September 2013 - galaxy-user - lists.galaxyproject.org

Slice bam
by lilach noy 18 Sep '13

18 Sep '13

hello all, Does anyone know if in order to use Slice bam I need to sort the bam file first or does galaxy automatically sort any bam file uploaded? Many thanks, Lilach Noy

2 1

portal to galaxy restricted
by Elwood Linney 18 Sep '13

18 Sep '13

A message sent earlier this week by me indicated that I could not connect to Galaxy via Fetch to download data. A reply indicated a glitch was fixed. I then could connect with Fetch and I tried to transfer 4 x 16gb files and the connection disconnected about 4 times. Now, once again, I cannot connect with Galaxy online to transfer data. Is this a problem that can be solved-either at my end or at Galaxy? Elwood Linney

2 1

How to calculate GC content of transcripts only including exons from a GTF file
by 师云 18 Sep '13

18 Sep '13

Hi everyone, I want to calculate GC content of transcripts in the gtf file like this: chr1 Cufflinks transcript 3 22 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; chr1 Cufflinks exon 3 10 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "1"; chr1 Cufflinks exon 13 18 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "2"; chr1 Cufflinks exon 20 22 1000 + . gene_id "CUFF.23955"; transcript_id "CUFF.23955.1"; exon_number "3"; and the genome sequence that transcript comes from is: >chr1 GTAGCGTCTCCGACGCGGATATGACCGCACGCTGATGCTCCCAGGGATGAGAGGCGTGCG I have to calculate GC content of the transcript after getting the sequence of the transcript. So how can I get the sequence of the transcript. In this case, it would be AGCGTCTC + ACGCGG + TAT, meaning the transcript sequence would be AGCGTCTCACGCGGTAT. Is it possible in the Galaxy?

2 2

About "Slice BAM" tool
by Yan He 18 Sep '13

18 Sep '13

Hi Jen and other galaxy-users, I was using "Slice BAM" tool on Galaxy to get the alignment overlap with the targeted intervals. After I got the output BAM file, I used "flagstat" to get the detailed information of the output BAM file. What I got from "flagstat" is as following. "13704486 + 0 in total (QC-passed reads + QC-failed reads) 0 + 0 duplicates 2989995 + 0 mapped (21.82%:-nan%) 13704486 + 0 paired in sequencing" What's the QC-passed reads? What's the mapped reads? Should I only get the mapped reads to the targeted intervals? I am very confused. Any help is highly appreciated! Thanks a lot! Best wishes, Yan

2 1

Re: [galaxy-user] Questions about MEME & Sequence logo generator
by Jennifer Jackson 18 Sep '13

18 Sep '13

Hello, Yes, MEME is not on the Main server, but can be used in local, cloud, or slipstream Galaxy installs. For throughput - there are a few MEME-related repositories in the Tool Shed to choose from. How many sequences each can process will likely vary and are related to the hardware the Galaxy instance is run on. Contacting the tool authors is one path or you can try testing using your actual data. Data composition could be an important factor (not just the number of sequences). For the Sequence Logo Generator, I do not know of a hard limit by the tool itself, but as the recommended/supported input is ClustalW output, that tool will most likely be setting the potential upper limit when using the public Main Galaxy instance. Testing will be the best way to learn the limits for your particular data (whether nucleotide or protein), but the success range will be capped in the thousands, not millions (and possibly lower, as length increases). If there is a memory problem or the run time exceeds the limits on the public server, the job will end with an error. Moving to a scaled up server, such as a cloud Galaxy, will give you more control over these types of variables. Some benchmarks are in the Clustal W publication: http://bioinformatics.oxfordjournals.org/content/23/21/2947.long If others would like to post benchmarks from their own experience, that would be welcome! Jen Galaxy team On 9/11/13 2:51 PM, Boaz Shaanan wrote: > Hi, > > Has the MEME module been taken out of the main galaxy server? Assuming > it'll be back, what's roughly a recommended number of sequences to > feed into MEME? It has a limit on the sequences that it can digest but > I don't know what it is. Likewise, what's this limit for the Sequence > Logo Generator? > > Thanks, > > Boaz > > /Boaz Shaanan, Ph.D. > Dept. of Life Sciences > Ben-Gurion University of the Negev > Beer-Sheva 84105 > Israel > > E-mail: bshaanan(a)bgu.ac.il > Phone: 972-8-647-2220 Skype: boaz.shaanan > Fax: 972-8-647-2992 or 972-8-646-1710 / > // > // > / > > / > > > ___________________________________________________________ > The Galaxy User list should be used for the discussion of > Galaxy analysis and other features on the public server > at usegalaxy.org. Please keep all replies on the list by > using "reply all" in your mail client. For discussion of > local Galaxy instances and the Galaxy source code, please > use the Galaxy Development list: > > http://lists.bx.psu.edu/listinfo/galaxy-dev > > To manage your subscriptions to this and other Galaxy lists, > please use the interface at: > > http://lists.bx.psu.edu/ > > To search Galaxy mailing lists use the unified search at: > > http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org

1 0

What's the PV of Galaxy
by liubiao 17 Sep '13

17 Sep '13

Hello Nabble, I am interested the Galaxy and want to set up a local galaxy. Could you address me the PV of galaxy one day? Best Regard, Biao Liu System Engineer Email: liubiao(a)genomics.cn | M. +86 186 7677 1486 China National GeneBank http://nationalgenebank.org/en/index.html Building No.11 | Beishan Industrial Zone | Yantian | Shenzhen China

2 1

MACS on galaxy not responding
by Amit Pande 17 Sep '13

17 Sep '13

Dear Galaxy, I have been trying to run MACS since the past two days but in vain. Could you kindly inform about the problem. My user account : genebuster(a)googlemail.com warm regards, Amit.

2 1

Re: [galaxy-user] FTP Error 530 Sorry, the maximum number of clients (3) for this user are already connected.
by Sobrera, Edwin 17 Sep '13

17 Sep '13

Hello, I too have been repeatedly receving the FTP error as reads in the subject line of the email when trying to connect. I've done everything possible to end all connections, and still get this error. Could you advise if there is any other step that I can take to reset connections? I had a file upload going, but it ended about half-way through and notified me to re-try login. I did try the log on again, and ended up receiving the FTP error message and have been unable to connect since (3 days ago). Thanks, Ross --------------------------------------------------------------------- CONFIDENTIALITY NOTICE: This e-mail message, including any attachments, is for the sole use of the intended recipient(s) and may contain confidential or legally privileged information. Any unauthorized review, use, disclosure or distribution is prohibited. If you are not the intended recipient, please contact the sender by reply e-mail and destroy all copies of this original message. ---------------------------------------------------------------------

2 4

problem with cuffdiff
by Ianiri, Giuseppe 17 Sep '13

17 Sep '13

Hy guys, I am performing some RNA sequencing. I am using a gtf file as a reference annotation for the cufflink - cuffmerge steps. Then when I do the cuffdiff I find something strange. Where there is the gene name, the corresponding values (all of them!) are 0, where there is no gene name there are values of expression, fold change etc. Does anyone have an idea of what is going on? I haven't find any similar question in the Galaxy archive. Also, I tried to visualize my outputs (TopHat Cufflink Cuffmerge) using Trackster but it gives me an error. Is anyone experiencing the same problem? Thanks, Giuseppe

2 1

Unable to visualize the Tophat accepted hits by Trackster tool
by Zhu Pinkuan 16 Sep '13

16 Sep '13

Hello, My name is Pinkuan, and I have been analyzing some RNA-seq data these days, but I confronted a problem when I did the visualization of the Tophat recepted hits with the Trackster tool. When I add the data of Tophat recepted hits to the visualization tool, there turns out to be an error that I can not visualize the data. So, do you have any idea about how to solve this problem? Greatly thanks, Pinkuan

2 2