galaxy-user August 2012

galaxy-user@lists.galaxyproject.org

62 participants
98 discussions

URL file upload... and file upload renamed
by Neil.Burdett＠csiro.au 22 Aug '12

22 Aug '12

1. How do I transfer files using the URL? As a test I wanted to transfer a file to my local installation of Galaxy so I put in the location of the file on my Linux box. file:///home/bmladmin/demo_data-old/file.nii.gz<file:///\\home\bmladmin\demo_data-old\file.nii.gz> into the "Get Data" URL box. But it seems to think that this is code that I've pasted rather than a link to the file. Will it only work if it is proceeded by http? 2. Also, when uploading a file using "Get Data" it seems the file is renamed to dataset_'id'.dat in ~/database/files/000/. Is it possible for the file to keep its name rather than being renamed? Neil

2 2

FTP upload problem
by Fatih Ozsolak 22 Aug '12

22 Aug '12

Hi, I am trying to upload 12 fastq files to Galaxy via FTP. The FTP is randomly loosing connection, caussing interruption of the upload. Can you let me know what is wrong? Thanks, fatih

3 3

LimitInternalRecursion
by Adhemar 21 Aug '12

21 Aug '12

Hi, There's this error message in my apache log: [error] Request exceeded the limit of 10 subrequest nesting levels due to probable confguration error. Use 'LimitInternalRecursion' to increase the limit if necessary. Use 'LogLevel debug' to get a backtrace., referer: ... When I turn the apache debug log on it also shows: [debug] core.c(3072): r->uri = /galaxy/proxy: http://localhost:8080/proxy:http://localhost:8080/proxy:http://localhost:80…, referer: ... It seems like mod_rewrite is somehow misconfigured, but I couldb't figure out what it is. Here is my httpd.con mod_rewrite conf: RewriteEngine on RewriteRule ^/galaxy$ /galaxy/ [R] RewriteRule ^/galaxy/static/style/(.*) /opt/bioinformatics/share/galaxy-central/static/june_2007_style/blue/$1 [L] RewriteRule ^/galaxy/static/scripts/(.*) /opt/bioinformatics/share/galaxy-central/static/scripts/packed/$1 [L] RewriteRule ^/galaxy/static/(.*) /opt/bioinformatics/share/galaxy-central/static/$1 [L] RewriteRule ^/galaxy/favicon.ico /opt/bioinformatics/share/galaxy-central/static/favicon.ico [L] RewriteRule ^/galaxy/robots.txt /opt/bioinformatics/share/galaxy-central/static/robots.txt [L] RewriteRule ^/galaxy(.*) http://localhost:8080$1 [P] Could you please help me to debug this? Thank you, Adhemar

1 0

run Bowtie to estimate Mean Inner Distance between Mate Pairs
by Du, Jianguang 21 Aug '12

21 Aug '12

Dear All, In order to figure out the Mean Inner Distance between Mate Pairs of my paired-end RNA-seq datasets, I ran Bowtie (Map with Bowtie for Illumina) with both forward and reverse datasets and mouse mm9 as reference genome. Below I list the Bowtie output for only one pair of reads (I put the fields on the left side): For the forward read QNAME: SRR322837.8.1 FLAG: 99 RNAME: chr1 POS: 163761156 MAPQ: 255 CIAGR: 36M MRNM: = MPOS: 163761301 ISIZE: 181 SEQ: NTGGATACTATTTTGCCATAAAAAAATGAATAAAAT QUAL: %(,,')(())@@@2235885<<22222@@@###### OPT: XA:i:1 MD:Z:0A35 NM:i:1 For the reverse read QNAME: SRR322837.8.2 FLAG: 147 RNAME: chr1 POS: 163761301 MAPQ: 255 CIAGR: 36M MRNM: = MPOS: 163761156 ISIZE: -181 SEQ: TATTATGTCAATCTATGAAGAAGGACGGCGAGGTGA QUAL: GDBE@B>EEGDB=BD-=GG>GGGEDDG<GBGD8GB? OPT: MD:Z:29A6 NM:i:1 Is the ISIZE the insert size? The difference between POS and MPOS is 145bp, which is 36bp shorter than ISIZE (181). My question is: if ISIZE does mean insert size, how should I convert INSIZE into Mean Inner Distance between Mate Pairs? Thanks, Jianguang Du

5 5

Files uploaded via FTP - 530 Sorry, the maximum number of clients (3) for this user are already connected.
by Julie Rodor 21 Aug '12

21 Aug '12

Hi, I am trying to upload new files to galaxy via FTP using Filezilla. I have this error message: 530 Sorry, the maximum number of clients (3) for this user are already connected. What can I do? Julie -- The University of Edinburgh is a charitable body, registered in Scotland, with registration number SC005336.

2 1

cuffdiff sample values assigned
by Jennifer Jackson 21 Aug '12

21 Aug '12

On 8/21/12 4:33 AM, i b wrote: > Thanks Jen, > useful link. But I did not understand one thing. > I have the following FPKM in cufflinks for two samples: > s1 (untreated): 1234106 > s2 (treated): 159713 > > cuffdiff of the two samples gives me the following values: > value_1: 5.4 > value_2: 20.9 > > and it is not significant (!). My two question: > > 1. how is this not significant? > 2. what is the realtion between the high fpkm in cufflinks and the low > values in cuffdiff?I read the manual: is this part of the statistical > method adopted?e.g are these numbers (cuffdiff values) derived from > the formula adopted? > > thanks a lot, > ib > > > On Thu, Aug 16, 2012 at 11:26 PM, Jennifer Jackson <jen(a)bx.psu.edu> wrote: >> Hello, >> >> A very similar question came up a few days ago and Jeremy had some good >> advice for how to approach learning to interpret this data: >> >> http://lists.bx.psu.edu/pipermail/galaxy-user/2012-August/004985.html >> >> Best, >> >> Jen >> Galaxy team >> >> >> On 8/15/12 8:49 AM, i b wrote: >>> >>> Dear all, >>> in cuffdiff outputs e.g. transcript differential expression, I find for >>> example: >>> value_1 value_2 log2(fold_change) >>> 7.77183 0 -1.79769e+308 >>> >>> or >>> >>> value_1 value_2 log2(fold_change) >>> 0 14.5972 1.79769e+308 >>> >>> for many many rows. >>> >>> >>> if I sort in excel my data by fold change column (big to small ), all >>> the rows with -1.79769e+308 or +1.79769e+308 are on the top. >>> How can be sure that these on the top are really the most up-regulated >>> or down regulated transcripts if I don't know the real value of one of >>> the two samples (is 0 really zero?)? >>> I was told that the zero in one if the two samples is very small >>> number and Cuffdiff simply writes 0, but it is not absolutely zero, >>> otherwise it would not be possible ot have -1.79769e+308 or >>> 1.79769e+308 >>> >>> Could you please tell me then how can I extrapolate the highest fold >>> change? (up and down regualted)?or of what is done by sorting by log >>> fold chnage is correct? >>> >>> Thanks, >>> ib >>> ___________________________________________________________ >>> The Galaxy User list should be used for the discussion of >>> Galaxy analysis and other features on the public server >>> at usegalaxy.org. Please keep all replies on the list by >>> using "reply all" in your mail client. For discussion of >>> local Galaxy instances and the Galaxy source code, please >>> use the Galaxy Development list: >>> >>> http://lists.bx.psu.edu/listinfo/galaxy-dev >>> >>> To manage your subscriptions to this and other Galaxy lists, >>> please use the interface at: >>> >>> http://lists.bx.psu.edu/ >>> >> >> -- >> Jennifer Jackson >> http://galaxyproject.org -- Jennifer Jackson http://galaxyproject.org

1 0

Counting intervals in one file overlapping intervals in another file - what are the hidden settings?
by Mohammad Heydarian 21 Aug '12

21 Aug '12

Hi, I am using the "Count intervals in one file overlapping intervals in another file" tool (part of the bedTools package) to assess the number of RNA-seq reads that map back to a specific region. (I am using this on the Galaxy test server). I am finding that this tool returns many more reads than it should. In reading the bedTools manual, it seems like this tool is the "windowBed" tool and it actually has many more parameters that are not shown on the Galaxy interface. What are these (hidden) settings for these parameters that are not shown? Hopefully this can explain my incorrectly recorded reads. Thanks in advance. Cheers, Mo Heydarian

4 3

Table with gene count reads
by Jennifer Jackson 20 Aug '12

20 Aug '12

Hello Mike, SAM datasets can be used as tabular data with the Text manipulation, Filter and Sort, Join, Subtract and Group, etc. if the headers are removed and the datatype changed. Or, you can convert the format to Interval. For the simplest count directly on the SAM/BAM format itself, the tool group "NGS: SAM Tools" and "NGS: Picard (beta)" have options. There is no "score" value from a SAM file - perhaps the reply below was misinterpreted? The score was derived from a GTF file, the GTF file and an Interval file were joined, then some summaries were created with the "Group" function. The Tool Shed has a repository for the DESeq package. The instructions explain how to prepare the inputs. "NGS: Picard (beta)" also has tools for assigning read groups if you need to do that. http://getgalaxy.org http://toolshed.g2.bx.psu.edu/ Search for: DESeq Hopefully this helps! Jen Galaxy team On 8/19/12 6:21 AM, mic(a)mb.au.dk wrote: > Hi Jennifer, > > I could't find htseq or similar tool in galaxy tool sheds (sam2counts does not work), what is a bit problematic if one what's to work with Deseq (fastaq->tophat->sam->counts->Deseq). > > Could you please explain in more detail how to convert SAM to counts using available galaxy tools. It is not clear for me where to find "score" in interval produced from SAM and etc. > > Best, > Mike > > > > <quote author='Jennifer Jackson'> > Hello Luciano, > > There is no single tool do to this operation (although there has been > some discussion about including one in the Tool Shed), but the same > information can be obtained by using a combination of existing tools. > > First, start by converting both starting datasets to interval format. > > mapped reads: > - for TopHat output, "NGS: SAM Tools -> Convert SAM to interval" > features: > - for GFF file (convert to tabular if necessary), subtract "1" > from the start position's value using tool "Text Manipulation -> > Compute" > - cut columns chrom, new start, stop, strand, name, and score from > this result file using "Text Manipulation -> Cut" > - set the data type to "interval" using the 'Edit attributes form > (pencil icon) > > Next, use a tool in the group "Operate on Genomic Intervals" to compare > these intervals for overlap. The tool "Cluster" with the option "Find" > is mostly likely the one you will want to use. > > As a final step, summarize the data by feature using the tool "Join, > Subtract and Group -> Group". > > Hopefully this helps, > > Best, > > Jen > Galaxy team > > On 3/19/12 4:36 PM, Luciano Cosme wrote: >> Hi, >> I was wondering if there is any tool on Galaxy were I can obtain a >> table with how many reads have been mapped to a given sample and to a >> given gene (for example, use a Tophat output and use a GFF file to >> obtain the table). I am using HTSeq to get it (htseq-count). There is >> also GenomicRanges and easyRNASeq packages in bioconductor. >> Thank you. >> >> Luciano >> >> >> >> ___________________________________________________________ >> The Galaxy User list should be used for the discussion of >> Galaxy analysis and other features on the public server >> at usegalaxy.org. Please keep all replies on the list by >> using "reply all" in your mail client. For discussion of >> local Galaxy instances and the Galaxy source code, please >> use the Galaxy Development list: >> >> http://lists.bx.psu.edu/listinfo/galaxy-dev >> >> To manage your subscriptions to this and other Galaxy lists, >> please use the interface at: >> >> http://lists.bx.psu.edu/ > ___________________________________________________________ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > </quote> > Quoted from: > http://gmod.827538.n3.nabble.com/Table-with-gene-count-reads-tp3840714p3851… > -- Jennifer Jackson http://galaxyproject.org

1 0

Minimum length of read segments
by Du, Jianguang 20 Aug '12

20 Aug '12

Dear All, I am going to run Tophat with RNA-seq dataset to observe alternative splicing events. There is a parameter for Tophat: "Minimum length of read segment". According to "implemented Tophat options", the description for "Minimum length of read segment" is "Each read is cut up into segments, each at least this long. These segments are mapped independently. The default is 25". The length of my reads is 36bps, should I change this parameter based on the length of my reads? How long should I input? Thanks. Jianguang Du

2 1

Linking to Compressed Data
by Branden Timm 20 Aug '12

20 Aug '12

Hi All, Is it possible to link to compressed files in a Galaxy data library? We receive all of our NGS data in bz2 or gzip format for obvious reasons, just wondering if I have to decompress it on the filesystem before I link to it or not. Thanks! -- Branden Timm btimm(a)glbrc.wisc.edu

2 1

← Newer
1
2
3
4
5
6
7
8
9
10
Older →

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user August 2012