular, add in > a column with the "_Tag1" information, merge the original > identifier column with the new tag column, cut the columns to > rearrange - (you want just the new merged identifier and the > original fasta sequence - leaving behind the two columns with the > original identifier + tag), then covert back from tabular to fasta > format. Use the tools in 'Text Manipulation' and 'FASTA > manipulation' to do these operations. I would normally suggest > creating/using a workflow at this point, but as the tags will all > be different, and the "Add column" step is in the middle of the > processing, this is probably not worth it. > > Hopefully this helps! > > Jen > Galaxy team > > > On 9/18/13 7:36 AM, D. A. Cowart wrote: >> Hello, >> >> I need to perform an action (or series of actions) on an 454 >> dataset using Galaxy, and have not been able to figure out the >> necessary steps, even after looking through the toolbar >> expressions and using custom search. >> My file is a fasta and has the standard format: >> >> >GNJQDEZ01A940A >> CTGAGTCAGGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC >> ATGTTA >> >GNJQDEZ01BJYQZ >> CTGAGTCAGGTCAACAATCATAAGACATCGGCTCTCTATATTTAATATTGGT >> >> Each of the 100,000 sequences within this file contains a >> specific tag, which is the first 8 nucleotides. >> There are 19 tags total. I would like to identify these tags and >> add an identifier of the tag to the sequence name. >> Therefore, if I am looking for the first tag (CTGAGTCA), the >> output would look like: >> >> >GNJQDEZ01A940A_*Tag1* >> *CTGAGTCA*GGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC >> ATGTTA >> >> Is it possible to achieve this using Galaxy? If possible, could >> you kindly suggest tools to use. >> >> Thank you in advance, >> Dominique Cowart >> >> >> ___________________________________________________________ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> atusegalaxy.org <http://usegalaxy.org>. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ >> >> To search Galaxy mailing lists use the unified search at: >> >> http://galaxyproject.org/search/mailinglists/ > > -- > Jennifer Hillman-Jackson > http://galaxyproject.org > > -- Jennifer Hillman-Jackson http://galaxyproject.org

1 0

miRNA analysis
by Hoang, Thanh 18 Sep '13

18 Sep '13

Hi all, I would like to analyze my miRNA sequencing analysis from mouse tissue. I have not any idea which tools or pipeline work best. Do you have any suggestion? Regards Thanh

2 2

Re: [galaxy-user] Metagenomic filtering
by Scott W. Tighe 18 Sep '13

18 Sep '13

Dear Galaxy When running HiSeq shot metagenomics sample from the environment against megablast and taxonomic representation, How do I filter/remove all the 16s and other conserved sequences. The problem if blasting a single organism that has a fraction of conserved sequence, the results will align with E.coli 10,000 times more then the possible target organism. This data would be wrong and misleading. For example a 100mg sample that was negative for e coli using MUG test, give thousands of hits with galaxy. 1) Is there a "filter conserved sequences" setting? 2) Is there a "remove model organisms" setting? Scott Tighe -- Core Laboratory Research Staff Advanced Genome Technologies Core Deep Sequencing (MPS) Facility Vermont Cancer Center 149 Beaumont Ave University of Vermont HSRF 303 Burlington Vermont USA 05045 802-656-AGTC 802-999-6666 (cell) Quoting Jennifer Jackson <jen(a)bx.psu.edu>: > Hello Elwood, > > Are you still having connection issues today? Or is this resolved? > > Best, > > Jen > Galaxy team > > On 9/13/13 11:36 AM, Elwood Linney wrote: >> A message sent earlier this week by me indicated that I could not >> connect to Galaxy via Fetch to download data. >> >> A reply indicated a glitch was fixed. >> >> I then could connect with Fetch and I tried to transfer 4 x 16gb >> files and the connection disconnected about 4 times. >> >> Now, once again, I cannot connect with Galaxy online to transfer data. >> >> Is this a problem that can be solved-either at my end or at Galaxy? >> >> Elwood Linney >> >> >> ___________________________________________________________ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ >> >> To search Galaxy mailing lists use the unified search at: >> >> http://galaxyproject.org/search/mailinglists/ > > -- > Jennifer Hillman-Jackson > http://galaxyproject.org

2 1

Identifying Tags - Galaxy Question
by D. A. Cowart 18 Sep '13

18 Sep '13

Hello, I need to perform an action (or series of actions) on an 454 dataset using Galaxy, and have not been able to figure out the necessary steps, even after looking through the toolbar expressions and using custom search. My file is a fasta and has the standard format: >GNJQDEZ01A940A CTGAGTCAGGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC ATGTTA >GNJQDEZ01BJYQZ CTGAGTCAGGTCAACAATCATAAGACATCGGCTCTCTATATTTAATATTGGT Each of the 100,000 sequences within this file contains a specific tag, which is the first 8 nucleotides. There are 19 tags total. I would like to identify these tags and add an identifier of the tag to the sequence name. Therefore, if I am looking for the first tag (CTGAGTCA), the output would look like: >GNJQDEZ01A940A_*Tag1* *CTGAGTCA*GGTCAACAATCATAAGATATTGGCACCATGTACCTGTGGTTCTCGTTTCC ATGTTA Is it possible to achieve this using Galaxy? If possible, could you kindly suggest tools to use. Thank you in advance, Dominique Cowart

2 1

estimating galaxy on the cloud needs for RNAseq
by Elwood Linney 17 Sep '13

17 Sep '13

Questions: I have been running sets of data for cufflinks/cuffdiff analysis on Galaxy online--I am considering using the cloud but from what I can read, because of different person's galaxy needs, I can't get an clear idea of what I would need and how long it would take to process (and the cost) if I am running weekly 4 x 16gb fastq files to 6-8 x 16gb files--one set per week Is anyone out there using the cloud exclusively for this type of analysis? And can you give me an idea of what type of cloud setup I could use? I have no idea of how much time it would take to process these on the cloud so its hard to estimate setup costs and specific requirements. Elwood Linney

2 1

Slice bam
by lilach noy 17 Sep '13

17 Sep '13

hello all, Does anyone know if in order to use Slice bam I need to sort the bam file first or does galaxy automatically sort any bam file uploaded? Many thanks, Lilach Noy

2 1

portal to galaxy restricted
by Elwood Linney 17 Sep '13

17 Sep '13

A message sent earlier this week by me indicated that I could not connect to Galaxy via Fetch to download data. A reply indicated a glitch was fixed. I then could connect with Fetch and I tried to transfer 4 x 16gb files and the connection disconnected about 4 times. Now, once again, I cannot connect with Galaxy online to transfer data. Is this a problem that can be solved-either at my end or at Galaxy? Elwood Linney

2 1

How to calculate GC content of transcripts only including exons from a GTF file
by 师云 17 Sep '13

17 Sep '13

Hi everyone, I want to calculate GC content of transcripts in the gtf file like this: chr1 Cufflinks transcript 3 22 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; chr1 Cufflinks exon 3 10 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "1"; chr1 Cufflinks exon 13 18 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "2"; chr1 Cufflinks exon 20 22 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "3"; and the genome sequence that transcript comes from is: >chr1 GTAGCGTCTCCGACGCGGATATGACCGCACGCTGATGCTCCCAGGGATGAGAGGCGTGCG I have to calculate GC content of the transcript after getting the sequence of the transcript. So how can I get the sequence of the transcript. In this case, it would be AGCGTCTC + ACGCGG + TAT, meaning the transcript sequence would be AGCGTCTCACGCGGTAT. Is it possible in the Galaxy?

2 2

About "Slice BAM" tool
by Yan He 17 Sep '13

17 Sep '13

Hi Jen and other galaxy-users, I was using "Slice BAM" tool on Galaxy to get the alignment overlap with the targeted intervals. After I got the output BAM file, I used "flagstat" to get the detailed information of the output BAM file. What I got from "flagstat" is as following. "13704486 + 0 in total (QC-passed reads + QC-failed reads) 0 + 0 duplicates 2989995 + 0 mapped (21.82%:-nan%) 13704486 + 0 paired in sequencing" What's the QC-passed reads? What's the mapped reads? Should I only get the mapped reads to the targeted intervals? I am very confused. Any help is highly appreciated! Thanks a lot! Best wishes, Yan

2 1

Re: [galaxy-user] Questions about MEME & Sequence logo generator
by Jennifer Jackson 17 Sep '13

17 Sep '13

Hello, Yes, MEME is not on the Main server, but can be used in local, cloud, or slipstream Galaxy installs. For throughput - there are a few MEME-related repositories in the Tool Shed to choose from. How many sequences each can process will likely vary and are related to the hardware the Galaxy instance is run on. Contacting the tool authors is one path or you can try testing using your actual data. Data composition could be an important factor (not just the number of sequences). For the Sequence Logo Generator, I do not know of a hard limit by the tool itself, but as the recommended/supported input is ClustalW output, that tool will most likely be setting the potential upper limit when using the public Main Galaxy instance. Testing will be the best way to learn the limits for your particular data (whether nucleotide or protein), but the success range will be capped in the thousands, not millions (and possibly lower, as length increases). If there is a memory problem or the run time exceeds the limits on the public server, the job will end with an error. Moving to a scaled up server, such as a cloud Galaxy, will give you more control over these types of variables. Some benchmarks are in the Clustal W publication: http://bioinformatics.oxfordjournals.org/content/23/21/2947.long If others would like to post benchmarks from their own experience, that would be welcome! Jen Galaxy team On 9/11/13 2:51 PM, Boaz Shaanan wrote: > Hi, > > Has the MEME module been taken out of the main galaxy server? Assuming > it'll be back, what's roughly a recommended number of sequences to > feed into MEME? It has a limit on the sequences that it can digest but > I don't know what it is. Likewise, what's this limit for the Sequence > Logo Generator? > > Thanks, > > Boaz > > /Boaz Shaanan, Ph.D. > Dept. of Life Sciences > Ben-Gurion University of the Negev > Beer-Sheva 84105 > Israel > > E-mail: bshaanan(a)bgu.ac.il > Phone: 972-8-647-2220 Skype: boaz.shaanan > Fax: 972-8-647-2992 or 972-8-646-1710 / > // > // > / > > / > > > ___________________________________________________________ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org

1 0