- galaxy-user - lists.galaxyproject.org

Loading Neurospora crassa genome database onto Galaxy.
by Mr. Lai U Ming, Julian 06 Aug '13

06 Aug '13

Hi, I'm working on the filamentous fungi, Neurospora crassa and would like to use Galaxy to do some RNASeq analysis. Could you please load the Neurospora crassa genome into the reference data base on Galaxy. The sequences can be found at EnsemblFungi and at the Broad Intitute site. Could you please let me know which of the data set is used so that I can get the .gtf file. Thanks. Best regards, Julian Lai Junior Research Fellow Jedd Group Temasek Life Sciences Laboratory 1 Research Link National University of Singapore Singapore 117604 TLL is organizing an international conference on Next Generation Genomic View on Plants, Animals and Microbes on March 5th to 7th, 2014. For more information, please visit http://conference.tll.org.sg. Information in this email is confidential and may also be privileged. It is intended solely for the person to whom it is addressed. If you are not the intended recipient, please notify the sender, and please delete the message and any other record of it from your system immediately.

2 1

Inquiry on FastQC report
by Ng Kiaw Kiaw 06 Aug '13

06 Aug '13

Dear Galaxy Officer, Good day. I am a new user of Galaxy main server. The tools provided are very user-friendly. Thanks for the establishment of these. I just new to the RNA-seq analysis and now in the learning process of Bioinformatics. I would like to inquire on the FastaQC report generated on my data. For your information: Samples: Plant (dicotyledon) Type of data: RNA-seq (Illumina HiSeq 2000 with CASAVA v 1.8.2) Paired ends Adapter sequence: RPI 15 ( 5’ CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA) Main purpose of my analysis: Identification of novel transcript and gene expression studies I run FastQC on my raw RNA-seq data both forward and reverse. I attach the FastQC report in this email. My questions are: 1) The basic statistics shows that my data encoding is Sanger/illumina 1.9. When I grooming my data for downstream analysis in Galaxy, is that correct I choose "Sanger" for the input FASTQ quality score type? 2) Based on the per base sequence quality, the quality scores are above 20.0 for both forward and reverse data. Do I still need to trim off my data? 3) The result for "Per base sequence content", "Per base GC content", "sequence duplication level" are fail. What are these three results indicate? What are the solution for these problems? 4) What the overrepresented sequence indicate? Do I need to trim off the overrepresented sequence? 5) Based on the K-mer content, how could I analyse and justify whether this is good data or not? 6) In the reverse data FastQC report, "per sequence GC content" seem not good. What do this indicate? 7) How could I identify the adapter sequence in my RNA-seq data and how could could I remove? 8) After grooming data, running FastQC on data, adapter removal, is there any other pre-processing steps need to be done before running bowtie and top hat? Many Thanks in advance for your kind assistance and supports. Best regards Ng Kiaw Kiaw PhD student RIKEN Yokohama Campus Japan.

2 1

rattus norvegicus reference genome
by Matthew Girgenti 06 Aug '13

06 Aug '13

Hi I'm currently using the Galaxy pipeline to analyze my illumina chip-seq data. When I try to use "NGA: Mapping>Map with Bowtie for Illumina" to map my reads there is no rat reference genome. I says I should contact galaxy. Should I simply upload the genome to proceed with analysis? Thanks Matt

2 1

Problem with ftp connexion to Galaxy
by Fabrice BESNARD 06 Aug '13

06 Aug '13

Hello, I registered some time ago to Galaxy. >From the very beginning, my ftp connexion is not working. I am using Filezilla, on a windows operating system. More precisely, the connexion can be established, but the process fail when it is asking for the password. Statut : Résolution de l'adresse de main.g2.bx.psu.edu Statut : Connexion à 128.118.250.4:21... Statut : Connexion établie, attente du message d'accueil... Réponse : 220 ProFTPD 1.3.4b Server (Galaxy Main Server FTP) [::ffff:128.118.250.4] Commande : USER fbesnard(a)biologie.ens.fr Réponse : 331 Password required for fbesnard(a)biologie.ens.fr Commande : PASS *************** Réponse : 530 Login incorrect. Erreur : Erreur critique Erreur : Impossible d'établir une connexion au serveur I sent an email two month ago to report this problem. I was answered that this was an issue happening with the new accounts created. Obviously, this issue has not been fixed yet, has it? If yes, could you indicate me to make my ftp connexion works now ? Thank you for your help !! -- Fabrice Besnard Institute of Biology of the Ecole Normale Supérieure (IBENS) 46 rue d'Ulm, 75230 Paris cedex 05, France 8th floor. Office: Room 802. Lab: Room 817. mail: fbesnard(a)biologie.ens.fr Tel: +33-1-44-32-39-44

2 2

Problem with downloading
by GANDRILLON OLIVIER 06 Aug '13

06 Aug '13

Hi I am trying to download the results of my analysis (.sam files) from Galaxy main. The download gets interrupted about halfway, with no error message, as if the full file had been downloaded (but has not). Thank's for your help Best Olivier Gandrillon

2 1

SNPeff
by Andréanne Morin 06 Aug '13

06 Aug '13

Hello, I would like to use SNPeff for annotation through GATK, However when I upload my file it seems like I cannot use it for this task. My file is .txt and is in this format : Chr location ref allele alt allele 1 1234567 A T/C What am I doing wrong? Thanks, Andréanne

2 1

Filter fastq by percentage of ambiguous (N) bases
by Anto Praveen Rajkumar Rajamani 06 Aug '13

06 Aug '13

Hello, I like to filter my fastq files (50 bp single end Illumina RNA seq reads) by a maximum threshold (10%) of ambiguous (N) bases. I can see that the "CLIP" tool removes all reads with one or more N bases. Is there a way to remove only the reads with five or more N bases using Galaxy? Thank you. Best wishes, Anto

2 1

Re: [galaxy-user] Galaxy server down?
by Elizabeth Clare 06 Aug '13

06 Aug '13

Hi, I think Galaxy was down earlier this week - I saw several several messages when trying to access the public server, but I'm still getting no function on the public site. Are there still problems? I can load the page now, make new workflows and set tasks but no tasks have been completed in a few days. For example, I set a file to upload yesterday and it still has the blue working indication. Tasks from two days ago are grey and "waiting to run". Any ideas what has gone wrong? Beth On Fri, Aug 2, 2013 at 12:18 PM, Elizabeth Clare < elclare.evol.biology(a)gmail.com> wrote: > Hi Jen, > > I have had little response from the galaxy public server in the last two > days (I'm in England) (https://main.g2.bx.psu.edu) At the moment I > cannot load the webpage or any page associated with it. I have had messages > "Internal Server Error" then one about a brief shut down saying we should > contact an administrator if it went on for a while. It appeared to come > back early this morning but now is unresponsive again. > > I guess I'm reporting a continual error now. Has it gone down? > > Thanks, > > Beth > > -- > > > -------------------------------- > Dr. Elizabeth L. Clare > > School of Biological and Chemical Sciences > Queen Mary University of London > Mile End Road, London E1 4NS > Room 1.02, G. E. Fogg Building > e.clare(a)qmul.ac.uk > +44 (0)207 882 5687 > > http://webspace.qmul.ac.uk/eclare/ > > "If you say yes more often than you say no, you will do interesting things > in your life" > -- -------------------------------- Dr. Elizabeth L. Clare School of Biological and Chemical Sciences Queen Mary University of London Mile End Road, London E1 4NS Room 1.02, G. E. Fogg Building e.clare(a)qmul.ac.uk +44 (0)207 882 5687 http://webspace.qmul.ac.uk/eclare/ "If you say yes more often than you say no, you will do interesting things in your life"

4 3

Galaxy Log-In and DATA
by Mersee Madison-Villar 06 Aug '13

06 Aug '13

Hi... I haven't used Galaxy for a while, and forgot my password. The problem with resetting it is that the email I used is no longer active: I graduated. I need to access the files I uploaded, as its appearing that they did not collapse in the 'collapse' function properly: I have the same region of a reference genome mapping to multiple sequences with 100% ID. Can I please get access to the account? My previous email was: mersee(a)uta.edu Thank you! Mersee -- M.J. Madison-Villar, PhD Postdoctoral Fellow, Colorado State University

1 0

question
by Larry Simpson 06 Aug '13

06 Aug '13

Hi Is it possible to trim a variable number of a specific nucleotide from the 3' ends of fastq RNA reads? The "Manipulate Fastq" utility in Galaxy may have this ability but I do not know how to create a custom inquiry. Thanks in advance for any assistance. Larry

3 2