galaxy-user August 2012

galaxy-user@lists.galaxyproject.org

62 participants
98 discussions

13 Aug '12

Dear all, given 3 samples, 1 control and 2 treated replicates when I do cuffcompare to produce the gtf input for cuffdiff, do I have to run it with or without the cufflink control? E.g. Cuffcompare with only my 2 treated replicates?--------------use this gtf to run cuffdiff Cuffcompare 1 contro and 2 treated replicates?--------------use this gtf to run cuffdff Thanks a lot ib

2 1

Extreme parallelization for NGS analysis
by Josh Tietjen 11 Aug '12

11 Aug '12

I'd like to start an open discussion on the topic of parallelization for NGS data. I noticed that Galaxy recently came out with a cloud-based interface using Amazon EC3. I've been trying to learn more about how these NGS analysis algorithms (for alignment, assemly, etc.) are actually implemented in a parallel fashion, but I have had trouble finding specific documentation and resources describing how it works and how it is implemented. Any direction/resources that people can provide would be much appreciated. Also, I have seen some papers describing parallelization of various specific algorithms, especially recently (such as PASQUAL from Georgia Tech), but they all seem to be operating on relatively "small" networks of distributed computing resources. Does anyone have any idea about how far the parallelization and speeding up of these analyses can be pushed? How difficult would it to be to implement something that runs on a distributed network of say 100,000 computers, or even more... say a million? Is there a bottleneck somewhere that would prevent that from being feasible for NGS analysis? Or would that make the analyses amazingly fast compared to what's available now? I'm thinking of a system like what the SETI project has set up for their distributed computing user base and wondering what the limits are and how one could implement such a system if the user base is already in place.

1 0

cuffdiff with three groups
by i b 11 Aug '12

11 Aug '12

Dear all, I ran Cuffdiff with 3 groups: A, B, C each with 2, 5 and 1 replicates respectively. When looking at the transcripts dif.exp.testing, I have only sample A and B and redpective values. What happened to sample C? Thanks for any help. ib

1 1

Re: [galaxy-user] Install Galaxy on Mac
by Hotz, Hans-Rudolf 10 Aug '12

10 Aug '12

Hi Edward I am moving your e-mail to 'galaxy-dev' since it's about a local Galaxy instance. I don't think there are any differences between installing Galaxy on Linux and Mac OS X. Hence you can follow the step-by-step instructions on the wiki (well, there are actually only two steps anyway...): http://wiki.g2.bx.psu.edu/Admin/Get%20Galaxy WRT checking the python version: just type 'python -V' on the command line, eg on my old MacBook: bash-3.2$ python -V Python 2.5.1 bash-3.2$ Hope this helps Regards, Hans On 08/10/2012 02:37 PM, Edward Turk wrote: > Hello, > Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? > Thank you, > Edward > ___________________________________________________________ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ >

5 11

need help to split paired-end dataset
by Du, Jianguang 10 Aug '12

10 Aug '12

I am new to the NGS analysis. I need help to solve this problem. As shown in my previous emial/question shown below, I have some paired-end datasets at FASTQ format, and I have problem to split each of these datasets into two datasets (one forward and one reverse). Jennifer instructed me to assign the datatype to be fastqsanger first and then run 'Manipulate FASTQ'. I have two questions: 1) Now that the datasets were already split into forward and reverse reads when extracted in FASTQ format from the SRA, can I use them just as single end data? 2) If I do need to split each dataset into two datasets, how should I choose the settings when I run "Manipulte FASTQ"? Thanks. Jianguang ///////////////////////// On 8/10/12 7:21 AM, Du, Jianguang wrote: > I have problem to split a paired-end FASTQ dataset into two separate > datasets. In order to explain the problem clearly, I list the detail of > what I did with my dataset: > > Step 1) My aim is to compare datasets for the differential alternative > splicing. I downloaded paired-end datasets at FASTQ format from SRA of > NCBI as original data. > > Below is part of my paired-end FASTQ dataset that I downloaed from SRA > of NCBI, Does this dataset look OK? > > @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 > GTTTTCTGAGTGAGAAAAGGTGTGTTTGGAGTTTG > +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 > I28II;II*2/<5:++,(..*943F@I.('+.35' > @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 > AAAGATGTTAGTGTTTTATACGGAAAGGATATCTC > +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 > 9+*9+7@?F1206,IGI+D122&/0++-.>+6/@? > > Step 2) Then I performed FASTQ groomer at setting as follows: > > a) Input FASTQ quality scores type: Illumina 1.3-1.7 > > b)Advanced Options: Hide Advanced Options. > > Did I choose the right setting for FASTQ groomer? Should I use Advanced > Options? If yes, what is the setting for Advances Options? > > Below is part of groomed dataset: > > @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 > GTTTTCTGAGTGAGAAAAGGTGTGTTTGGAGTTTG > +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 > *!!**!**!!!!!!!!!!!!!!!!'!*!!!!!!!! > @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 > AAAGATGTTAGTGTTTTATACGGAAAGGATATCTC > +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 > !!!!!!!!'!!!!!*(*!%!!!!!!!!!!!!!!!! > > Does the groomed data look right? Is number represnting the member of a > pair correct? Here they are ".1" and ".2", should they be "/1" and "/2"? > > Step 3) Then I ran FASTQ splitter with the groomed files. There is not > setting for the splitter. I chose the right groomed file and then click > "Excute". Below is the description of the splitted dataset: > > empty > format:fastqsanger, database:hg19 > Info: Split 0 of 15277248 reads (0.00%). > > Please help me dela with this problem. > > Thanks. > > Jianguang Du >

2 1

(no subject)
by Du, Jianguang 10 Aug '12

10 Aug '12

1 0

reference genome format for tophat
by i b 10 Aug '12

10 Aug '12

Dear all, I managed to upload to Galaxy a genome of interest in .fasta format from NCIB website. However, Galaxy does not recognize it as input to run Tophat... Wht format has to be to be used as referece genome for tophat?and how can i convert it? Any suggestion? thanks, ib

2 1

Problem with running Cufflinks
by Yan He 10 Aug '12

10 Aug '12

Hi everyone, After mapping my RNA-seq data to the reference transcriptome using Bowtie, I tried to run Cufflinks, but got the following error message. It seems that I need to sort the SAM file got from Bowtie mapping. Dose anyone know how to solve this problem? Many thanks! Error running cufflinks. return code = 1 cufflinks: /lib64/libz.so.1: no version information available (required by cufflinks) Command line: cufflinks -q --no-update-check -I 300000 -F 0.100000 -j 0.150000 -p 8 /galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat [bam_header_read] EOF marker is absent. [bam_header_read] invalid BAM binary header (this is not a BAM file). File /galaxy/main_pool/pool4/files/004/761/dataset_4761476.dat doesn't appear to be a valid BAM file, trying SAM... [03:31:18] Inspecting reads and determining fragment length distribution. Error: this SAM file doesn't appear to be correctly sorted! current hit is at CGI_10025607:534, last one was at CGI_10021217:812 Cufflinks requires that if your file has SQ records in the SAM header that they appear in the same order as the chromosomes names in the alignments. If there are no SQ records in the header, or if the header is missing, the alignments must be sorted lexicographically by chromsome name and by position. Yan

2 1

FASTQ splitter produced empty dataset, please help
by Du, Jianguang 10 Aug '12

10 Aug '12

I have problem to split a paired-end FASTQ dataset into two separate datasets. In order to explain the problem clearly, I list the detail of what I did with my dataset: Step 1) My aim is to compare datasets for the differential alternative splicing. I downloaded paired-end datasets at FASTQ format from SRA of NCBI as original data. Below is part of my paired-end FASTQ dataset that I downloaed from SRA of NCBI, Does this dataset look OK? @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GTTTTCTGAGTGAGAAAAGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 I28II;II*2/<5:++,(..*943F@I.('+.35' @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGTTTTATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 9+*9+7@?F1206,IGI+D122&/0++-.>+6/@? Step 2) Then I performed FASTQ groomer at setting as follows: a) Input FASTQ quality scores type: Illumina 1.3-1.7 b)Advanced Options: Hide Advanced Options. Did I choose the right setting for FASTQ groomer? Should I use Advanced Options? If yes, what is the setting for Advances Options? Below is part of groomed dataset: @SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 GTTTTCTGAGTGAGAAAAGGTGTGTTTGGAGTTTG +SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35 *!!**!**!!!!!!!!!!!!!!!!'!*!!!!!!!! @SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 AAAGATGTTAGTGTTTTATACGGAAAGGATATCTC +SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35 !!!!!!!!'!!!!!*(*!%!!!!!!!!!!!!!!!! Does the groomed data look right? Is number represnting the member of a pair correct? Here they are ".1" and ".2", should they be "/1" and "/2"? Step 3) Then I ran FASTQ splitter with the groomed files. There is not setting for the splitter. I chose the right groomed file and then click "Excute". Below is the description of the splitted dataset: empty format: fastqsanger, database:hg19 Info: Split 0 of 15277248 reads (0.00%). Please help me dela with this problem. Thanks. Jianguang Du

2 1

Install Galaxy on Mac
by Edward Turk 10 Aug '12

10 Aug '12

Hello, Could someone provide instructions for installing galaxy on a Mac OS 10.7? The instructions provided by galaxy start off by asking me to check my python version, but I don't know how to do that. I figure someone has step-by-step instructions or a screen cast? Thank you, Edward

1 0

← Newer
1
2
3
4
5
6
7
8
9
10
Older →

2024

2023

2022

2021

2020

2019

2018

2017

2016

2015

2014

2013

2012

2011

2010

2009

2008

2007

2006

galaxy-user August 2012